ID: 1023049964

View in Genome Browser
Species Human (GRCh38)
Location 7:36242433-36242455
Sequence ATGAATGAACAGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1698
Summary {0: 1, 1: 1, 2: 10, 3: 110, 4: 1576}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023049964_1023049967 1 Left 1023049964 7:36242433-36242455 CCTCCTTCCTTCTGTTCATTCAT 0: 1
1: 1
2: 10
3: 110
4: 1576
Right 1023049967 7:36242457-36242479 CATTCATTCCCTTATGCTACAGG 0: 1
1: 0
2: 4
3: 10
4: 200
1023049964_1023049970 28 Left 1023049964 7:36242433-36242455 CCTCCTTCCTTCTGTTCATTCAT 0: 1
1: 1
2: 10
3: 110
4: 1576
Right 1023049970 7:36242484-36242506 TGTTGAGCTTCCAGTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023049964 Original CRISPR ATGAATGAACAGAAGGAAGG AGG (reversed) Intronic
900701116 1:4049185-4049207 ATGAATGTACCAAGGGAAGGAGG - Intergenic
900872680 1:5315467-5315489 AGGAAAGAAGAGAGGGAAGGAGG + Intergenic
900983273 1:6058733-6058755 AGGAAGGAACAGGAGGAGGGAGG + Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
901539079 1:9903166-9903188 ATGAGTCATTAGAAGGAAGGAGG + Intronic
901745237 1:11368446-11368468 ATGTAGGCACAGAAAGAAGGTGG + Intergenic
901860868 1:12073500-12073522 AAGAAAGAAGAGAAGGAGGGAGG - Intronic
902490399 1:16776824-16776846 ATGAAGGGTCAGAAGGAAAGAGG - Intronic
902620417 1:17647525-17647547 ATGAATAAAAGGAAGGAGGGAGG - Intronic
902620419 1:17647529-17647551 AAGAATGAATAAAAGGAAGGAGG - Intronic
902759001 1:18568675-18568697 AAGAAAGGAAAGAAGGAAGGAGG + Intergenic
903273329 1:22205726-22205748 ATGAATGAACAAAAGGTGGAAGG - Intergenic
903293755 1:22330754-22330776 ATGAATGAAGAGAAGAGAGAAGG + Intergenic
903341695 1:22658871-22658893 ATGGATGGACAGCAGGATGGAGG + Intronic
903889660 1:26561031-26561053 ATCAATGACCTGAAGAAAGGGGG - Exonic
903909111 1:26709336-26709358 GTGGATGCACAGGAGGAAGGTGG - Intronic
904246783 1:29193730-29193752 ATGACAGAAAAGCAGGAAGGGGG + Intronic
904327922 1:29739482-29739504 ATGAATAAACCATAGGAAGGTGG - Intergenic
904362950 1:29990343-29990365 ATGAATAAACAATAGGAAAGTGG - Intergenic
904522823 1:31109168-31109190 AGGAAGAAATAGAAGGAAGGAGG - Intergenic
904745210 1:32706486-32706508 ATGAATGAAGGGAAGGAGGATGG + Intergenic
904855069 1:33491567-33491589 ATGGATGAGCAGGAGGAAGGGGG + Exonic
905331853 1:37208823-37208845 ATGAATGAAATGAAGCAAGAAGG + Intergenic
905885486 1:41489603-41489625 ATCAATGGATAGAAAGAAGGTGG - Intergenic
905885506 1:41489690-41489712 ATCAATGGATAGAAAGAAGGTGG - Intergenic
905885552 1:41489888-41489910 ATCAATGGATAGAAAGAAGGTGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906204030 1:43977470-43977492 ATGAGAGAACAGAAAGAGGGAGG - Intronic
906794769 1:48688126-48688148 ATGAAGGGAGAGAAGGAGGGAGG + Intronic
906794772 1:48688142-48688164 AGGGAGGAAGAGAAGGAAGGAGG + Intronic
906909850 1:49936252-49936274 ATGAATGAAATGAAGCAAGAAGG + Intronic
907057708 1:51386734-51386756 ATGAATGAAATGAAGCAAGAAGG + Intronic
907139711 1:52175731-52175753 ATGAATGAAATGAAGCAAGAAGG - Intronic
907634165 1:56116832-56116854 GTGAAGAAACAGCAGGAAGGGGG + Intergenic
907670544 1:56471280-56471302 ATGAAAGAAAAGAAGGAGAGAGG + Intergenic
907756946 1:57319745-57319767 ACGAATAAACAGAGGGTAGGTGG + Intronic
907824220 1:57999916-57999938 AAGAAGGAAAAGAAGGAAGGAGG + Intronic
907926504 1:58959534-58959556 ATGAATGAAATGAAGCAAGAAGG + Intergenic
907997964 1:59652479-59652501 ATGAATGAAATGAAGCAAGAAGG - Intronic
908333691 1:63097936-63097958 AAGAAGGAAAAGAAGGATGGGGG + Intergenic
908639202 1:66203574-66203596 ATGAATGAAACGAAGCAAGAAGG - Intronic
908765263 1:67548938-67548960 ATGAATGAAATGAAGCAAGAAGG - Intergenic
908976941 1:69909997-69910019 ATGAATGAAATGAAGCAAGAAGG - Intronic
909289080 1:73859185-73859207 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
909386728 1:75066586-75066608 ATGGATGGAAGGAAGGAAGGAGG - Intergenic
909417249 1:75420427-75420449 ATGAATGAACAGCAAGATGCTGG + Intronic
909428562 1:75557400-75557422 GTGAATACACAGAAGAAAGGTGG + Intronic
909614477 1:77591342-77591364 ATGAAAGAAAAGAACGAAGAGGG - Intronic
909677952 1:78258295-78258317 ATGGATGAACTGATGGAAGTAGG + Intergenic
909914756 1:81303133-81303155 GTGAATGAACACGAGGACGGAGG - Intergenic
909964031 1:81885127-81885149 ACGAATAAATAGAAGTAAGGAGG + Intronic
910021928 1:82602117-82602139 AGGAAAGAAAAGAAGGAAAGAGG - Intergenic
910171330 1:84380477-84380499 AAGAAAGAAAAGAAGGAAGAAGG + Intronic
910175198 1:84422589-84422611 TGTAATGAACAGAAGGAAGAAGG + Intergenic
910499288 1:87871070-87871092 AAGAAAGAAAAGAAGGAGGGTGG + Intergenic
910566149 1:88645269-88645291 AGGAAAGGAAAGAAGGAAGGAGG + Intergenic
910689578 1:89952237-89952259 AGGAAAGAACAGAAGGAATTTGG + Intergenic
910759730 1:90722519-90722541 GTGAATGAACAAAATGAATGAGG - Intergenic
910901878 1:92130113-92130135 ATGAGTGTACAGCAAGAAGGCGG - Intronic
911226649 1:95314411-95314433 ATGAATGAATAAAAGGAAGGAGG + Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911366696 1:96947202-96947224 ATGCATGTATAGCAGGAAGGTGG - Intergenic
911371204 1:96996879-96996901 ATGAATGAAAAGGAAAAAGGAGG - Intergenic
911377095 1:97064103-97064125 ATAACTGAACAGGAGAAAGGAGG + Intergenic
911492757 1:98589927-98589949 ATGAATGAAATGAAGCAAGAAGG + Intergenic
911859785 1:102932818-102932840 ATGAATGAAATGAAGCAAGAAGG - Intronic
911911399 1:103641542-103641564 ATGAATGAATAAAAGCAACGTGG - Intergenic
911917055 1:103710408-103710430 ATGAATGAATAAAAGCAACGTGG + Intronic
911918814 1:103735680-103735702 ATGAATGAATAAAAGCAACGTGG - Intronic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912411729 1:109484598-109484620 ATGGATGGACCGAAGGATGGAGG - Intronic
912478909 1:109962612-109962634 ATGAATGACCAACAGAAAGGTGG + Intergenic
913298750 1:117347886-117347908 ATGCAAGAAAGGAAGGAAGGAGG - Intergenic
913434533 1:118832836-118832858 ATGAATGAAATGAAGGGAGAAGG + Intergenic
913461315 1:119088901-119088923 AGGAAAGATCAGAAGGAAGTAGG - Intronic
913507134 1:119527158-119527180 ATGAGTGAGCAGAAGCAGGGTGG - Intergenic
913704230 1:121402726-121402748 ATGAATGAAATGAAGCAAGAAGG + Intergenic
