ID: 1023048043

View in Genome Browser
Species Human (GRCh38)
Location 7:36228596-36228618
Sequence CTGCAGACACAGCTGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 694
Summary {0: 1, 1: 0, 2: 8, 3: 86, 4: 599}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023048043 Original CRISPR CTGCAGACACAGCTGGGGCC AGG Intronic
900088796 1:910336-910358 CGGGAGACCCCGCTGGGGCCGGG - Intergenic
900091435 1:922473-922495 TGGCAGCCACAGCTGGGGTCAGG + Intergenic
900151756 1:1181980-1182002 GTGCACACAGAGCTGGGGCAGGG + Intronic
900184437 1:1326314-1326336 AAGCAGAGACAGGTGGGGCCGGG - Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900291965 1:1927456-1927478 CTTCAGACACAGCTGGATCCAGG - Intronic
900344766 1:2205350-2205372 CCGAGGACACAGCTGGGGCGGGG - Intronic
900345196 1:2207192-2207214 CTGCTGGCAGAGCTGGGTCCTGG + Intronic
900410715 1:2511286-2511308 CTGGGGACACAGCGGGGCCCGGG - Intronic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900500786 1:3003551-3003573 TTGCAGAGCCCGCTGGGGCCTGG + Intergenic
900570340 1:3355197-3355219 CTGCAGCTGCATCTGGGGCCAGG + Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900653029 1:3740277-3740299 CTGCACAGACAGCTGCGACCAGG - Intergenic
900804716 1:4759877-4759899 CTCCATCCACAGCTGGAGCCTGG - Intronic
900827151 1:4935894-4935916 TTGCAGACACTGCTGAAGCCAGG + Intergenic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901207524 1:7505510-7505532 GTGCAGGCCCAGATGGGGCCGGG + Intronic
901783847 1:11611757-11611779 CTTCAGACACAGCTGAATCCAGG + Intergenic
901862134 1:12081212-12081234 CTGCTCACTCTGCTGGGGCCTGG - Intronic
902200517 1:14830123-14830145 CTTCAGGCACAGCTGGATCCAGG + Intronic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902206367 1:14871081-14871103 CTGAAGACACACCTGGGCTCAGG - Intronic
902246157 1:15122185-15122207 CTTTGGACACAGCTGGCGCCAGG + Intergenic
902257099 1:15196976-15196998 CTTCAGACACAGCGGGATCCAGG + Intronic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
902648798 1:17823132-17823154 CTACGGGCATAGCTGGGGCCAGG - Exonic
902774688 1:18667159-18667181 CAGCACACACAGCTAGGGTCAGG - Intronic
903606101 1:24576225-24576247 CTCCTGACAAAGCTGGGGGCTGG + Intronic
903813173 1:26046051-26046073 CTGCAGCCGCAGCGGGAGCCGGG - Exonic
904462497 1:30688523-30688545 CTGCAGACAACTCTGTGGCCAGG + Intergenic
904504002 1:30935922-30935944 CTGCAGACACCACAGGGCCCAGG - Intronic
904505466 1:30949351-30949373 CTGCAGACACCACAGGGCCCAGG - Intronic
904784237 1:32973409-32973431 CAGCAGACACAGCGGGGGATGGG + Intergenic
905371592 1:37485387-37485409 GTGCAGAGACAGCGGGGGCTTGG - Intergenic
905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG + Exonic
905682719 1:39885703-39885725 CTGCAGTCCCAGCTGGGGTGGGG - Intergenic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907332695 1:53681582-53681604 CTGCTGACAAAGCAGGGGACTGG + Intronic
907407973 1:54265414-54265436 CTGCACACCCAGCATGGGCCTGG + Intronic
908120073 1:60978080-60978102 CTTCAGACACAGCTTGACCCAGG + Intronic
909056228 1:70824540-70824562 CTGGAGACATAGTCGGGGCCAGG - Intergenic
909392500 1:75133350-75133372 CTGCTGACCGAGCTGGGGTCTGG + Intronic
909803162 1:79840090-79840112 CTGCAGAAACAGGTGTAGCCAGG + Intergenic
910216211 1:84847587-84847609 CAGCAGGCACAGCTGAGGACAGG - Intronic
911669670 1:100593529-100593551 CTCTGGACACACCTGGGGCCTGG - Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912572436 1:110634333-110634355 CTGGAGACCAAGGTGGGGCCAGG - Intergenic
912713916 1:111968635-111968657 CTGCAGACACTTCTGGTTCCAGG - Intronic
912790471 1:112644486-112644508 TTGAATACAAAGCTGGGGCCAGG - Intronic
913230511 1:116737045-116737067 CTGCAGATACAGATGGGGTCTGG + Intergenic
914044552 1:144079756-144079778 CTGCAGACACAGCTTCTCCCCGG + Intergenic
914133558 1:144880930-144880952 CTGCAGACACAGCTTCTCCCCGG - Intergenic
914451643 1:147798069-147798091 CTGCAGTCACAGCTGGGCTCAGG + Intergenic
915300252 1:154947605-154947627 CTCCAGAGGCAGGTGGGGCCTGG - Intronic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915556430 1:156663423-156663445 CTGGAGACACAGCTGAGTCATGG + Intergenic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
916962459 1:169903169-169903191 CTCCAGACAAAGGTTGGGCCAGG + Intergenic
917737915 1:177937213-177937235 CTGCAGACACACCTGGGCCCTGG - Exonic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG + Intergenic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920665378 1:207959418-207959440 CTGCAGACCCGGCCGCGGCCGGG + Intergenic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
922899120 1:229122771-229122793 CTGCAGTCAAAGCAGGAGCCAGG + Intergenic
923022395 1:230175035-230175057 CTAGAGACACAGCAGGGGCCAGG - Intronic
924145918 1:241074487-241074509 CTTCAGGTACAGCTGGAGCCAGG + Intronic
924486564 1:244489517-244489539 CTGAAGAGACAGCTGGAGTCAGG + Intronic
1062860428 10:805700-805722 CTGCAGAAGCAGCCGGGGACAGG + Intergenic
1063203231 10:3806142-3806164 CTGCAGACACACCTGGAGGGAGG + Intergenic
1063535265 10:6876832-6876854 CTGCGCACACACCTGGGGCTGGG + Intergenic
1064097172 10:12432363-12432385 TGGCAGATCCAGCTGGGGCCTGG + Intronic
1064354217 10:14603782-14603804 AGGCAGACAAAGCCGGGGCCGGG - Intronic
1065374465 10:25024128-25024150 CTGCAGACATACCTGCTGCCAGG + Exonic
1066459363 10:35599678-35599700 CTTCAGAAACAGCAGAGGCCGGG - Intergenic
1067249196 10:44573083-44573105 CTGCAGGCATAGCTGGATCCAGG - Intergenic
1067296392 10:44977432-44977454 CTGAGGACACTGCTGGGGCGGGG + Exonic
1067416341 10:46106207-46106229 GCGCGGTCACAGCTGGGGCCAGG + Intergenic
1067560354 10:47300686-47300708 CAGCAGCAGCAGCTGGGGCCCGG - Exonic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069411103 10:68154336-68154358 CTGCTGAAGCAGCTGGGGCCAGG - Intronic
