ID: 1023045832

View in Genome Browser
Species Human (GRCh38)
Location 7:36209428-36209450
Sequence GTATATGCCTAGCTCAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023045832_1023045839 24 Left 1023045832 7:36209428-36209450 CCAAGCCTGAGCTAGGCATATAC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1023045839 7:36209475-36209497 TGTCTGTCGTGGGTGTGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 252
1023045832_1023045835 13 Left 1023045832 7:36209428-36209450 CCAAGCCTGAGCTAGGCATATAC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1023045835 7:36209464-36209486 TTGATGAGAGATGTCTGTCGTGG 0: 1
1: 0
2: 2
3: 21
4: 165
1023045832_1023045838 23 Left 1023045832 7:36209428-36209450 CCAAGCCTGAGCTAGGCATATAC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1023045838 7:36209474-36209496 ATGTCTGTCGTGGGTGTGCAGGG No data
1023045832_1023045836 14 Left 1023045832 7:36209428-36209450 CCAAGCCTGAGCTAGGCATATAC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1023045836 7:36209465-36209487 TGATGAGAGATGTCTGTCGTGGG 0: 1
1: 0
2: 0
3: 18
4: 160
1023045832_1023045837 22 Left 1023045832 7:36209428-36209450 CCAAGCCTGAGCTAGGCATATAC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1023045837 7:36209473-36209495 GATGTCTGTCGTGGGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023045832 Original CRISPR GTATATGCCTAGCTCAGGCT TGG (reversed) Intronic
900231115 1:1558457-1558479 GTATATGCCAGACACAGGCTTGG + Intronic
905658463 1:39701646-39701668 GGAAATGCCTGGCTCAAGCTGGG + Intronic
906929124 1:50151532-50151554 GGATATGCCTAAATGAGGCTGGG - Intronic
912545820 1:110450695-110450717 GTAAATGCCTAGATAAGTCTTGG + Intergenic
913333375 1:117685648-117685670 GTATCAGCCGAGCACAGGCTGGG - Intergenic
914864110 1:151411537-151411559 TTATTTGCCTAGCTCAGCCCTGG + Intronic
916574179 1:166052471-166052493 TTTTATGCCTTGATCAGGCTAGG + Intergenic
921670825 1:217922005-217922027 AGATATGCCCAGCTCAGGTTGGG + Intergenic
1069591938 10:69647574-69647596 GCATATGCCTACTTTAGGCTAGG + Intergenic
1070704866 10:78630370-78630392 GCATTTGCCCAGCTCAGCCTAGG - Intergenic
1071407051 10:85346223-85346245 GTATTTGCCTAGCACAGAATCGG + Intergenic
1073712224 10:106056812-106056834 GTAAATCTCTGGCTCAGGCTTGG + Intergenic
1076139404 10:128067878-128067900 GTCTATGCCCAGGTCAGGCAGGG - Intronic
1076737887 10:132466890-132466912 GTCTAGGCCTGGCTCAGGGTAGG - Intergenic
1078002803 11:7511699-7511721 GTCTTTGCCAAGCCCAGGCTGGG + Intergenic
1081022046 11:37958949-37958971 GTAAAGGTATAGCTCAGGCTGGG - Intergenic
1081343921 11:41959311-41959333 GTTTATGCCTGGATCAGTCTTGG - Intergenic
1086095404 11:83045455-83045477 GTATATGCCAAGCCCAGAGTAGG + Intronic
1091452150 12:579349-579371 CTAGATGCCTAGCTCGTGCTAGG - Intronic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1096982556 12:55736836-55736858 GAAGCTGCCTAGCACAGGCTGGG + Intergenic
1099334225 12:81333122-81333144 GTATTTGCCTAGCTTTTGCTCGG + Intronic
1102779553 12:115552430-115552452 GTAAATGCCTGGTACAGGCTGGG - Intergenic
1108441714 13:50460053-50460075 GTATTGGCCTAGCTCATGGTGGG + Intronic
1109974297 13:69810909-69810931 GTTTCTTCCTAGCTCAGTCTTGG - Intronic
1118862590 14:69676260-69676282 CTATATGACTACCTCAGACTCGG + Intronic
1119926484 14:78499230-78499252 GTAATTGCCTAGCACAGGCCTGG + Intronic
1122209043 14:100163104-100163126 GTCTATCTCTAGCTCAGTCTTGG - Intergenic
1124940322 15:34211603-34211625 GTATGTGCCTTGCTTATGCTTGG - Intergenic
1125847267 15:42868559-42868581 ATATTTGCCTGTCTCAGGCTGGG + Intronic
1133911410 16:10069712-10069734 AGATATGCCCAGCCCAGGCTGGG + Intronic
1136065248 16:27754219-27754241 GTAGATGCCTGGCTCTGGCGTGG - Exonic
1138672391 16:58626110-58626132 GTATATACCAAGTTCAGGCCGGG + Intronic
1144402557 17:14920173-14920195 GAATTTGCCTAGATCTGGCTTGG + Intergenic
1144512732 17:15891309-15891331 GTATATGCCTGTCCCAGGCAAGG + Intergenic
1144628939 17:16860413-16860435 GTGTATCCTTAGCTCAGGCTGGG + Intergenic
1144652470 17:17015702-17015724 GTGTATCCTTAGCTCAGGCTGGG - Intergenic