913708732 1:121456396-121456418 AGGGATGAAGGGAAGGAAGGAGG + Intergenic
913722298 1:121609686-121609708 ATGATTGAACAGAAAGAGAGAGG - Intergenic
913742058 1:121856944-121856966 ATGATTGAACAGAAAGAGAGAGG - Intergenic
913758372 1:122102851-122102873 ATGATTGAACAGAAAGAGAGAGG - Intergenic
913942877 1:125124349-125124371 ATGAATGAAACGAAGGGAGAAGG + Intergenic
914401615 1:147326514-147326536 ATGAATGAAATGAAGCAAGAAGG - Intergenic
914880632 1:151543942-151543964 AAGAAGGAAGAGAGGGAAGGAGG - Intronic
915102811 1:153512979-153513001 AGGAAAGTACAGAAGGAAAGGGG + Intergenic
915172078 1:153985382-153985404 AAGAAAGAAGAGAAGGGAGGAGG + Intronic
915304478 1:154969825-154969847 GGGAGTGAAAAGAAGGAAGGGGG + Intronic
915458673 1:156056439-156056461 ATCAATGATCTGAAGAAAGGTGG + Intronic
915654169 1:157345017-157345039 ATGAATGAAATGAAGCAAGAAGG - Intergenic
915875244 1:159605152-159605174 ATGAATGAAATGAAGCAAGAAGG + Intergenic
915882889 1:159691712-159691734 ATGCAAGAACGGAAGGAAGGAGG - Intergenic
915943850 1:160135908-160135930 AATGATGAACAGCAGGAAGGGGG - Exonic
916020167 1:160784486-160784508 ATGAATGAAATGAAGCAAGAAGG + Intergenic
916057490 1:161077844-161077866 ATGAAATAAGAGAAGGAAAGGGG - Intronic
916307328 1:163352431-163352453 ATGAATGAACTGAAGGAAAATGG - Intronic
916381553 1:164217435-164217457 ATGAATGAAATGAAGCAAGAAGG + Intergenic
916527022 1:165619971-165619993 AGGAATGAAGGGAGGGAAGGAGG - Intergenic
916543720 1:165782732-165782754 ATGAATGAAATGAAGCAAGAAGG - Intronic
917397932 1:174614804-174614826 ATGAATGAAATGAAGCAAGAAGG - Intronic
917571086 1:176266165-176266187 ATGACTGAACCCAAGGAAAGGGG + Intergenic
917608537 1:176661806-176661828 AAGACAGACCAGAAGGAAGGTGG + Intronic
917680793 1:177365074-177365096 ATGAAGGAATAGGTGGAAGGTGG + Intergenic
917684830 1:177405645-177405667 ATGAATGAAATGAAGCAAGAAGG - Intergenic
917699419 1:177565004-177565026 ATGAATGAAATGAAGCAAGAAGG + Intergenic
917786089 1:178458768-178458790 CTGCTTGAAGAGAAGGAAGGGGG - Intronic
918038364 1:180896989-180897011 ATGAAGGAAGAGAGGGAGGGAGG + Intergenic
918410266 1:184251191-184251213 AGGAAGGAAGAGAAGGAAGGAGG - Intergenic
918427297 1:184423791-184423813 ATGGAAGAAGAGATGGAAGGAGG - Intronic
918670450 1:187208281-187208303 ATGAATGAACAGAAAAAGGATGG + Intergenic
919440239 1:197624932-197624954 ATGAATGAAATGAAGCAAGAAGG + Intronic
919441186 1:197635030-197635052 AGGAAGGAAGGGAAGGAAGGAGG + Intronic
919654813 1:200186766-200186788 ATGAATGAAATGAAGGAAGAAGG + Intergenic
920162827 1:204012594-204012616 AAGAAAGAAAGGAAGGAAGGAGG + Intergenic
920360362 1:205411208-205411230 AAGAAAGAAAGGAAGGAAGGAGG + Intronic
920737297 1:208544546-208544568 ATGAATTAACAGAAAGGAAGAGG + Intergenic
920838493 1:209534157-209534179 ATAAATTAGCAGTAGGAAGGAGG + Intergenic
920916595 1:210262578-210262600 AAAAATGAGGAGAAGGAAGGAGG - Intergenic
921425027 1:214991584-214991606 AGGAATGACCATAAAGAAGGAGG - Intergenic
921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG + Intronic
921594836 1:217043298-217043320 ATAAATGGAAAGAAGGAAGCTGG + Intronic
922069880 1:222181522-222181544 ATGAATTAGCAGCAGGAAGGGGG + Intergenic
922200856 1:223400260-223400282 ATGAATGAAATGAAGCAAGAAGG - Intergenic
922206162 1:223448270-223448292 ATGAATGAAATGAAGCAAGAAGG + Intergenic
922333696 1:224600902-224600924 GTGAAGGCACAGAGGGAAGGTGG + Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922622482 1:227000677-227000699 ATAAATGATCACTAGGAAGGAGG - Intronic
922792938 1:228320371-228320393 ATGGATGACTAGATGGAAGGAGG - Intronic
922824364 1:228507091-228507113 ATGAATGAAATGAAGCAAGAAGG + Intergenic
922912648 1:229230456-229230478 ATGAATTAGCAGGAGGTAGGCGG - Intergenic
923129683 1:231064660-231064682 AGGAAGGGAAAGAAGGAAGGAGG - Intergenic
923185348 1:231567827-231567849 ATAAATCAATAGAAGGAAAGTGG + Intronic
923332966 1:232942618-232942640 AAGAAAGAAGAGAGGGAAGGAGG + Intergenic
923449928 1:234106924-234106946 ATAAATGACAAGAAGGATGGAGG - Intronic
923530041 1:234805706-234805728 ATGAAGGGTCAGAAGGAAAGAGG + Intergenic
924186941 1:241502798-241502820 ATGAATGAAAATCATGAAGGTGG - Intronic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063049430 10:2430816-2430838 AAGAAAGAAAATAAGGAAGGAGG + Intergenic
1063236255 10:4119408-4119430 ATGGATGGACAGAAATAAGGAGG - Intergenic
1063633776 10:7761072-7761094 ATGCAGGAGCAGAAGGTAGGAGG + Intronic
1063789631 10:9427552-9427574 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1063877603 10:10496549-10496571 ATGGATGAAAAGATGGAGGGTGG + Intergenic
1064000798 10:11662251-11662273 AGGAAGGAAGGGAAGGAAGGAGG + Intergenic
1064010958 10:11736167-11736189 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1064908440 10:20372871-20372893 ATTAAAGGACAAAAGGAAGGTGG - Intergenic
1064939409 10:20715868-20715890 AAGAAAGAGAAGAAGGAAGGAGG + Intergenic
1065639858 10:27770565-27770587 AAGAAAGAAGAAAAGGAAGGCGG - Intergenic
1065770172 10:29070710-29070732 ATGGATGATCAGAAAGAATGAGG - Intergenic
1065909248 10:30287081-30287103 ATGAACGAATTGAAGGATGGTGG + Intergenic
1065933487 10:30499976-30499998 AAGAAAGAAAAGAAAGAAGGAGG + Intergenic
1065960335 10:30728956-30728978 AGGAATGAGCAGAAGAAAGCAGG + Intergenic
1065992397 10:31025180-31025202 AAGGAGGAACAGAAGGAAGGAGG + Intronic
1066189212 10:33040279-33040301 ATGAAAGGAAGGAAGGAAGGAGG + Intergenic
1066282457 10:33931175-33931197 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
1066484776 10:35832900-35832922 CTGAATGAACTGAATGAAGGAGG + Intergenic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066553417 10:36584579-36584601 AAGGATGAAAAGTAGGAAGGAGG - Intergenic
1066664318 10:37767039-37767061 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1066780840 10:38943067-38943089 ATGAGAGAAAAGAAGGAGGGTGG + Intergenic
1066813475 10:39371842-39371864 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1066953554 10:42144727-42144749 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1067257649 10:44659972-44659994 AAGAATGAAGGAAAGGAAGGAGG - Intergenic