1069510376 10:69037706-69037728 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1070760271 10:79019966-79019988 CTTCAGCCACAGCTGGGAGCTGG - Intergenic
1071771982 10:88739450-88739472 CTGAAGACACTGCTGAGGACAGG + Intronic
1072009378 10:91290277-91290299 CTGCAGAAAGAGGTAGGGCCGGG + Intergenic
1072115502 10:92366742-92366764 GTGCAGAGACACCTGGGGCTGGG + Intergenic
1072310508 10:94149828-94149850 CTTCAGAGACAGCAGGGGCTGGG + Intronic
1073041847 10:100613179-100613201 CTTCAGCCACTGCTTGGGCCCGG + Intergenic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1073191111 10:101651192-101651214 CCGCTCACAGAGCTGGGGCCTGG - Intronic
1073248932 10:102110032-102110054 CTCCACACACACCTGGGGACAGG + Exonic
1073452362 10:103617466-103617488 CTGCTGCCACCTCTGGGGCCTGG - Intronic
1074910663 10:117905687-117905709 CTGCAGACAGAGCTCAAGCCTGG + Intergenic
1074922089 10:118024915-118024937 CTGCAGAGATGGCTGGGGCTAGG - Intronic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1075715669 10:124553834-124553856 CTGCAGACAGAGGAGGGGCCTGG - Intronic
1076132352 10:128022205-128022227 CTGCCGACTCAGGAGGGGCCTGG - Intronic
1076497611 10:130907221-130907243 CTGCAGGCCCTCCTGGGGCCGGG + Intergenic
1076724873 10:132408593-132408615 CTGCAGGAGCGGCTGGGGCCAGG - Intronic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1077076269 11:703600-703622 TTGGAAACACAGGTGGGGCCTGG - Intronic
1077095508 11:797425-797447 CTGCAGCCCCAGCCGGGCCCCGG + Intronic
1077230620 11:1456817-1456839 GTGCAGCCACAGCTCGGGGCAGG - Intronic
1077243003 11:1521017-1521039 CGTCAGAAGCAGCTGGGGCCAGG + Intergenic
1077488952 11:2851653-2851675 CTGAGCACCCAGCTGGGGCCAGG - Intergenic
1077522881 11:3046652-3046674 CTCCAGACTCCGTTGGGGCCTGG - Intronic
1077701231 11:4444060-4444082 CAGCTAACACAGCTGGGACCAGG + Intergenic
1077917690 11:6621995-6622017 CAGCAAACACAGCTGCAGCCCGG - Exonic
1078436154 11:11327613-11327635 CTGCAGACCCAGCAGTGGCTTGG + Intronic
1078658111 11:13261174-13261196 CCGCAGACAGAGCTGAGCCCTGG + Intergenic
1078670092 11:13356933-13356955 CTGCAGACACACAAGGGGACTGG - Intronic
1078761233 11:14253508-14253530 CTGCAGACCCGACTGGGGCCTGG - Intronic
1079032262 11:16994502-16994524 CTGCGGACATAGGTGGGGGCTGG + Intronic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1080607573 11:33876348-33876370 CTGAAGACACAACTGGGAACAGG - Intronic
1080640524 11:34155796-34155818 CTGCAGCCCCTGCTGGAGCCTGG + Intronic
1080767748 11:35312292-35312314 CTCAAGAAGCAGCTGGGGCCTGG - Exonic
1081659077 11:44876981-44877003 CTGCAGGCTCTGCAGGGGCCTGG - Intronic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1083235729 11:61349621-61349643 CTGCTGCTACAGCTGAGGCCTGG - Exonic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1083876900 11:65529068-65529090 CCCCACACACGGCTGGGGCCGGG - Intronic
1083888010 11:65582109-65582131 CTGCAGGCTCCGCTGGGGGCAGG - Exonic
1084360359 11:68665040-68665062 CACCAGACACAGCTGGGGACTGG + Intergenic
1084378723 11:68796960-68796982 CCGCAGGCTCAGCAGGGGCCAGG + Intronic
1084409834 11:69000396-69000418 CTTCAGACACAGCTGGATCCAGG - Intergenic
1084520786 11:69661424-69661446 CTGCAGACACTGCTGGCCTCTGG - Intronic
1084647076 11:70464831-70464853 CTGCAGACATTGCCTGGGCCAGG + Intergenic
1085053498 11:73391447-73391469 TGGCAGCCACAGCTGGGGGCTGG + Intronic
1085386360 11:76160451-76160473 CTGGAGAGAGACCTGGGGCCCGG + Intergenic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1089143334 11:116305838-116305860 CTGGAGACATAGGTTGGGCCAGG + Intergenic
1089191083 11:116653770-116653792 CTGCATACACTGCTGGGCACAGG - Intergenic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1089685934 11:120146944-120146966 CTGGGGACACAGCTGAGCCCAGG + Intronic
1089751433 11:120654154-120654176 CTGTAGTCAAAGCAGGGGCCTGG + Intronic
1089834050 11:121354370-121354392 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090543849 11:127739730-127739752 CAGCAGAAAAAGATGGGGCCAGG + Intergenic
1091403019 12:192393-192415 CAGGACACACAACTGGGGCCAGG - Intronic
1091438202 12:490909-490931 CTGCAGACCCATCTGGGCCTGGG - Intronic
1091564647 12:1639564-1639586 CTGCTGACACCCCTGGGGCAGGG - Intronic
1092141143 12:6184324-6184346 TTGCAGACAGAGGAGGGGCCAGG - Intergenic
1094713400 12:32987193-32987215 CAGGAAACAAAGCTGGGGCCTGG - Intergenic
1096244184 12:49975220-49975242 CTGCAGCCGTGGCTGGGGCCTGG - Intronic
1096258453 12:50076697-50076719 CTGCTGACAGAGCTGGGGGCAGG + Intronic
1097899186 12:64856691-64856713 CTCTAGACACACCTGGGGCCTGG - Intronic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1102111792 12:110370807-110370829 CTCCAGGCACGGCTGTGGCCAGG - Intergenic
1102229898 12:111255422-111255444 CAGCAGACACACCTGGAGGCAGG + Intronic
1102560381 12:113757815-113757837 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1103935013 12:124471009-124471031 CTGCCCACGCCGCTGGGGCCCGG + Intronic
1103942661 12:124509396-124509418 CTTCAGGCACAGTTGGGTCCAGG - Intronic
1103968117 12:124652944-124652966 CTGCAAAGACAGCTGCTGCCAGG - Intergenic
1104222980 12:126803739-126803761 CTTCAGGAACAGCTGGAGCCTGG - Intergenic
1104377415 12:128277259-128277281 CTTCAGGCACAGCTGGATCCAGG + Intronic
1104474882 12:129063174-129063196 CTGAAGACACTGCAGGTGCCAGG + Intergenic
1104517978 12:129445613-129445635 CTTCAGGCACAGCTGGATCCAGG - Intronic
1104684720 12:130777415-130777437 CTTCAGACCCAGCTGGATCCTGG + Intergenic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1104729441 12:131096990-131097012 CTGCAGCCACAGCAGAGGCGTGG - Intronic
1104910396 12:132237628-132237650 CTGCAGAGGCAGCTGTGGGCAGG - Intronic
1105294601 13:19076701-19076723 AAGCAGGCACAGCTGGTGCCAGG - Intergenic
1105430856 13:20336216-20336238 CTGCAGACACGTCAGGGGGCAGG - Intergenic
1106433990 13:29707992-29708014 TTGCAGACAGAGGTGGAGCCGGG - Intergenic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1107389691 13:39951355-39951377 ATTCAGACACAGCTCGGGGCTGG - Intergenic