1145160513 17:20570980-20571002 GTGTATCCTTAGCTCAGGCTGGG + Intergenic
1146065647 17:29632656-29632678 GTCTTTGGCTAGTTCAGGCTGGG + Exonic
1148486124 17:47991830-47991852 GTCTGTGCCTATCTCAGGCTGGG + Intergenic
1150318882 17:64193161-64193183 TTCTATGGCAAGCTCAGGCTCGG + Intronic
1159221905 18:65475633-65475655 ATATATCCCTAGCTCAGTCTGGG + Intergenic
925188321 2:1864425-1864447 GCACATGCCTAGCTGAAGCTGGG - Intronic
931403335 2:61952138-61952160 GTATAGGCCAAGCTCATGATGGG + Intronic
932238816 2:70141977-70141999 GTTTCTGCCTAGCACATGCTGGG - Intergenic
934718983 2:96559784-96559806 GTAGGTGCATAGCTCATGCTTGG - Intergenic
939582168 2:143963206-143963228 GTAAAAGCCTAGCCCTGGCTTGG + Intronic
942494363 2:176523987-176524009 GCATTTGCCCAGATCAGGCTGGG - Intergenic
1169864947 20:10189922-10189944 CTTTATCCCTAGCTCAGGATAGG - Intergenic
1170590748 20:17769867-17769889 GTATATGACTAGGCCAGGCATGG + Intergenic
1173088685 20:39949924-39949946 CCATATGTCTAGCTCTGGCTGGG - Intergenic
1175355207 20:58360305-58360327 GCAGATGCCTAGCTCATCCTGGG + Exonic
1175413360 20:58785815-58785837 CTGTATGCCCAGCTCATGCTAGG + Intergenic
1175715308 20:61251704-61251726 GTACATCCCTAGCCCAGGCCAGG + Intergenic
1181557174 22:23677873-23677895 GCAGCTGCTTAGCTCAGGCTTGG - Intergenic
1181697194 22:24599670-24599692 GCAGTTGCTTAGCTCAGGCTTGG + Intronic
1183575580 22:38686662-38686684 GTAGTTGCCAAGCTCAGGTTGGG - Exonic
1183710726 22:39501948-39501970 GTATATGCTGATCTCTGGCTGGG - Intronic
1184485650 22:44777230-44777252 GTATGTGCCTGTCTCACGCTAGG + Intronic
949537046 3:5004410-5004432 CTAAATGACTTGCTCAGGCTGGG + Intergenic
949778153 3:7655069-7655091 GTACAAGCCCAGCTCAGGCCTGG + Intronic
949813889 3:8038301-8038323 TTATTTACCCAGCTCAGGCTGGG - Intergenic
950888234 3:16379334-16379356 TTTTATGTCTAGCACAGGCTAGG - Intronic
953717172 3:45325775-45325797 GGAGATGCCCAGCACAGGCTGGG + Intergenic
953775391 3:45812330-45812352 CTATATTCCTACCTCAGTCTAGG + Intergenic
953874478 3:46658361-46658383 GCAGATGCCTTGCTAAGGCTGGG - Intergenic
962917118 3:139914321-139914343 GGCTTAGCCTAGCTCAGGCTTGG + Intergenic
966850000 3:184158730-184158752 GTATTTGTCAAGCTCAGGGTAGG + Intronic
969829810 4:9786166-9786188 GTGTGTACCCAGCTCAGGCTGGG - Intronic
970377268 4:15471529-15471551 TAAAATGCCTAGCACAGGCTGGG - Intronic
977729633 4:100335510-100335532 GTATCTTCCTGGCTCAGTCTTGG - Intergenic
986752166 5:10797039-10797061 ATATATGTCTACCGCAGGCTTGG + Intergenic
987212711 5:15699624-15699646 GTATGTGCCTAGAACAGGTTAGG + Intronic
992326630 5:75666283-75666305 CTAGGAGCCTAGCTCAGGCTGGG - Intronic
994424781 5:99571394-99571416 GAATATGCCTAGCTTTGGCTTGG - Intergenic
995757415 5:115523217-115523239 CTAGATGCCTAGATCTGGCTTGG + Exonic
996550517 5:124725363-124725385 TTATATGCCTAGCACAGTCTGGG - Intronic
997754716 5:136385517-136385539 GTATCTGCATAGCTCAAGGTTGG + Intronic
1011219253 6:85036618-85036640 GTCTATGCCTAGCTCATGTAAGG - Intergenic
1023045832 7:36209428-36209450 GTATATGCCTAGCTCAGGCTTGG - Intronic
1025870309 7:65425154-65425176 ATTTATCCCTAGCTTAGGCTTGG - Intergenic
1026224319 7:68427284-68427306 CTATATGCCTAGCACTGTCTTGG + Intergenic
1031086341 7:117305090-117305112 GAATCTGCCTGGCTCAGGGTTGG + Intronic
1035108484 7:156461380-156461402 CTACCTGCCAAGCTCAGGCTGGG + Intergenic
1037663180 8:20944305-20944327 GTGTCTGCCTCCCTCAGGCTAGG - Intergenic
1040539787 8:48342244-48342266 GTAAATGTTTATCTCAGGCTGGG - Intergenic
1042250330 8:66750376-66750398 ATAGGTGCCTGGCTCAGGCTGGG - Intronic
1048793918 8:138130798-138130820 GTCTATGCCCAGCTCTGACTCGG + Exonic
1050888167 9:10790933-10790955 GTCTAAGCCTAGCTGAGACTAGG - Intergenic
1187052781 X:15711270-15711292 GTAGAGGTCTAGCTCAGGCATGG - Intronic
1188411395 X:29876267-29876289 GTATATGCCAACCTCAGAGTGGG + Intronic
1188626998 X:32297565-32297587 ATATATGACTGTCTCAGGCTGGG - Intronic
1193805408 X:85987797-85987819 GTTTATTCCTAGTTCAGTCTTGG - Intronic
1200835932 Y:7731112-7731134 TTTTATGTCTAGCACAGGCTAGG - Intergenic
1201553524 Y:15244180-15244202 GTATCTTCCTCGCTAAGGCTGGG - Intergenic