1067305377 10:45059443-45059465 CTGAATGAACTGACTGAAGGAGG + Intergenic
1067357871 10:45548024-45548046 ATGAAAGAACATAAGGATGTGGG - Intronic
1068256353 10:54516475-54516497 ATGAATGAAATGAAGCAAGAAGG + Intronic
1068948612 10:62755156-62755178 AAGAAAGGAGAGAAGGAAGGAGG + Intergenic
1069010499 10:63366579-63366601 CTGAATGAAGAGAAAGAATGAGG + Intronic
1069284203 10:66692377-66692399 ATGAATGAAATGAAGCAAGAAGG + Intronic
1069366693 10:67701041-67701063 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1069515355 10:69072830-69072852 ATGAATGAAGGAAAGGAAGGGGG + Intergenic
1069629879 10:69891025-69891047 ATGCATTAAAAGAAGGAAGGTGG - Intronic
1069718503 10:70535522-70535544 AGGAAAGAAGAGGAGGAAGGAGG - Intronic
1069987485 10:72294279-72294301 AAGAAGGAAGAGAAGGCAGGAGG + Intergenic
1070369776 10:75771260-75771282 ATGCATGGATGGAAGGAAGGAGG - Intronic
1070721855 10:78762512-78762534 ATGAAAGAAAAGAGGGAGGGGGG - Intergenic
1070759753 10:79016691-79016713 AGGAGAGACCAGAAGGAAGGAGG + Intergenic
1070811679 10:79301238-79301260 ATGAATGAAGGGTAGGGAGGAGG - Intronic
1070990371 10:80727241-80727263 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1071247943 10:83785786-83785808 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1071352534 10:84761590-84761612 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1071354247 10:84777962-84777984 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1071358841 10:84824808-84824830 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
1071393749 10:85201005-85201027 ATGAATGTAGTGAAGGAAGCTGG - Intergenic
1071483784 10:86084310-86084332 AAGAAAGAAAGGAAGGAAGGAGG + Intronic
1072013837 10:91326579-91326601 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1072064563 10:91853412-91853434 TTGAATGAACATAAAGAAGATGG - Intronic
1072855197 10:98938504-98938526 ATGAATGAAATGAAGCAAGAAGG + Intronic
1072887090 10:99287308-99287330 GTGAAAGAAGAGAAGGAATGAGG + Intergenic
1073549312 10:104382728-104382750 AGGAAAGAAAAGAATGAAGGAGG - Intronic
1073635234 10:105191301-105191323 AGGAAGGAAAAGAAGCAAGGAGG + Intronic
1073638299 10:105221896-105221918 ATTAAAGAAGAGAAAGAAGGAGG + Intronic
1073703245 10:105954157-105954179 AGGAAAGAACAGGAGGAAGGAGG + Intergenic
1073943993 10:108730019-108730041 AGGAATAGACAGAAGGAGGGAGG + Intergenic
1073975398 10:109095204-109095226 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1074303323 10:112252313-112252335 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1074496713 10:113985971-113985993 AGGAAGGAAGGGAAGGAAGGAGG + Intergenic
1074903159 10:117837613-117837635 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1075017101 10:118917925-118917947 ATGAAAGGAAAGAAGGAGGGAGG + Intergenic
1075962843 10:126584362-126584384 ATGGATGGACAGATGGAAGGTGG - Intronic
1075962854 10:126584417-126584439 ATGGATGGACAGATGGAAGGTGG - Intronic
1076001485 10:126916645-126916667 AAGAAAGGACAGAAGGAATGAGG - Intronic
1076039807 10:127236402-127236424 AGGAAGGAAGGGAAGGAAGGAGG - Intronic
1076101135 10:127779578-127779600 AGGAATGAAGAGAAAAAAGGGGG + Intergenic
1076448887 10:130541512-130541534 AGGAAAGAAGAGAGGGAAGGAGG - Intergenic
1077312124 11:1893557-1893579 ATGAATGGACAGAGGGAGAGAGG + Intergenic
1077315087 11:1916034-1916056 ATGATGGAAGAGAAGGAGGGAGG + Intergenic
1077379948 11:2227265-2227287 AAGAAAGGAGAGAAGGAAGGGGG + Intergenic
1077841165 11:5976196-5976218 AAGAATAAAAAGAGGGAAGGAGG + Intergenic
1077970684 11:7186661-7186683 ATGAATGGACAAAAGAAATGTGG - Intergenic
1078129068 11:8596950-8596972 AAGAATTAATAGAAGAAAGGAGG + Intergenic
1078421152 11:11214091-11214113 ATGAATGGATGGAAGAAAGGAGG + Intergenic
1078657308 11:13253704-13253726 ATGAATGAATAAATGAAAGGGGG + Intergenic
1078802685 11:14662723-14662745 ATGAATGAACTGAAGCGAGAAGG + Intronic
1079321005 11:19451269-19451291 ATGAAAGAAGAGAATGAGGGAGG - Intronic
1079577397 11:22020724-22020746 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1079598794 11:22286048-22286070 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1079808327 11:24962491-24962513 ATGAATGAAGTGAAGCAAGAAGG - Intronic
1079946964 11:26755858-26755880 ACTCATGAACAGAGGGAAGGGGG + Intergenic
1080180243 11:29416879-29416901 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1080354433 11:31425546-31425568 ATGAAGGCACAGCAAGAAGGAGG - Intronic
1080576103 11:33600549-33600571 AGGAAGGAAAGGAAGGAAGGAGG - Intronic
1080794533 11:35551258-35551280 CTGAATGATCAGAAGCAAGATGG + Intergenic
1081028383 11:38045112-38045134 AGCAAGGTACAGAAGGAAGGAGG + Intergenic
1081039531 11:38193150-38193172 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1081209301 11:40312120-40312142 ATGTATCAACAGAAGGGAGTTGG - Intronic
1081336641 11:41874804-41874826 AAGAAAGAAGAGAGGGAAGGAGG + Intergenic
1081497644 11:43631686-43631708 ATGAAAGAAATGAAGGAGGGAGG - Intronic
1081731034 11:45371857-45371879 ATGAATGGAGAGAAGGCAGCAGG - Intergenic
1082227600 11:49726564-49726586 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1082574476 11:54786268-54786290 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1082856663 11:57814210-57814232 GTGAATGAAGGGAAGGAAGGAGG + Intronic
1083107141 11:60369153-60369175 AAGAAGGAAAAGAAGGACGGTGG - Intronic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083433309 11:62626204-62626226 ATAACAGAACAGAAGGAAGGAGG + Intronic
1084442137 11:69180630-69180652 ATGAATGCACACAAGGCTGGAGG + Intergenic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084543837 11:69803818-69803840 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543875 11:69804053-69804075 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084580036 11:70017511-70017533 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1085303558 11:75472721-75472743 CTGAATGAACAACTGGAAGGAGG - Intronic
1085560184 11:77465323-77465345 ATAAATGAACAGAAGTTAAGTGG - Intronic
1085775159 11:79358801-79358823 TTGAATGAATGGCAGGAAGGAGG - Intronic