1107966165 13:45600087-45600109 CTGCAGACATAGCTGTGGTTGGG - Intronic
1108001309 13:45907810-45907832 CTGCAGAGACAGCAGAGGTCTGG + Intergenic
1108023027 13:46148323-46148345 CTCCAAACACAACTGGGACCTGG + Intronic
1110568611 13:76980388-76980410 CTGCAGCCTCCGCAGGGGCCGGG - Intergenic
1112793307 13:103027840-103027862 CAACAGACCCAGCTGGAGCCTGG - Intergenic
1112805168 13:103156789-103156811 GTGCAGGCAAAGCTGGGGCAGGG - Intergenic
1113467811 13:110524509-110524531 CTCCAGCCATGGCTGGGGCCAGG - Intronic
1113518966 13:110924766-110924788 CAGCAGACAGAGCTGGGTCCAGG - Intergenic
1113812968 13:113153490-113153512 CAGCAGGCACAGCTGGGTCCAGG + Intergenic
1113945731 13:114043110-114043132 TTGCAGACAAAGGAGGGGCCTGG - Intronic
1114221247 14:20699411-20699433 CTGCTGACCCTGCTGGGGCTGGG + Exonic
1114618811 14:24082595-24082617 CTGCAGCAGCAGCTGGGGGCTGG - Exonic
1115934546 14:38536994-38537016 GTGGAGACACAGCTAAGGCCGGG - Intergenic
1116297835 14:43135876-43135898 CTCCACCCACAGCCGGGGCCGGG - Intergenic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1116992188 14:51288150-51288172 CTGAAGATGCATCTGGGGCCAGG + Intergenic
1117658666 14:57982405-57982427 CTGTGGACATAGCTGGTGCCTGG - Intergenic
1117694097 14:58340778-58340800 CTTAAGACACAGGTGGGGCCGGG - Intronic
1118648753 14:67867745-67867767 GTCCAGAAACAGCTGGGGCTGGG - Intronic
1119264519 14:73256070-73256092 CTGGTGCCTCAGCTGGGGCCTGG + Intronic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119507694 14:75187104-75187126 CTTCAGGCACAGCTGTGTCCAGG - Intergenic
1121432429 14:93897297-93897319 CTGCAGGTACAGCTGGCTCCAGG - Intergenic
1121493759 14:94378160-94378182 CTCCAGAAACAGATGGGCCCAGG + Exonic
1121638300 14:95468422-95468444 CTGGAGGCTCAGCTGGGCCCTGG - Intronic
1122227234 14:100286843-100286865 CAGCAGGATCAGCTGGGGCCAGG - Intergenic
1122272861 14:100576156-100576178 CTGCATGGCCAGCTGGGGCCAGG - Intronic
1122783703 14:104154423-104154445 CTGCGGCCACAGGTGGGGCCTGG + Intronic
1122894224 14:104748001-104748023 CTACTGACACGGCAGGGGCCTGG + Intergenic
1123122825 14:105926025-105926047 CTGCAGAGGCTGCTGAGGCCTGG + Intronic
1202936436 14_KI270725v1_random:92317-92339 CTGCAGACACAGCTTCTCCCTGG - Intergenic
1124254112 15:28127229-28127251 CTGCAGACGCAGCTGGGCATAGG + Intronic
1124431196 15:29610058-29610080 CTACAGACTCTACTGGGGCCTGG + Intergenic
1125516468 15:40323869-40323891 CTGCAGCCGCCGCCGGGGCCTGG - Intergenic
1125635517 15:41185170-41185192 CTGCTAACGCAGCTGAGGCCAGG - Intronic
1125827593 15:42689489-42689511 CTGCAGACAGAGATGTGGCCTGG - Exonic
1125972865 15:43926281-43926303 CTGCAGAGACCACTGGGGACAGG - Intronic
1126013381 15:44325782-44325804 CAGCATTCATAGCTGGGGCCAGG + Intronic
1126621379 15:50643365-50643387 CTGCAGTTACAACTGGAGCCTGG - Exonic
1126696349 15:51329309-51329331 CTCCAGACTCAGCAGGAGCCAGG + Intronic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127801691 15:62482787-62482809 CTGCAGACCCAGCGGTGGCCAGG + Intronic
1127906417 15:63379626-63379648 CTGCAGACCCAGCTGGTACTGGG + Intronic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128532519 15:68464421-68464443 TTGCAGACACAGGTGAGGCCAGG + Intergenic
1128720158 15:69942096-69942118 CTGCAGAAACGCCTGAGGCCTGG - Intergenic
1129821425 15:78604629-78604651 ATGCAGACCCAGCTGGAGACTGG + Intronic
1130849838 15:87782172-87782194 CTTCAGGCACAGCTGGAACCAGG + Intergenic
1130910832 15:88269799-88269821 CTGCAGACATGCCTGGAGCCTGG + Intergenic
1131267300 15:90924262-90924284 CTGCAGACCCAGCTGGTCCTGGG - Intergenic
1131346855 15:91657425-91657447 CTGCAGAGTCAGCTTTGGCCGGG - Intergenic
1132256996 15:100384525-100384547 TTGCTGTCACAGCTGGGGCCTGG - Intergenic
1132270636 15:100520808-100520830 CAGCAAGCACAGCTGGTGCCGGG + Intronic
1132634974 16:939589-939611 CCGCAGACACAGCAGGGTCGAGG - Intronic
1132708768 16:1257443-1257465 CTACAGACAAGGCAGGGGCCTGG + Intronic
1132725502 16:1336601-1336623 CCACAGACACAGCAGGGGCCCGG + Intronic
1132810621 16:1795014-1795036 ACGCAGACTCAGCAGGGGCCTGG + Intergenic
1133161217 16:3913035-3913057 CTGCAGTTTCAGCTGGGGCTGGG - Intergenic
1133216759 16:4297241-4297263 CTGCAGCCCCAGCTGGGACCAGG + Intergenic
1134103442 16:11469139-11469161 GTGCAGACACAGGTGGGCCTAGG + Intronic
1134108418 16:11499727-11499749 GTGAAGACACAGCTGGTGCCAGG - Intronic
1134270797 16:12731416-12731438 CAGCAGAGACTGCTGGGGCATGG + Intronic
1134282208 16:12827138-12827160 CTGAAGACTCAGCTGGGGAAAGG + Intergenic
1134322237 16:13174515-13174537 CTGGAGACAGAACTGGGGGCAGG + Intronic
1135419673 16:22297463-22297485 CTGCAGAGACGGCGGCGGCCCGG - Exonic
1135627641 16:24010134-24010156 CTTCAGAGCCAGCAGGGGCCAGG + Intronic
1135644813 16:24152587-24152609 TTCCAGAGAGAGCTGGGGCCGGG - Intronic
1136079686 16:27843678-27843700 CTTCAGACACAGCTGGATCCAGG - Intronic
1137451329 16:48577529-48577551 TTGCAGCCACAGCTGCAGCCTGG + Intronic
1137467687 16:48725803-48725825 CTGCAGAAACTGCTGGGACCAGG + Intergenic
1138094283 16:54199951-54199973 CAGCTGACAGAGCAGGGGCCGGG + Intergenic
1138155150 16:54696159-54696181 CAGCAGACATAGCTGGGCCCTGG - Intergenic
1138346128 16:56321315-56321337 CTGCAGGCGCAGCTGGATCCAGG + Intronic
1138386632 16:56639769-56639791 CTGGGGACAGAGCTTGGGCCAGG + Intronic
1138447285 16:57072099-57072121 CTTCAGGCACAGCTGGATCCAGG + Intronic
1138519953 16:57565429-57565451 CTTCAGACATAGCTGGATCCAGG + Intronic
1138608659 16:58105737-58105759 CTGCAGACAGAGGAGGGGCCAGG - Intergenic
1138918784 16:61501196-61501218 CTGCTGACATAGCTGGATCCCGG - Intergenic
1139706950 16:68747343-68747365 CTGCAGAGGCAGCTGGGCCAGGG + Intronic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1140212426 16:72981122-72981144 CTTTAGAGATAGCTGGGGCCCGG - Intronic
1140808484 16:78554849-78554871 CTGAAGACAGAGGTGGGACCTGG + Intronic
