ID: 1023047414

View in Genome Browser
Species Human (GRCh38)
Location 7:36222740-36222762
Sequence CGGGGTCCCCACTTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023047408_1023047414 3 Left 1023047408 7:36222714-36222736 CCTAGTTCATAGATGGCATCTTC 0: 2
1: 12
2: 65
3: 207
4: 503
Right 1023047414 7:36222740-36222762 CGGGGTCCCCACTTGGTGGAAGG No data
1023047407_1023047414 9 Left 1023047407 7:36222708-36222730 CCATTTCCTAGTTCATAGATGGC 0: 3
1: 23
2: 135
3: 294
4: 597
Right 1023047414 7:36222740-36222762 CGGGGTCCCCACTTGGTGGAAGG No data
1023047405_1023047414 10 Left 1023047405 7:36222707-36222729 CCCATTTCCTAGTTCATAGATGG 0: 5
1: 41
2: 198
3: 424
4: 818
Right 1023047414 7:36222740-36222762 CGGGGTCCCCACTTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023047414 Original CRISPR CGGGGTCCCCACTTGGTGGA AGG Intronic
No off target data available for this crispr