1085789810 11:79487261-79487283 AGGAAGGAAAAGAAAGAAGGAGG - Intergenic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086019973 11:82215924-82215946 ATGAATGATCAGAAGGCTGAGGG - Intergenic
1086047289 11:82547852-82547874 ATAAAAGAACAGTAGGATGGAGG + Intergenic
1086056116 11:82649065-82649087 AAGAAGGAGCAGAAGAAAGGAGG - Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086290466 11:85303191-85303213 AAAATTGAACACAAGGAAGGTGG + Intronic
1086481632 11:87246578-87246600 ATGAATGAAATGAAGCAAGAAGG - Intronic
1087566436 11:99865171-99865193 ATTGAAGCACAGAAGGAAGGAGG - Intronic
1087648393 11:100834746-100834768 AGGTATGAACAGAGGGATGGAGG + Intronic
1087787066 11:102366924-102366946 ATCAAGAAACAGAAAGAAGGTGG - Intronic
1087806522 11:102561378-102561400 GAGAAGGAAAAGAAGGAAGGAGG - Intergenic
1088524309 11:110736325-110736347 AAGAAGGAAGGGAAGGAAGGAGG + Intergenic
1088731004 11:112683276-112683298 ATGAATGAAATGAAGGAAGAAGG - Intergenic
1088810647 11:113389371-113389393 ATGAATGAATAGCTGGAAAGAGG - Intronic
1088841008 11:113627489-113627511 AGGAAGGAAAAGGAGGAAGGAGG + Intergenic
1089111259 11:116059178-116059200 TTAAATGAAAAAAAGGAAGGGGG - Intergenic
1089166403 11:116480622-116480644 ATGGATGAACAGTGGGAAGATGG + Intergenic
1089174681 11:116539945-116539967 ATGAATGATTAGAAGAAAGGAGG - Intergenic
1089196281 11:116695670-116695692 ATGGAAGGAGAGAAGGAAGGAGG - Intergenic
1089313890 11:117577555-117577577 AAGAAAGGAAAGAAGGAAGGAGG - Intronic
1089325417 11:117653438-117653460 ATGAATGAGCTGGGGGAAGGGGG - Intronic
1089460573 11:118650713-118650735 ATGAATGAACACAAAAATGGAGG - Intronic
1089550152 11:119268731-119268753 AAGAAAGAACAAAAGGAAGTAGG + Intronic
1089643126 11:119860634-119860656 AAGATTGACCAAAAGGAAGGAGG - Intergenic
1089795607 11:120978097-120978119 AAGAATGAGCAGAAAGAAAGAGG - Intronic
1089816080 11:121176901-121176923 ATGAATGAAATGAAGCAAGAAGG - Intronic
1090178042 11:124669236-124669258 ATGAATGGACAGACGGATGTAGG + Intronic
1090565470 11:127987040-127987062 ATGAATCAAGAGAATAAAGGAGG + Intergenic
1090690442 11:129175207-129175229 ATGAATGAAATGAAGCAAGAAGG + Intronic
1090706606 11:129343640-129343662 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1091062861 11:132480284-132480306 ATGAATGAAATGAAGCAAGAAGG + Intronic
1091335136 11:134760973-134760995 AAGGATGGAAAGAAGGAAGGAGG - Intergenic
1091811180 12:3399122-3399144 ATGAAGCAACAGAAGTATGGTGG - Intronic
1091943307 12:4510160-4510182 ATGAATGAAATGAAGCAAGAAGG + Intronic
1092037751 12:5353747-5353769 AGGAAGGAAGAGAAGGAGGGAGG + Intergenic
1092208455 12:6631103-6631125 AAGAAGGAACACCAGGAAGGAGG + Intronic
1092265126 12:6975029-6975051 ATGACTGGACAGAAGGACTGTGG + Intronic
1092277798 12:7075351-7075373 AGGAAGGAACAGAAGGAGGGAGG - Intergenic
1092559223 12:9592733-9592755 ATGAATGAACAAAGAAAAGGTGG - Intergenic
1092575847 12:9782028-9782050 ATGAATGCACAGAAGAAGGCCGG - Intergenic
1092732236 12:11545723-11545745 ATGAATGAAGAGAAGAAGGCAGG - Intergenic
1092889382 12:12954548-12954570 ATGACTAACCAGCAGGAAGGGGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093047333 12:14463599-14463621 AGTAATGAACAGAAGAATGGGGG + Intronic
1093068099 12:14679888-14679910 ATGAAAAAAAAAAAGGAAGGAGG - Intronic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093332211 12:17856819-17856841 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1093493811 12:19733411-19733433 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1093508369 12:19896592-19896614 AAGAAAGAAGAGGAGGAAGGAGG - Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094475385 12:30836795-30836817 ATGAGTGAACGGTAGGAAGGTGG - Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1095059445 12:37665316-37665338 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1095065165 12:37763108-37763130 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1095151485 12:38800922-38800944 ATGAATGAAATGAAGCAAGAAGG + Intronic
1095169399 12:39016257-39016279 AGGAATGAACAGAAAGACTGTGG + Intergenic
1095323342 12:40857525-40857547 ATGAATGACCTGAAAGCAGGTGG + Intronic
1095340733 12:41086184-41086206 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1095518888 12:43038329-43038351 AAGAAAGAACATGAGGAAGGAGG - Intergenic
1095591416 12:43907761-43907783 ATGAATGAAATGAAGCAAGAAGG + Intronic
1095696649 12:45151492-45151514 ATGAGAGAACAGAACTAAGGGGG - Intergenic
1095857259 12:46873961-46873983 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
1095911244 12:47428178-47428200 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1096333383 12:50734275-50734297 ATATATGAACAAAAGGAATGAGG - Intronic
1096901467 12:54887608-54887630 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1096938678 12:55315415-55315437 GTTAATGAACTGAAGGAATGAGG + Intergenic
1096962249 12:55591215-55591237 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1097304897 12:58058396-58058418 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1097452463 12:59752520-59752542 ATGAATGAAATGAAGCAAGAAGG + Intronic
1097621344 12:61942718-61942740 ATGAATGAAATGAAGCAAGAAGG + Intronic
1097908867 12:64948175-64948197 ATGAATGAACATAGGAAAAGAGG - Intergenic
1097991067 12:65834530-65834552 AGGAAGGAAAAAAAGGAAGGAGG - Intronic
1098057446 12:66522944-66522966 ATGAATGAAATGAAGCAAGAAGG + Intronic
1098139303 12:67435453-67435475 AATGATGAAAAGAAGGAAGGAGG - Intergenic
1098163123 12:67666699-67666721 ATGAATGAAGGGAAGAAGGGAGG + Intergenic
1098181147 12:67848530-67848552 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1098186463 12:67901482-67901504 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1098192760 12:67967736-67967758 ATGAATGTATTGCAGGAAGGTGG - Intergenic
1098372755 12:69778141-69778163 ATGAATGAAATGAAGGGAGAAGG - Intronic
1098661453 12:73100043-73100065 AGGAAGGAAGGGAAGGAAGGAGG - Intergenic
1098668762 12:73198363-73198385 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1098855865 12:75652735-75652757 AAGAAAGAACAGAAGGGAGATGG + Intergenic