1141107202 16:81243355-81243377 CTGCAGAAATAACGGGGGCCAGG - Intronic
1141440924 16:84029140-84029162 CTGCAGTCAGACCTGAGGCCTGG - Intronic
1141628592 16:85274871-85274893 CTGCAGATGCATGTGGGGCCTGG + Intergenic
1141650935 16:85392826-85392848 CTGGAGAGGCGGCTGGGGCCAGG + Intergenic
1141725699 16:85787025-85787047 CGGCAGACACTGCTTGGTCCAGG + Intronic
1141854607 16:86672597-86672619 CTGCTCACACAGCTGGAACCCGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142126430 16:88412920-88412942 CCACAGCCACAGCCGGGGCCCGG + Intergenic
1142283747 16:89162539-89162561 GTGCAGCCGCACCTGGGGCCCGG - Intergenic
1143348767 17:6271260-6271282 CAGCACCTACAGCTGGGGCCAGG - Intergenic
1143516683 17:7422764-7422786 CTGCAGCCACCGGTGAGGCCTGG + Intergenic
1144956062 17:19019528-19019550 CTGCAGTCACTGGTGGGGCCAGG - Exonic
1145061518 17:19737228-19737250 GAGCAGGCACAGGTGGGGCCAGG + Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146354864 17:32125464-32125486 CTGGAGAAGCAGCAGGGGCCTGG - Intergenic
1146654381 17:34626596-34626618 CTGCCGCCTCAGCGGGGGCCTGG + Intronic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1147690811 17:42313235-42313257 CCTCACACACAGGTGGGGCCTGG - Intergenic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1149488058 17:57059882-57059904 CTTCAGACACAGTTGGATCCAGG - Intergenic
1149996537 17:61408809-61408831 CTGCAGGGACCGCTGGGCCCTGG - Exonic
1151386004 17:73755820-73755842 CTGGAGCCTCAGCTGAGGCCTGG - Intergenic
1151460838 17:74253180-74253202 CTGCAGCTACAGCAGTGGCCTGG + Exonic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1151705059 17:75763109-75763131 CTGCTGACACACCTGGGCGCGGG + Exonic
1151807733 17:76417024-76417046 CAGCACACACAGCTGGGGAGTGG - Intronic
1151973519 17:77471300-77471322 CTTCAGAGACAGCAGGGGGCTGG - Intronic
1152246726 17:79188350-79188372 CTGCAGTCTCTGCTGGGGCCAGG - Intronic
1152678830 17:81655387-81655409 CTCCAGACACAGAGAGGGCCTGG - Intronic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1152941906 17:83177223-83177245 CTGCAGAGCCTGCTGGAGCCGGG + Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1154156518 18:11948071-11948093 CTGCAGCCGGAGCTGGAGCCAGG + Intergenic
1154199328 18:12288242-12288264 CAGCTGAGACAGCTGGGGCGGGG + Intergenic
1154218164 18:12431127-12431149 CTGCAGAGACACCAGGGGTCGGG - Intronic
1155166722 18:23237836-23237858 CTGCAGACACCAGAGGGGCCTGG + Intronic
1156347967 18:36274881-36274903 CTGCAAACAAACCTGGGGGCTGG + Intergenic
1157029076 18:43882539-43882561 TTCCAGTCACAGCTGAGGCCAGG + Intergenic
1157617711 18:48997040-48997062 CCCCAGACACTGCTGCGGCCTGG + Intergenic
1157713280 18:49864529-49864551 AAGCAGTCAAAGCTGGGGCCTGG + Intronic
1157876231 18:51276227-51276249 CTGTCGGCTCAGCTGGGGCCAGG + Intergenic
1158306069 18:56107001-56107023 CTGAAGACTGAACTGGGGCCCGG + Intergenic
1158572940 18:58612113-58612135 CTGCAGACACTGCAGGGGAATGG + Intronic
1158606465 18:58900519-58900541 CTGCAGAGACAGCCAGGCCCTGG - Intronic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1159924000 18:74250569-74250591 GTGCAGACACAGATGGCGTCCGG - Intergenic
1160143438 18:76346613-76346635 GTGCAGGCTCAGCTGAGGCCAGG - Intergenic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160438715 18:78871987-78872009 CTGCAGAGAAAGGTGGGGGCTGG - Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160538726 18:79609242-79609264 CTGCACCAACAGCTGGGCCCAGG + Intergenic
1160586113 18:79914573-79914595 CTCCAGACGCAGCTTGGGCAAGG - Intronic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1160849953 19:1185871-1185893 TTTCAGACACAGCTGGATCCAGG + Intronic
1160938169 19:1607454-1607476 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1161455179 19:4366376-4366398 CTTCAGGCACAGCTGGATCCCGG - Intronic
1161782346 19:6301559-6301581 CTGCAGACCTGGCTGGGTCCAGG - Intergenic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162496879 19:11028313-11028335 CTTCAGGCACAGCTGGATCCAGG + Intronic
1162524478 19:11199435-11199457 CAGCACAGACAGCTGAGGCCCGG + Exonic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1162716863 19:12639836-12639858 CCCCCTACACAGCTGGGGCCAGG - Intronic
1162928368 19:13942223-13942245 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163125766 19:15243392-15243414 CTGGTGACACGGCTGGGGGCCGG + Exonic
1163196271 19:15723304-15723326 TTTCAGACACAGCTGGGGTGGGG + Intergenic
1163283337 19:16330724-16330746 CAGCTGACACAGCTCAGGCCGGG - Intergenic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1163518532 19:17778972-17778994 CTGGAGACACAGCCAGGACCAGG + Intronic
1163638629 19:18449518-18449540 CTCCAGCCACAGCAGGGGACGGG + Intronic
1163638767 19:18450136-18450158 CTGCAGTCAGAGCTGGGGCCTGG + Intronic
1163662904 19:18589183-18589205 CTGCAGAGTCAGATGGGGCGGGG + Intronic
1163668893 19:18616237-18616259 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG + Intergenic
1164678764 19:30120238-30120260 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1164763233 19:30743827-30743849 CTGCAGAGGCAGCTAGGGGCTGG + Intergenic
1165059448 19:33197970-33197992 CAGCAGACAGGGCTGGGGCTAGG - Intronic
1165067648 19:33238444-33238466 CTGCAGACACAGACGGGAGCAGG + Intergenic
1165427047 19:35752119-35752141 CTGCCCACCTAGCTGGGGCCTGG + Intronic
1165448255 19:35868571-35868593 CTCCTGTCACCGCTGGGGCCGGG + Exonic
1165633061 19:37317898-37317920 CTGCAGACCCAGCCTGTGCCGGG - Intronic
1166053852 19:40277097-40277119 CTTCACACACAGCTGGGGACAGG + Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166101942 19:40576375-40576397 CTGGAGAAGCCGCTGGGGCCCGG + Exonic
1166122715 19:40694960-40694982 CTGGAGACACAGCAGTGACCTGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166361612 19:42254967-42254989 CGGCGGACACAGGTGGGGGCGGG - Exonic