1098954307 12:76672597-76672619 ATGAATGGACATCAGGAGGGAGG - Intergenic
1099059143 12:77884204-77884226 ATGGATGGACGGAGGGAAGGAGG + Intronic
1099267261 12:80463282-80463304 ATGAATGAAATGAAGCAAGAAGG + Intronic
1099688551 12:85921543-85921565 ATGGATGGACGGAGGGAAGGAGG + Intergenic
1099750390 12:86765281-86765303 ATGAATGAAATGAAGCAAGAAGG + Intronic
1099773892 12:87099681-87099703 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1099842797 12:87987404-87987426 AACAAGGAACAGAAGGAAGAAGG + Intronic
1099966825 12:89455867-89455889 ATAAATGAACAAAATGAAGTTGG - Intronic
1100089375 12:90952128-90952150 AAGGATGAATAGAAGAAAGGGGG - Intronic
1100091248 12:90974151-90974173 ATTAATGATCAGAGGAAAGGAGG + Intronic
1100153193 12:91766768-91766790 ATGAATGAACTGAAGCAATTAGG + Intergenic
1100202633 12:92315270-92315292 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1100251088 12:92824638-92824660 ATGAAAGACCTGAAGGAAGGAGG - Intronic
1100428694 12:94510992-94511014 ATGAATGAATAAAGAGAAGGTGG - Intergenic
1100569443 12:95833289-95833311 AGCAATGAACAGAAGGAAAATGG - Intergenic
1100587194 12:95991114-95991136 ATAAATAAGAAGAAGGAAGGAGG + Intronic
1100647690 12:96548534-96548556 ATGAATGTACAGGAGGACTGTGG + Intronic
1100705007 12:97191086-97191108 ATGAAGCAAGAGAAGAAAGGTGG + Intergenic
1101054164 12:100895047-100895069 AACATTGACCAGAAGGAAGGTGG - Intronic
1101331438 12:103761029-103761051 ATGAGTGATCAGAAGGAAAGTGG - Intronic
1101339149 12:103826094-103826116 ATGAATGAATAGAAAAAAGAAGG - Intronic
1101519804 12:105471135-105471157 ATGAAATGAGAGAAGGAAGGAGG - Intergenic
1101629156 12:106476593-106476615 ATGAATGAAATGAAGCAAGAAGG - Intronic
1101823750 12:108204356-108204378 AGGAAGGAAAGGAAGGAAGGAGG - Intronic
1101947534 12:109149397-109149419 AGGAATGGACAGCAGGGAGGGGG + Intronic
1102501156 12:113353554-113353576 AGGGAAGAAGAGAAGGAAGGAGG - Intronic
1102501174 12:113353610-113353632 AGGAAAGAAGGGAAGGAAGGAGG - Intronic
1102544195 12:113642759-113642781 AAGAAGGGAAAGAAGGAAGGAGG - Intergenic
1102641983 12:114374863-114374885 ATCAATAAAAAGAAGGAGGGAGG + Intronic
1103075885 12:117982269-117982291 ATAAATAAACAAAAGGAAGTTGG - Intergenic
1103257388 12:119553714-119553736 ACGAATGAATGGAAGGAATGGGG + Intergenic
1103368232 12:120398528-120398550 ATGAATGAAGAGCAGGGAGGTGG - Intergenic
1103886690 12:124207744-124207766 TGGAAGGAACAGAGGGAAGGAGG + Intronic
1103965126 12:124633904-124633926 ATGAATGCTCAGAATGAAGGTGG + Intergenic
1105211651 13:18260687-18260709 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1105481211 13:20777733-20777755 ATGAATGAACAAAAGCAAATAGG - Exonic
1105559720 13:21479021-21479043 AGGAAGGAACAGAGGGAGGGAGG + Intergenic
1105598233 13:21860481-21860503 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1105667476 13:22576012-22576034 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106168046 13:27266232-27266254 ATAAAAGAAAAGAAGGAGGGAGG - Intergenic
1106426831 13:29639132-29639154 ATGTTTGAAAAGAAGAAAGGTGG + Intergenic
1106428864 13:29659934-29659956 AAGAAAGAAAGGAAGGAAGGAGG + Intergenic
1106451769 13:29888821-29888843 GTGAGTTATCAGAAGGAAGGAGG + Intergenic
1107101581 13:36598862-36598884 AGGAATGACCATAAGGAAGTAGG + Intergenic
1107406785 13:40122114-40122136 ATGGATGAACCTAAGGAAAGGGG + Intergenic
1107430051 13:40332415-40332437 ATGACTGAACCTGAGGAAGGGGG + Intergenic
1107694295 13:42985547-42985569 ATGAAAGGACCGAAGGAAAGAGG + Intronic
1107999430 13:45892727-45892749 AAGAAGCAACAGGAGGAAGGAGG + Intergenic
1108121425 13:47191285-47191307 ATAAATGAATAGAAGGGAGAGGG + Intergenic
1108137316 13:47379529-47379551 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1108289955 13:48949139-48949161 GTGTATGAACTGAAGGAAAGAGG + Intergenic
1108491205 13:50983334-50983356 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1108607601 13:52055214-52055236 ATGAATGAAATGAAGCAAGAAGG + Intronic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1108822363 13:54368747-54368769 AGGAAGGAAGAGAAGGAGGGAGG + Intergenic
1108895527 13:55322630-55322652 AAGAAAAAATAGAAGGAAGGAGG - Intergenic
1108942065 13:55968221-55968243 ATGAATGTAGAGAAGAAATGAGG + Intergenic
1108979377 13:56491522-56491544 ATGAAGAAACAGAGAGAAGGGGG + Intergenic
1109159962 13:58958921-58958943 ATTAGTGAACAGAATGAAGGTGG - Intergenic
1109370696 13:61416173-61416195 AGGAAGGAAAGGAAGGAAGGAGG - Intronic
1109576879 13:64271214-64271236 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1109671447 13:65613664-65613686 AGGAAAGAGAAGAAGGAAGGAGG - Intergenic
1110169488 13:72483923-72483945 AAGAATGTACAAAAGGTAGGGGG - Intergenic
1110459734 13:75732351-75732373 ATGAATGAAATGAAGCAAGAAGG - Intronic
1110599364 13:77354446-77354468 ATGAATTAACTGAATGAAGCAGG + Intergenic
1110829174 13:80010984-80011006 ATGAATTCACAGAAAGGAGGGGG - Intergenic
1110935394 13:81281152-81281174 AAGAATGAAGAAAGGGAAGGAGG + Intergenic
1110996020 13:82110914-82110936 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1111497875 13:89076893-89076915 AGGAAAGAAAGGAAGGAAGGAGG - Intergenic
1111723204 13:91973193-91973215 ATGAATGAAATGAAGCAAGAAGG - Intronic
1111724859 13:91994284-91994306 ATGGATAAACAAAATGAAGGGGG - Intronic
1112239947 13:97672141-97672163 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1112539054 13:100288809-100288831 AAAAAGGAAAAGAAGGAAGGAGG - Intronic
1112745595 13:102523428-102523450 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1112971513 13:105268558-105268580 ACGGAAGAAAAGAAGGAAGGGGG - Intergenic
1113154778 13:107307316-107307338 ATGAGAGAACAGAGGGAAAGAGG + Intronic
1113350290 13:109522879-109522901 ATGAATAAACTCAAGCAAGGAGG - Intergenic
1113387816 13:109866738-109866760 AAGAAAGAAAAGAAGGAAAGAGG + Intergenic
1113571748 13:111362916-111362938 ATGACTGAAGACAAGGGAGGTGG + Intergenic
1113641469 13:111960490-111960512 ATGAATGAATAGATGGATGGAGG + Intergenic
1113695032 13:112339238-112339260 AGGACTGAAGAGAAGGAGGGAGG - Intergenic