1166898033 19:46036288-46036310 CTGCAGCCACAACTTGGGCAGGG - Intergenic
1166916018 19:46196571-46196593 CTGGAGGCTCAGCTGGGGTCGGG - Intergenic
1166934302 19:46321770-46321792 CTGCAGACACCCCTGGCCCCCGG + Exonic
1167097180 19:47380734-47380756 CTTCAGGCACAGCTGGATCCAGG + Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167374337 19:49103066-49103088 CTGCAGACGCAGCTGGTGGGAGG + Intronic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
1168331599 19:55573136-55573158 CTGAAGACAGTGCTTGGGCCTGG - Intergenic
1202684111 1_KI270712v1_random:33175-33197 CTGCAGACACAGCTTCTCCCCGG + Intergenic
925238078 2:2296839-2296861 CTGCACACACCGGTGAGGCCTGG - Intronic
927041582 2:19235986-19236008 CTTCACAAACACCTGGGGCCAGG - Intergenic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
927927865 2:27025784-27025806 CTGCAGACACCCCAAGGGCCTGG - Intronic
928201194 2:29248608-29248630 CGCCAGACAGTGCTGGGGCCCGG + Intronic
928230253 2:29492543-29492565 GTGCAGAAACAGCTAGGCCCTGG - Intronic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
928983165 2:37156746-37156768 GTGCTGACCCAGCCGGGGCCAGG + Intronic
929919355 2:46161528-46161550 CTGCCAGTACAGCTGGGGCCTGG - Intronic
931691371 2:64837367-64837389 CTGCCTACACAGGTGGGGACAGG - Intergenic
932716266 2:74102209-74102231 CCACAGAGACAGCTCGGGCCAGG - Exonic
932764430 2:74460991-74461013 CAGCAGACAGTGCTGAGGCCTGG + Intergenic
934304755 2:91811903-91811925 CTGCAGACACAGCTTCTCCCCGG + Intergenic
934328502 2:92040847-92040869 CTGCAGACACAGCTTCTCCCCGG - Intergenic
934466877 2:94271353-94271375 CTGCAGACACAGCTTCTCCCCGG - Intergenic
934553730 2:95276875-95276897 CTGCAGAGCCCGGTGGGGCCTGG + Intronic
934747627 2:96769947-96769969 CAGCTGACAGAGCTGTGGCCAGG + Intronic
934870648 2:97861772-97861794 CTACAGACCCACCTGGGACCTGG + Intronic
934943290 2:98518253-98518275 CTGCAGACACGGCAGTGGCCTGG - Intronic
935734919 2:106098831-106098853 CTGCAGACACGCCTGTGGTCTGG - Intronic
935813030 2:106818115-106818137 CTCAAGACCCACCTGGGGCCAGG + Intronic
936092090 2:109507994-109508016 CTTCAGGCATAGCTGGGTCCAGG + Intergenic
936462087 2:112721638-112721660 CTTCAGACACACATGGGTCCAGG + Intronic
937337217 2:121069374-121069396 CTACAGACCCAGGTGGGCCCTGG + Intergenic
938107945 2:128546036-128546058 CTGCACCCACAGCTTGGGCGAGG + Intergenic
938277456 2:130038555-130038577 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938328426 2:130429358-130429380 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938361520 2:130692136-130692158 CTTCAGTCACAGATGGGGGCTGG + Intergenic
938437927 2:131298825-131298847 CTTCAGTCACAGATGGGGGCTGG + Intronic
940582745 2:155601529-155601551 CCACAGAAACAGCAGGGGCCAGG - Intergenic
940957051 2:159739162-159739184 CTACAGCCACAGCTGGGTCAGGG + Intronic
941001260 2:160205721-160205743 GGGCAGGCCCAGCTGGGGCCTGG - Intronic
942342197 2:174960545-174960567 ATTAAAACACAGCTGGGGCCGGG + Intronic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
942489097 2:176472102-176472124 CTGCAGGCACAGCTGTGTGCTGG + Intergenic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
944022796 2:195126062-195126084 CCGCAGCCTCAGCTGGGGCTTGG + Intergenic
944512452 2:200477895-200477917 CTGCAGACACCTCGGAGGCCAGG + Exonic
945092979 2:206193381-206193403 AAGAAAACACAGCTGGGGCCAGG - Intronic
945298298 2:208192622-208192644 CAGCAGCCTCAGCTGGGGGCAGG - Intergenic
946804041 2:223452042-223452064 CTGCAGGCAGAGCTGGCGCAGGG + Intergenic
947005402 2:225505813-225505835 CTGCAGACATAGCTATAGCCAGG + Intronic
947794563 2:232885791-232885813 CTGCAGTGACACATGGGGCCCGG + Intronic
947820252 2:233064128-233064150 CTGCAGGAGCAGCTGGGGCCCGG + Intronic
948428087 2:237901294-237901316 CTGCAGACACCACCGGGGCAGGG - Intronic
948434415 2:237943627-237943649 CTGCCGACTCAGTAGGGGCCGGG - Intergenic
948568979 2:238905431-238905453 CAGCAGACATGGCTGGGGTCAGG + Intronic
948830645 2:240596853-240596875 ATGCGGACGCAGCGGGGGCCAGG - Exonic
1169077229 20:2768604-2768626 CTACAGAGTCAGGTGGGGCCAGG + Intergenic
1169778537 20:9283227-9283249 ATGCAGCCTCAGCTGGGGGCAGG - Intronic
1169901758 20:10560235-10560257 CTGTAGACAGGGATGGGGCCAGG - Intronic
1171199997 20:23233171-23233193 CAGCAGTCACAGCTGGGGTTGGG - Intergenic
1171339655 20:24417474-24417496 CTGAAGACACAGGTGCGGGCGGG + Intergenic
1171792036 20:29536190-29536212 TAGAAGACACAGCTGGGGGCCGG + Intergenic
1171879181 20:30604045-30604067 AAGCAGGCACAGCTGGTGCCAGG - Intergenic
1172094063 20:32452178-32452200 CTGCAGACCCAGCTGGGTGCTGG + Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172749952 20:37243819-37243841 CTGCAGACTCAGATGGGAGCTGG + Intergenic
1172961861 20:38805740-38805762 CCACAGACACAGCCGGGGTCGGG + Exonic
1173872598 20:46351271-46351293 CTGAAGACACAACTGGTCCCGGG + Intronic
1174412873 20:50347204-50347226 CTTCAGATACAGCTGGATCCAGG - Intergenic
1175217103 20:57397095-57397117 CTGCAGAGACAGGCTGGGCCTGG - Intronic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175332923 20:58177252-58177274 CTGCAGACACGCCTGGGCTCAGG + Intergenic
1175804561 20:61820343-61820365 CTGCAGATACCACTGAGGCCAGG + Intronic
1176119806 20:63449200-63449222 CTTCAGGCACAGCTGGATCCAGG - Intronic
1176161146 20:63649466-63649488 CCACAGACACAGCTGGTGCCAGG + Intronic
1176587062 21:8597282-8597304 CTGCAGACACAGCTTCTCCCTGG + Intergenic
1178398521 21:32263776-32263798 CTGCAAACCCAGCTGGGGTCGGG + Intergenic
1179039702 21:37791410-37791432 CTGCACATTGAGCTGGGGCCAGG + Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179288094 21:39995328-39995350 CTGCAGCCGTTGCTGGGGCCAGG - Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180056686 21:45362522-45362544 CTGCAGTCACTGTTGGGCCCTGG - Intergenic
1180083954 21:45499241-45499263 CTGCCGACACAGCTCGGGTCTGG - Intronic
1180149301 21:45939630-45939652 GTGCAGACACCGCTGGGCCATGG + Intronic
1180196314 21:46196511-46196533 CTGCAGACACAGCTGCAAACAGG + Intronic
1180247497 21:46557914-46557936 CTGCAGAGACAGGTGGGCCGTGG - Intronic
1180269891 22:10574279-10574301 CTGCAGACACAGCTTCTCCCTGG + Intergenic
1180588016 22:16910584-16910606 CTGCAGACACAGCTTCTCCCCGG - Intergenic
1180702915 22:17791425-17791447 CTGCAGGCAAACCTTGGGCCTGG - Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1180883310 22:19222060-19222082 CTCCAATCACAGCTGGGGTCCGG + Exonic
1180962004 22:19766383-19766405 CCGCAGACGCGGCTGAGGCCCGG + Exonic
1181021674 22:20106801-20106823 CAGCACACACAGCTGGGCTCAGG - Intronic
1181068159 22:20316309-20316331 CTGCAGACACCCCTTTGGCCTGG - Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181167764 22:20992628-20992650 GTACAGACACAGGTGGGACCTGG - Intronic
1182366671 22:29783868-29783890 CTTAAGACTCTGCTGGGGCCGGG - Intergenic
1182500549 22:30743588-30743610 CTGCTGGCACAGCTGGGCTCAGG + Intronic
1182633155 22:31703109-31703131 CTTAAAACACAGCAGGGGCCAGG - Intronic
1183172820 22:36200484-36200506 CGGCAGCCACAGCAGGGGCTAGG - Intronic
1183177375 22:36234008-36234030 CGGCAGCCACAGCAGGGGCTGGG - Intronic
1183188409 22:36305880-36305902 CTGCACGCACAGCAGGGCCCAGG + Intronic
1183309219 22:37100426-37100448 CCTCTGCCACAGCTGGGGCCAGG - Intronic
1183333610 22:37234467-37234489 CCGGAGGCACAGCTGTGGCCTGG - Intronic
1183554285 22:38513129-38513151 CTGCAGAAACAGCCTGGGCATGG + Intergenic
1184043169 22:41956558-41956580 CTGCAGTCAGGGCTGGGCCCCGG + Intergenic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184207631 22:43015062-43015084 CTCCAGACCCAGCTCCGGCCGGG + Exonic
1184658274 22:45952923-45952945 CAGCAGACACAGCTGGGAGGCGG - Intronic
1184743448 22:46442492-46442514 CAGGAGCCACAGCTGGGGGCAGG - Intronic
1184834291 22:47012019-47012041 GTGCAGAATCAGCTGGGGGCGGG - Intronic
1184997472 22:48219224-48219246 CTGCAGACGTCGCTGAGGCCGGG - Intergenic
1185009453 22:48305095-48305117 CTGCGCCCACTGCTGGGGCCAGG + Intergenic
1185066659 22:48635651-48635673 CTGCAGACACAGGAGGAACCAGG - Intronic
1185285504 22:49998025-49998047 CTTCAGGCAGAGCTGGGGCTGGG + Exonic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949921821 3:9009049-9009071 CTTCAGGCACAGCTGGATCCAGG - Intronic
949953505 3:9248688-9248710 CTGCAGATAGCGCTGGGGCTGGG - Intronic
950047814 3:9960879-9960901 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
950113964 3:10438608-10438630 CTGAAACCACAGCAGGGGCCTGG + Intronic
950132761 3:10558578-10558600 CTTCAGGCACAGCTGGATCCAGG - Intronic
950234687 3:11308482-11308504 CTGCAGACTCTGCTGGGGAACGG - Intronic
950490770 3:13303611-13303633 CTGCAGATAAAGCCGTGGCCTGG + Intergenic
950695872 3:14700892-14700914 CTGCTGACAGTTCTGGGGCCAGG + Intronic
951045330 3:18031389-18031411 AGGCAGACACAGCTGGGAACTGG - Intronic
951464733 3:22989918-22989940 CTGCCGGCGCCGCTGGGGCCGGG - Intergenic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
952968054 3:38633131-38633153 CTGCAGGTCCAGCTGGGGCCGGG + Exonic
953690534 3:45114137-45114159 CTGCTGACAGAGCTGAGGCTGGG - Intronic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
954746402 3:52789904-52789926 CTGCAGACTCAGCAGAGTCCTGG - Intronic
957005654 3:74943675-74943697 CTTCAGGCACAGCTGTGTCCAGG - Intergenic
960497340 3:118391048-118391070 CTCCAGACCAAGATGGGGCCTGG + Intergenic
961326008 3:126109804-126109826 CTGCAGCCCCATCTGGGACCTGG - Intronic
961392034 3:126557959-126557981 CTGCAGCCACAGCCTGGGCCAGG + Intronic
961515315 3:127428752-127428774 CTTCAGGCACAGCTGGATCCAGG + Intergenic
961530178 3:127535889-127535911 CAGCAGACACAGCTGTGTGCTGG - Intergenic
961741285 3:129034580-129034602 CTTCAGGCACAGCTGGGTCCAGG + Intronic
961780746 3:129318878-129318900 CTGCAGCCACAGGCTGGGCCAGG + Intergenic
961782056 3:129326173-129326195 TTGCAGACACAGCCTGGGCCAGG - Intergenic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962862556 3:139418462-139418484 CTCTAGACCCATCTGGGGCCTGG - Intergenic
962929209 3:140021953-140021975 CGGCAGACAGAACTGGGACCTGG + Intronic
963806660 3:149729337-149729359 CTGGTGACTCAGCTGGGGGCAGG + Intronic
964230293 3:154458077-154458099 CTTCAGAAATATCTGGGGCCAGG - Intergenic
965616318 3:170596384-170596406 CTTCAGGCATAGCTGGGTCCAGG + Intronic
967019355 3:185508859-185508881 ATACCGACACAGCTGAGGCCTGG + Exonic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968518043 4:1023085-1023107 CCCCAGACCCTGCTGGGGCCTGG - Intronic
968900626 4:3429970-3429992 CTGCAGCTGCAGCTGGGACCCGG + Intronic
968962113 4:3750918-3750940 ATCCAGTCACAGCTGGAGCCAGG + Intergenic
969245152 4:5927152-5927174 CTCCAGGCACAGCTGGCTCCAGG - Intronic
969338131 4:6523600-6523622 CTGCACACACTGCTGGGGGCAGG + Intronic
969622271 4:8284568-8284590 CTGCAGACCCCGCAGGTGCCTGG + Intronic
969672979 4:8599821-8599843 CCCCAGACTCAGCAGGGGCCCGG - Intronic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
974878501 4:67725348-67725370 CTGCAGTCATAGCTGAAGCCTGG - Intergenic
975618334 4:76270108-76270130 CTTCAGGCACAGCTGGATCCAGG + Intronic
977136496 4:93311198-93311220 CTGAAGAGACAGCTGGAGTCAGG + Intronic
977241255 4:94572715-94572737 ATACAGACACAGATGGGGCATGG + Intronic
978516515 4:109574440-109574462 CTGCCAACACAGCTAGAGCCTGG + Intronic
982278199 4:153658471-153658493 CGGCACCGACAGCTGGGGCCTGG + Intergenic
984054422 4:174909043-174909065 CTGCAGACACCACTGGTACCAGG - Intronic
984771531 4:183440849-183440871 CTGCAGACATAGGTGTGGCTGGG - Intergenic
984811562 4:183799873-183799895 CAGCAGAGACAGCTCAGGCCAGG - Intergenic
985558424 5:569464-569486 GTGCACACCCAGGTGGGGCCAGG + Intergenic
985922235 5:2986421-2986443 CTGCAGACACTGCTGGGCTGGGG - Intergenic
987023566 5:13900041-13900063 CTGCAGAGTTGGCTGGGGCCAGG - Intronic