1114148544 14:20008065-20008087 AGGGAGGAAAAGAAGGAAGGAGG + Intergenic
1114156111 14:20105058-20105080 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1114553724 14:23549633-23549655 TAGAATGAACTGAAGGATGGGGG + Intronic
1114869069 14:26633999-26634021 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1114872743 14:26678046-26678068 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1115435645 14:33369989-33370011 ATGAAGAAAGAGTAGGAAGGAGG - Intronic
1115480050 14:33851710-33851732 ATACATGAACAGATGGGAGGAGG + Intergenic
1115719718 14:36147389-36147411 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1116074807 14:40097834-40097856 AAGAAGGAACGGAAGGAGGGAGG - Intergenic
1116092535 14:40327483-40327505 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1116094409 14:40349337-40349359 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1116096817 14:40380729-40380751 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1116138032 14:40953635-40953657 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1116224622 14:42133607-42133629 ATGAATGAATATAAGAAATGCGG + Intergenic
1116306496 14:43263341-43263363 ATGAATGAAATGAAGCAAGACGG + Intergenic
1116524441 14:45887957-45887979 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1116538085 14:46061435-46061457 TAAAATGAACAGAAGGTAGGTGG + Intergenic
1116829144 14:49700670-49700692 ATGTTTGAAAAGAATGAAGGTGG + Intronic
1117002989 14:51390601-51390623 ATCAATGACCAAAAGAAAGGGGG - Intergenic
1117287918 14:54305558-54305580 ATGATCAAACAGAAGGAAGAAGG + Intergenic
1117441966 14:55768459-55768481 TTGAATGAAGAGAAGAATGGTGG + Intergenic
1117663670 14:58033818-58033840 ATGAATGAAATGAAGCAAGAAGG + Intronic
1117896360 14:60491506-60491528 ATTAATGAAAAGGATGAAGGAGG - Intronic
1118059831 14:62123491-62123513 ATCAATGACAAGAAAGAAGGTGG - Intergenic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118505067 14:66402327-66402349 AGGAATTAAGAGAAGGAAGGTGG - Intergenic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119151936 14:72368609-72368631 ATGAATGAATTGAAGCAAGAGGG - Intronic
1120233062 14:81860166-81860188 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1120288174 14:82532333-82532355 AAGAAAGAAAAGAAGGAAGGAGG - Intergenic
1120331198 14:83094518-83094540 ATGAATCATGAGAAAGAAGGTGG + Intergenic
1120489577 14:85160299-85160321 ATGAATTAACAAATGGAAGAAGG - Intergenic
1120871386 14:89340085-89340107 AGGAAAGAGAAGAAGGAAGGGGG + Intronic
1120903144 14:89593155-89593177 AAGAAAGCAGAGAAGGAAGGAGG + Intronic
1120971421 14:90211506-90211528 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1121481397 14:94278580-94278602 ATGAAGGAAGAGAGGGAGGGTGG - Intronic
1121612832 14:95293213-95293235 AGGGAGGAAAAGAAGGAAGGAGG - Intronic
1121624573 14:95374805-95374827 AAGAAAGAAAAGAAGGAGGGAGG - Intergenic
1121799211 14:96759447-96759469 ATGAATGAATACATCGAAGGAGG - Intergenic
1121800287 14:96768984-96769006 AAGAAAGGAAAGAAGGAAGGAGG - Intergenic
1121871942 14:97416207-97416229 ATGAAAGAAGAGAAAGAAAGGGG - Intergenic
1121940726 14:98068123-98068145 AGGAATGAGCAGAGGAAAGGAGG + Intergenic
1122000394 14:98646103-98646125 GTGAATGAGCAGAAGGTATGAGG - Intergenic
1122233714 14:100320401-100320423 ATGGATGGACAGAGGGATGGAGG - Intergenic
1122322273 14:100862211-100862233 ACAAATGAAAGGAAGGAAGGAGG - Intergenic
1123158149 14:106250580-106250602 ATGAATGAACAGATAAAATGTGG + Intergenic
1123817838 15:23997723-23997745 ATGCATGAACAAAAGGCATGGGG + Intergenic
1124003446 15:25778191-25778213 ATGAATGATCAGTTGGAAGTGGG - Intronic
1124139113 15:27061983-27062005 GTCAGTGGACAGAAGGAAGGAGG - Intronic
1124236875 15:27997219-27997241 AAGAAAGAAAGGAAGGAAGGAGG + Intronic
1124428590 15:29586083-29586105 ATGAATGAACAGACAAAATGTGG + Intergenic
1125208444 15:37182322-37182344 GGGAATGAACAGAAGGGATGTGG + Intergenic
1125232122 15:37468303-37468325 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1125298883 15:38233223-38233245 ATGAAGGGGCAGAATGAAGGGGG + Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1125838315 15:42773768-42773790 ATGAATGGAAAGAGGAAAGGTGG + Intronic
1126237980 15:46407854-46407876 ATGTAGGAATAGAAAGAAGGAGG - Intergenic
1126388510 15:48119904-48119926 ACGAAGGAAAGGAAGGAAGGAGG + Intergenic
1126443855 15:48720129-48720151 ATCGATTGACAGAAGGAAGGAGG + Intronic
1126501954 15:49355505-49355527 ATGAATGAAATGAAGCAAGAAGG + Intronic
1126505266 15:49397262-49397284 ATGAATGAAATGAAGCAAGAAGG + Intronic
1126677635 15:51174255-51174277 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1126683066 15:51222725-51222747 ATGAATGAACGGAAGGAGATAGG + Intronic
1126763702 15:51992802-51992824 ATGGATGAACAGTCGGATGGAGG + Intronic
1127566713 15:60196546-60196568 AGGAATAAAGGGAAGGAAGGAGG + Intergenic
1128095720 15:64953432-64953454 AAGAAAGAAGAAAAGGAAGGAGG - Intronic
1128408593 15:67369547-67369569 AGGAAGGAAGAAAAGGAAGGAGG + Intronic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1128699680 15:69795104-69795126 AGGAAGGAAAAGAAGGAAAGGGG + Intergenic
1128793392 15:70449080-70449102 ATGGAGGAAGAGAAGGATGGAGG + Intergenic
1128793449 15:70449275-70449297 GTGGATGGATAGAAGGAAGGAGG + Intergenic
1128793618 15:70449879-70449901 ATGAATGGAGAGAGGGATGGAGG + Intergenic
1128793684 15:70450134-70450156 ATGAGTGGATAGAAGGATGGAGG + Intergenic
1128793740 15:70450336-70450358 ATGGATGAATAGAGGGATGGAGG + Intergenic
1128851277 15:70959491-70959513 AAGAAAGAAAGGAAGGAAGGAGG + Intronic
1128853726 15:70989359-70989381 ATGAATGAAATGAAGCAAGAAGG - Intronic
1128903702 15:71448985-71449007 GAGAATGAACAGAAGGCAAGGGG - Intronic
1128942158 15:71797752-71797774 ATGAATGAAATGAAGCAAGAAGG - Intronic
1129192340 15:73944774-73944796 TTAACTGAACAGAGGGAAGGAGG + Intronic
1129454405 15:75669087-75669109 ACACATGAACTGAAGGAAGGAGG - Intergenic
1129824957 15:78628879-78628901 ATGAATTAACTGCAGGAAGTGGG + Intronic
1129837605 15:78721109-78721131 ATGAATGAAATGAAGCAAGAAGG + Intronic
1129999045 15:80031586-80031608 ATGAATGAAGAGATGGGTGGTGG + Intergenic