987119841 5:14756676-14756698 CTGCAAACACAGCTGTGGGCTGG + Intronic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
992342886 5:75844302-75844324 CTGCTGAAAGAGCTGGGGGCTGG - Intergenic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
995145908 5:108787020-108787042 CTGCAGAGCCAGCAGGGGCTGGG + Intronic
995874009 5:116771303-116771325 CTGAAGACACACCTTGGACCTGG + Intergenic
996493888 5:124130872-124130894 CTGCAAACACACATGGGACCAGG + Intergenic
997042918 5:130278460-130278482 CTGCAGAGCCAGCAGGAGCCAGG - Intergenic
997337556 5:133118852-133118874 CTGCAGAGCTAGCAGGGGCCAGG - Intergenic
997580704 5:135015018-135015040 CAGCAGACCCATCTGGGGCCAGG - Intergenic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
997979205 5:138458656-138458678 CTGCACACTCAGCTGGGGGTAGG + Intergenic
998406827 5:141878754-141878776 GGGCAGACAGAGCTGGGGACAGG - Intronic
999254049 5:150199757-150199779 CTTCAGGCACAGCTGGGTCTAGG + Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999508942 5:152227560-152227582 CCTCAGACAAAGCTGGGTCCAGG + Intergenic
1000019119 5:157303696-157303718 CTGCATACCCTGCAGGGGCCTGG + Intronic
1000852332 5:166355784-166355806 CAGCAGAGTCAGCAGGGGCCAGG + Intergenic
1001050661 5:168411524-168411546 CTTCAGGCACAGCTGGATCCAGG + Intronic
1001452817 5:171839273-171839295 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1001547332 5:172578831-172578853 GTGCAGACACAGGCAGGGCCTGG + Intergenic
1001560434 5:172665588-172665610 CTGCAGACACCGCAGGAACCAGG - Intronic
1001666608 5:173438400-173438422 GTGCAGACAGATCAGGGGCCAGG + Intergenic
1001673106 5:173490852-173490874 CCCCAGAGACAGCTGGGGCATGG + Intergenic
1001862086 5:175066071-175066093 TTCCAGACACAGCTGAGGCCAGG - Intergenic
1002082745 5:176747358-176747380 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1002591739 5:180295362-180295384 CTGCATACACAGCTGGCCTCCGG - Intergenic
1002603918 5:180370844-180370866 CTGCAGGCAGGGCAGGGGCCAGG + Intergenic
1003135292 6:3430483-3430505 CTGCAGTCCCTCCTGGGGCCTGG - Intronic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1003486163 6:6581415-6581437 GTGCAGACTCAGCTGGGGCCAGG - Intergenic
1006349618 6:33511691-33511713 CCTCAGAAACAGCTGAGGCCTGG + Intergenic
1006679709 6:35788155-35788177 CTGCCCACAGAGTTGGGGCCTGG + Intronic
1006787630 6:36679087-36679109 CTGGAAACCCAGCTGGGGCGAGG + Intronic
1006884297 6:37367821-37367843 CTGCAGACAAAACTGAGGCATGG + Intronic
1007533131 6:42560738-42560760 CACCAGACACAGCTGAGGACAGG - Intergenic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1010211182 6:73363736-73363758 CTGGAGAGACTGCTGGGTCCCGG - Exonic
1011411856 6:87074462-87074484 GTGGGGACCCAGCTGGGGCCTGG + Intergenic
1015602484 6:134924015-134924037 CTGCATGCACAGCTTGGACCTGG + Intronic
1015709220 6:136121154-136121176 CTGCAGTCACAGCTGGCTTCAGG - Intronic
1016023016 6:139255553-139255575 CTGCAGGCTCAGGTGAGGCCAGG - Exonic
1016323144 6:142870115-142870137 CTGCAGACCCAGGTGGGTCTTGG - Intronic
1016619606 6:146092723-146092745 CTTCAGATGCAGCAGGGGCCAGG - Intronic
1016859163 6:148699269-148699291 CTGCAGACCCTGCTAGGGCATGG + Intergenic
1017717492 6:157222863-157222885 CTGCCCTCACAGCTGGGGTCTGG - Intergenic
1018414194 6:163587088-163587110 CTCCAGACATAACTGTGGCCAGG - Intergenic
1018701562 6:166431369-166431391 CTGCAGACTGAGGTGGGGCCTGG + Intronic
1018961804 6:168454817-168454839 CTGAAGACGCTGCTGGGGACAGG + Intronic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1019165228 6:170094107-170094129 CTGCAGAGAGGCCTGGGGCCAGG - Intergenic
1019298006 7:289432-289454 CTGCAGAAAGCGCTGGGACCTGG + Intergenic
1019342034 7:512871-512893 CCCCAGACAGAGGTGGGGCCTGG - Intronic
1019709465 7:2511681-2511703 CTGAAGACAAGGCTGGGGCTGGG - Intergenic
1020084700 7:5303953-5303975 GGGCAGTCACAGCCGGGGCCGGG - Exonic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023905833 7:44521119-44521141 CTGCAGAGAAAGCAGGGGTCTGG + Intronic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1024924476 7:54598760-54598782 CTGCAGAGAGGGCTGGAGCCTGG - Intergenic
1024956579 7:54927134-54927156 CTCCAGACCCACCTAGGGCCTGG + Intergenic
1025209604 7:57013247-57013269 GGGCAGTCACAGCCGGGGCCGGG + Intergenic
1025662347 7:63563603-63563625 GGGCAGTCACAGCCGGGGCCGGG - Intergenic
1025959797 7:66209961-66209983 CTGAAAATACACCTGGGGCCAGG - Intronic
1029067963 7:97871768-97871790 CTACAGAGACAGGTGGGGACTGG + Exonic
1029216558 7:98954589-98954611 CTGCAGAACCTGCTGGTGCCTGG - Intronic
1029309753 7:99651873-99651895 CTGCAGCCACAGATAGGACCAGG + Intronic
1030957756 7:115876552-115876574 ATGCAGTCACTGCTGGAGCCTGG - Intergenic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1032268499 7:130384353-130384375 CTGCAGGCACAGCTTGGGATGGG - Intronic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1032952039 7:136925671-136925693 CTGCAGAGACAGGAGGTGCCAGG - Intronic
1034256446 7:149727256-149727278 CAGCAGCCACAGCTCTGGCCAGG + Intronic
1034259835 7:149748106-149748128 CTGCAAAGAGAGCTGGGGGCGGG + Intergenic
1034270643 7:149802077-149802099 CTGCAGCCGCAGCTGTGGCCTGG + Intergenic
1034856545 7:154553925-154553947 GTGCTGACACAGCTGAGTCCTGG + Intronic
1035085046 7:156251102-156251124 GTGCAGACAAGGCAGGGGCCCGG + Intergenic
1035568684 8:658587-658609 ATGCAGCCACATCGGGGGCCAGG - Intronic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1037516633 8:19638269-19638291 CAGCAGACACAGTTGAGGCAGGG - Intronic
1038276789 8:26127966-26127988 ATGAAGACACAGCTGTGGCCAGG + Intergenic
1038781718 8:30573880-30573902 CTTCAGACTCAGCTGGACCCAGG + Intergenic
1040355571 8:46614835-46614857 ATGCAGAGACAGATGTGGCCTGG - Intergenic
1040532614 8:48277653-48277675 CAGCAGACACCCCTGAGGCCTGG + Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044727953 8:95208282-95208304 TTGCAGTCACTGCTGGGCCCTGG + Intergenic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1046195660 8:110860287-110860309 GGGCAGACACAGCAGGGGGCTGG - Intergenic
1046809353 8:118515873-118515895 CTGCAGAGAGGGCTGGGGACTGG - Intronic
1047233219 8:123015470-123015492 CGGGAGACACAACTGGGGCCAGG - Exonic
1047589472 8:126311958-126311980 CTTCAGACTCAGATGTGGCCTGG - Intergenic
1048066848 8:130978967-130978989 CTTCAGGCACAGCTTGGTCCAGG - Intronic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1049024844 8:139981218-139981240 TTGCAGAGACAGCTCTGGCCAGG + Intronic
1049217059 8:141413086-141413108 CAGCAGACACAGCTGACTCCAGG - Intronic
1049421987 8:142521075-142521097 CTGCAGCCACAGCAGAGGGCAGG - Intronic
1049435044 8:142582594-142582616 CAGCAGAGACAGCTAGGGCGTGG + Intergenic
1050243086 9:3658788-3658810 CTGCAGTCACTGCTGTAGCCAGG - Intergenic
1050248253 9:3714240-3714262 CTCTGGACACACCTGGGGCCTGG + Intergenic
1052824193 9:33163505-33163527 CTGGGGGCTCAGCTGGGGCCTGG - Intronic
1053569365 9:39288248-39288270 TCGGAGACGCAGCTGGGGCCGGG - Intronic
1053696926 9:40648162-40648184 CTGCAGACACAGCTTCTCCCCGG - Intergenic
1053835324 9:42129290-42129312 TCGGAGACGCAGCTGGGGCCGGG - Exonic
1053943326 9:43278296-43278318 CTGCAGACACAGCTTCTCCCCGG - Intergenic
1054090994 9:60847232-60847254 TCGGAGACGCAGCTGGGGCCGGG - Intergenic
1054112405 9:61122788-61122810 TCGGAGACGCAGCTGGGGCCGGG - Intergenic
1054127780 9:61330762-61330784 TCGGAGACGCAGCTGGGGCCGGG + Intergenic
1054308178 9:63447395-63447417 CTGCAGACACAGCTTCTCCCCGG - Intergenic
1054406914 9:64771386-64771408 CTGCAGACACAGCTTCTCCCCGG - Intergenic
1054440538 9:65256852-65256874 CTGCAGACACAGCTTCTCCCCGG - Intergenic
1054489869 9:65765072-65765094 CTGCAGACACAGCTTCTCCCCGG + Intergenic
1054595300 9:67059341-67059363 TCGGAGACGCAGCTGGGGCCGGG + Intergenic
1056913859 9:90728330-90728352 CTGCAGTCTCAGCTGGGACCTGG - Intergenic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1057518119 9:95738532-95738554 CTGCAGACCCAGCTGCAGCGAGG - Intergenic
1057891526 9:98873651-98873673 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059241668 9:112811296-112811318 CTTAAGACCCAGCTGTGGCCTGG + Intronic
1059671361 9:116495497-116495519 CCTCAGACACAACTGGGTCCAGG - Intronic
1060299667 9:122367940-122367962 CTGCCTACACAGGTGGGGCCGGG + Intergenic
1061325143 9:129859145-129859167 CTGAGGACACACCTGGGGCCGGG - Intronic
1061366196 9:130173303-130173325 TGGCAGACAGAGATGGGGCCAGG - Intronic
1061387732 9:130300347-130300369 CTGTAGACACAGCAGTGGGCAGG + Intronic
1061487450 9:130927507-130927529 CAGCTGGCACAGATGGGGCCTGG + Intronic
1061579238 9:131526773-131526795 CTGCAGACACAGCTGTCCCCAGG - Intronic
1061846329 9:133390550-133390572 CTGCAGAACCAGGTGGGGCAGGG + Intronic
1061883333 9:133578799-133578821 GGGGAGGCACAGCTGGGGCCTGG - Exonic
1061930852 9:133832378-133832400 CTGCAGACTCTGCTGGGGGTTGG + Intronic
1062003017 9:134226254-134226276 CTCCAGATGCTGCTGGGGCCAGG - Intergenic
1062010488 9:134264273-134264295 CTGCAGACGCAGCTGGTACCTGG + Intergenic
1062088260 9:134659808-134659830 GTGCACACACAGCTGGGCACAGG - Intronic
1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG + Intergenic
1062401222 9:136373559-136373581 CTGCAGACACACCAGGAGCCTGG + Exonic
1062477360 9:136735334-136735356 CAGCAGAGACAGCTGCGGCCGGG - Intergenic
1062536546 9:137023617-137023639 CTAAAGGCACAGCTGGTGCCTGG - Intronic
1062585916 9:137249975-137249997 CTCCAGACACAGATAGGGGCAGG - Intergenic
1202779379 9_KI270717v1_random:21821-21843 CTGCAGACACAGCTTCTCCCCGG - Intergenic
1203586446 Un_KI270747v1:8201-8223 CTGCAGACACAGCTTCTCCCCGG - Intergenic
1203617018 Un_KI270749v1:74996-75018 CTGCAGACACAGCTTCTCCCCGG + Intergenic
1185642748 X:1597574-1597596 CTGCAGACACAGCCCAGGCCTGG + Intronic
1185779109 X:2829755-2829777 CTGCTGACACCGCTGAGGTCGGG + Intronic
1186430199 X:9498653-9498675 CTGCAGAGACCGCAGGAGCCTGG + Intronic
1186858919 X:13652286-13652308 CGGCAGTCACAGCTGGGCCTTGG + Intergenic
1187393562 X:18901708-18901730 CTGGAGACACAGCGCTGGCCAGG - Intronic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1190305575 X:49079812-49079834 CGGCACCGACAGCTGGGGCCCGG - Exonic
1190369951 X:49730975-49730997 CTAGAGATACAGCTGGGGCAGGG + Intergenic
1190522597 X:51295512-51295534 CTGCAGAAACAGCTGTTACCTGG - Intergenic
1191640237 X:63423956-63423978 CTACACACACAGCTGGCTCCTGG - Intergenic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1192257164 X:69471358-69471380 CTACAGACACAGCTAGACCCAGG - Intergenic
1193080868 X:77404767-77404789 AGGGAGACACTGCTGGGGCCAGG - Intergenic
1194212065 X:91082035-91082057 CCACAGAGACAGCTGGGGTCAGG + Intergenic
1194591583 X:95805914-95805936 CTCCGGACCCACCTGGGGCCTGG + Intergenic
1194687525 X:96940960-96940982 AGGAAAACACAGCTGGGGCCAGG - Intronic
1195122876 X:101774666-101774688 CTGCAGACCCACCCAGGGCCTGG - Intergenic
1195748007 X:108137831-108137853 GTGCTGACACAGCTGGTGACAGG + Exonic
1196154106 X:112407548-112407570 CTCTTGACACACCTGGGGCCTGG + Intergenic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1197303003 X:124804080-124804102 CTTTATACTCAGCTGGGGCCAGG - Intronic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200988271 Y:9326005-9326027 CTGCAGGCACAGCCTGGCCCTGG + Intergenic
1201194653 Y:11480102-11480124 CTGCAGACACAGCTTCTCCCCGG - Intergenic
1201290933 Y:12420738-12420760 CTGCTGACACCGCTGAGGTCGGG - Intergenic
1202119750 Y:21510188-21510210 CTGCAGGCACAGCCTGGCCCTGG - Intergenic
1202122203 Y:21533729-21533751 CTGCAGGCACAGCCTGGCCCTGG - Intronic
1202156804 Y:21895654-21895676 CTGCAGGCACAGCCTGGCCCTGG + Intronic
1202159250 Y:21919195-21919217 CTGCAGGCACAGCCTGGCCCTGG + Intergenic
1202185699 Y:22184110-22184132 CTGCAGGCACAGCCTGGCCCTGG + Intergenic
1202205661 Y:22402286-22402308 CTGCAGGCACAGCCTGGCCCTGG - Intronic