1130127412 15:81105350-81105372 AAGGAGGAAAAGAAGGAAGGAGG - Intronic
1131013650 15:89039952-89039974 ATGAATGGATGGAAGAAAGGAGG + Intergenic
1131306868 15:91252731-91252753 ATGAAGGAAGGGAAGGAAGGAGG - Intronic
1131331339 15:91501899-91501921 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1131338552 15:91573429-91573451 AGGAAGGAAGAGAAAGAAGGAGG + Intergenic
1131527966 15:93167658-93167680 AGGAAAGAAGAGAGGGAAGGAGG - Intergenic
1131584320 15:93676678-93676700 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1131928954 15:97418037-97418059 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1132766810 16:1538511-1538533 AGGAAAGACCAGAATGAAGGGGG - Intronic
1133399408 16:5473787-5473809 ATGAATTGAAAGAGGGAAGGTGG + Intergenic
1133626759 16:7577332-7577354 ATGTATGAAGGGAAGGCAGGAGG - Intronic
1133668995 16:7999148-7999170 ATGCAAGAACAGGAGGAGGGGGG - Intergenic
1133716961 16:8459009-8459031 AAAAAAGAACAGAAGGAAGGCGG - Intergenic
1134105861 16:11485630-11485652 AGGAAAGAAAAGATGGAAGGTGG - Intronic
1134209004 16:12260366-12260388 ATGAAGGATGAGAAGGAAGACGG - Intronic
1134325613 16:13204886-13204908 AAGAATGAACTGAAGGAACCAGG - Intronic
1134329002 16:13233273-13233295 ATGAAGGAAGAGAGGGAGGGAGG + Intronic
1134440513 16:14297030-14297052 AGGAAGGAAAGGAAGGAAGGAGG - Intergenic
1134764975 16:16749764-16749786 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1134822523 16:17258188-17258210 AGGAAGGAAAAGAAGAAAGGAGG + Intronic
1134849398 16:17468684-17468706 ACAAATGAAGAGAAGGAAGGAGG - Intronic
1135177574 16:20244372-20244394 AAGAATGAAAGGAAGGAAAGAGG - Intergenic
1135348270 16:21707695-21707717 AAGAAAGAAAGGAAGGAAGGAGG - Intronic
1135522479 16:23188037-23188059 ATGGATGGAAAGAAGGAAGGAGG - Intronic
1135745342 16:25012146-25012168 ATGAATCAACAAAAGGCAGGTGG + Intronic
1135898503 16:26432832-26432854 ATGAATGAATGAATGGAAGGAGG + Intergenic
1135939563 16:26809633-26809655 AGGAAGGGAAAGAAGGAAGGAGG + Intergenic
1136065154 16:27753746-27753768 AAGGAGGAAAAGAAGGAAGGAGG - Intronic
1136539106 16:30918740-30918762 AGGAAGGAGAAGAAGGAAGGAGG - Intergenic
1136771023 16:32841409-32841431 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1136869158 16:33788661-33788683 ATGAATGAACAGATAAAATGTGG - Intergenic
1136899549 16:34020073-34020095 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1136946094 16:34652815-34652837 AGGAAGGAAGAAAAGGAAGGCGG + Intergenic
1136983145 16:35076188-35076210 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1137083629 16:36096638-36096660 ATGAATGAAACGAAGGGAGAAGG - Intergenic
1137228365 16:46536757-46536779 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1137683347 16:50369287-50369309 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
1137774074 16:51041082-51041104 AGGAATGAAGACAAGGAAGAAGG + Intergenic
1137922378 16:52503522-52503544 ATGAATGAGCAAATGAAAGGAGG + Intronic
1137931022 16:52587879-52587901 GTGCATGAACAGAGTGAAGGTGG + Intergenic
1137977084 16:53041122-53041144 CTGGATGAAAGGAAGGAAGGAGG + Intergenic
1138248952 16:55487862-55487884 AAGAATGAAGAGGAGGAGGGAGG - Intronic
1138372736 16:56540220-56540242 GTGAATGACCATGAGGAAGGAGG - Intergenic
1138436335 16:57002449-57002471 ATGAATGAACAGAGAAAATGTGG - Intronic
1138541598 16:57691039-57691061 AAGAAGGAAGAGAAGGAAGGAGG + Intergenic
1138637429 16:58352228-58352250 ATGAATAAACAGAAGCAATGAGG - Intronic
1139131196 16:64148266-64148288 AGGAAGGAAGGGAAGGAAGGAGG - Intergenic
1139131206 16:64148321-64148343 AAGAAGGAAGGGAAGGAAGGAGG - Intergenic
1139834120 16:69824528-69824550 AGGAAGGAACAAAGGGAAGGGGG - Intronic
1140173206 16:72628552-72628574 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1140328257 16:74026974-74026996 AGGAAGGAACGGAAGGAAGGGGG + Intergenic
1140379084 16:74470276-74470298 AGGAAGGAAAGGAAGGAAGGAGG - Intronic
1140379096 16:74470313-74470335 AAGAAGGAAAGGAAGGAAGGAGG - Intronic
1140938432 16:79697756-79697778 AGGAAGGAAGAGAGGGAAGGAGG - Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141031964 16:80596923-80596945 ACGAATGAACAGAAGAATGACGG + Intergenic
1141031989 16:80597060-80597082 AGAGATGAACAGAAGGATGGTGG + Intergenic
1141042894 16:80687418-80687440 ATGAATGGATAGATGGATGGTGG + Intronic
1141212728 16:81996228-81996250 GAGAATGGACTGAAGGAAGGAGG + Exonic
1141472218 16:84246831-84246853 TGGAATAAACAGGAGGAAGGTGG + Intergenic
1141619052 16:85227086-85227108 ATGGATGAAAAGAAGGACTGAGG - Intergenic
1141854780 16:86673618-86673640 ATGAATGGACAAAATGATGGAGG - Intergenic
1141854847 16:86673943-86673965 AGGGATGAACAGATGGATGGGGG - Intergenic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1141856217 16:86683082-86683104 AAGGAAGAAAAGAAGGAAGGAGG + Intergenic
1141856223 16:86683106-86683128 GAGAAGGAAAAGAAGGAAGGAGG + Intergenic
1141898026 16:86971088-86971110 ATCAAGGAGCAGAAGCAAGGTGG + Intergenic
1203073446 16_KI270728v1_random:1103522-1103544 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1203103015 16_KI270728v1_random:1327407-1327429 ATGAATGAACAGATAAAATGTGG + Intergenic
1143651859 17:8268391-8268413 AAGAAGGAAAGGAAGGAAGGAGG + Intronic
1143964089 17:10743940-10743962 AGGAAGGAAGAGAAGGAGGGAGG - Intergenic
1145279731 17:21458382-21458404 ATGAATGAAGGGGAGGGAGGCGG + Intergenic
1145679460 17:26569774-26569796 ATGATTGAACAGAAAGAGAGAGG - Intergenic
1145681039 17:26592446-26592468 ATGATTGAACAGAAAGAGAGAGG - Intergenic
1145690809 17:26737117-26737139 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1145718265 17:27044389-27044411 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1145943544 17:28757093-28757115 AAGAATGGACAGAGGGCAGGAGG + Exonic
1146034299 17:29391575-29391597 ATGTATACACAGAAGGGAGGGGG + Intronic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1146407586 17:32552532-32552554 ATGGATGGATAAAAGGAAGGAGG - Intronic
1146422253 17:32698378-32698400 AAAAAAGAAAAGAAGGAAGGAGG - Intronic
1146939193 17:36832296-36832318 ATGGATGGACAGATGGATGGTGG - Intergenic
1147006913 17:37410714-37410736 ATGAAAGGACAGAAGGCAGTTGG - Intronic
1147142590 17:38467737-38467759 ATGAATGAACAAAAGAAGGAGGG - Intronic
1147310781 17:39595148-39595170 GTGAATGAAGAGAAGGAATTGGG - Intergenic
1147520610 17:41168718-41168740 TTGAATGAACAGAATAAAGCAGG - Intergenic
1147723101 17:42550631-42550653 ATGAATGTACGGAAGAGAGGGGG - Exonic
1147724313 17:42556857-42556879 ATGAATGTACGGAAGAGAGGGGG - Intergenic
1147770340 17:42863721-42863743 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1147901593 17:43789824-43789846 ATAAATTAACAGAAGGAGGCTGG - Intergenic
1148234143 17:45956191-45956213 AGGAATGAGCTGAAGGATGGGGG + Intronic
1148583559 17:48760641-48760663 ATGAGTGAACAGACAGGAGGTGG + Intergenic
1149012390 17:51871018-51871040 AAGAAAGTAAAGAAGGAAGGAGG - Intronic
1149247348 17:54726262-54726284 ATGAATGAACAAAGAAAAGGTGG + Intergenic
1149259320 17:54861705-54861727 ATGAATGAAATGAAGGAAAATGG - Intergenic
1149338500 17:55662627-55662649 ATGGGTGAAGGGAAGGAAGGAGG - Intergenic
1149537857 17:57446281-57446303 TTCAGGGAACAGAAGGAAGGAGG + Intronic
1149544315 17:57491805-57491827 TTGAATGAACAGCAGGAAGGAGG - Intronic
1150105781 17:62461566-62461588 AGGAAGGAAGAGAAGGAAGGAGG - Intronic
1150293157 17:63993254-63993276 AAGAAAGGAAAGAAGGAAGGAGG + Intergenic
1150293175 17:63993307-63993329 AAGAAAGGAAAGAAGGAAGGAGG + Intergenic
1151233042 17:72698639-72698661 ATGAATAAATAAAAGGAAAGTGG - Intronic
1151428790 17:74048788-74048810 ATGAATGAATGAAAGGAAGAAGG + Intergenic
1151949740 17:77344621-77344643 ATGAATGAACAGACAAAATGTGG + Intronic
1152044719 17:77928421-77928443 CTGAATGAAGAAAAGGAAGCAGG + Intergenic
1152098904 17:78289486-78289508 ATGAATGAAGGGACAGAAGGCGG + Intergenic
1152311292 17:79551547-79551569 ATGGATGGGCAGATGGAAGGTGG + Intergenic
1152328491 17:79656662-79656684 AAGAAAGGAAAGAAGGAAGGAGG + Intergenic
1153134107 18:1893983-1894005 ATGAATGAAAAGAAGCAGGGCGG - Intergenic
1153430007 18:5005408-5005430 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1153507699 18:5818914-5818936 ATGAAGGAAAAGAACAAAGGTGG - Intergenic
1153543735 18:6185206-6185228 ATAAACAAACAGAGGGAAGGCGG + Intronic
1153812713 18:8765894-8765916 CTGAGTGGACAGAAGGAAAGAGG - Intronic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1153974170 18:10252382-10252404 ATGAATGGATAGACGGATGGTGG - Intergenic
1154505807 18:15039872-15039894 ATGAAGGAACAAAATGAAGTTGG + Intergenic
1155141303 18:23047014-23047036 CTGAATGATCAGAAAAAAGGGGG + Intergenic
1155339552 18:24799912-24799934 TTGAATGAATTAAAGGAAGGGGG + Intergenic
1155409916 18:25532593-25532615 GGTAATAAACAGAAGGAAGGAGG + Intergenic
1155455665 18:26009863-26009885 AGGGATGCACAGAAGGAAGCAGG - Intergenic
1155692568 18:28643984-28644006 AAGGAAGAAAAGAAGGAAGGAGG + Intergenic
1155694669 18:28671115-28671137 AGGAGGGAACACAAGGAAGGAGG + Intergenic
1155712932 18:28905079-28905101 AGGAATGAAGAAAAGGAAAGAGG - Intergenic
1156344006 18:36239861-36239883 ATGAATGAAATGAAGCAAGAAGG - Intronic
1156764343 18:40633116-40633138 AAGAAAGGAAAGAAGGAAGGAGG + Intergenic
1156826347 18:41434487-41434509 AGGAAGGAAGAGAGGGAAGGAGG + Intergenic
1157499601 18:48180231-48180253 ATGGATGGAAGGAAGGAAGGAGG - Intronic
1157618444 18:49001629-49001651 AGGAAGGAAGAGAAGGAAGGTGG + Intergenic
1157622319 18:49023770-49023792 AGGAAGGAACAGAAGGGAGAAGG - Intergenic
1157648485 18:49302622-49302644 GTGAAAGAAGAGAAGTAAGGGGG + Intronic
1158074522 18:53512726-53512748 ATGAATGAAATGAAGCAAGAAGG + Intronic
1158132449 18:54167816-54167838 ATGGATGAAAAGTAGTAAGGTGG + Intronic
1158177026 18:54668906-54668928 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1158641588 18:59208160-59208182 ATGGATGGAAGGAAGGAAGGAGG + Intergenic
1158952453 18:62506901-62506923 ATGAATGAAAAGAAGAAAATGGG - Intergenic
1159116490 18:64119245-64119267 GAGGAAGAACAGAAGGAAGGAGG + Intergenic
1159133292 18:64306222-64306244 GTGAATAAATAGATGGAAGGGGG + Intergenic
1159134312 18:64319005-64319027 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
1159352545 18:67294545-67294567 AGGAAAGAAAGGAAGGAAGGAGG - Intergenic
1159440155 18:68468080-68468102 ATGAATTAACACATGGAGGGTGG + Intergenic
1160041259 18:75347746-75347768 AAGAATGAAGAGAGGGAGGGAGG + Intergenic
1160526659 18:79542553-79542575 ATGAATGAATGGATGGATGGTGG - Intergenic
1161259962 19:3332421-3332443 AGGAAGGAAAGGAAGGAAGGAGG - Intergenic
1161259975 19:3332462-3332484 AGGAAGGAAAGGAAGGAAGGAGG - Intergenic
1161329093 19:3677968-3677990 ATGGAGGAATAGAGGGAAGGAGG + Intronic
1161427722 19:4213238-4213260 AAGAAGGAAAGGAAGGAAGGAGG - Intronic
1161427732 19:4213280-4213302 AGGAAAGAAAGGAAGGAAGGAGG - Intronic
1161510521 19:4668369-4668391 ATGTCTGGACAGAAGGAGGGAGG - Intronic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1161919998 19:7258961-7258983 AGGAAAGAAAAAAAGGAAGGAGG - Intronic
1161920012 19:7259033-7259055 AAGAAAGAAAGGAAGGAAGGAGG - Intronic
1161982882 19:7638988-7639010 ATGGATGGACAGATGGATGGAGG - Intronic
1162062843 19:8107263-8107285 ATAAATGGACAGAAGGAGGGGGG + Intronic
1162062917 19:8107589-8107611 ATGAATGGACAGAAAGATGGGGG + Intronic
1162062976 19:8107896-8107918 ATAAATGGACAGAAGGATGGAGG + Intronic
1162180860 19:8867791-8867813 ATGGAAGGACAGAAGGAAGGAGG + Intronic
1162190692 19:8944094-8944116 ATGGATGGAAAGAAGAAAGGAGG - Intronic
1162228262 19:9242915-9242937 AAGAAAGACAAGAAGGAAGGAGG - Intergenic
1162334093 19:10049571-10049593 AAGAAAGAAGAGAAAGAAGGGGG + Intergenic
1162803424 19:13123552-13123574 AAGAATGAAAAGAATGAAGAAGG + Intronic
1163382706 19:16979295-16979317 ATGGATGAATAGATGGATGGAGG - Intronic
1163475771 19:17525322-17525344 ATGAATGAAGGGAGGGACGGAGG - Intronic
1163730461 19:18946441-18946463 GGGAATGAAGAGAAGGAAGAGGG - Intergenic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1164246498 19:23434858-23434880 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1164430009 19:28178858-28178880 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1164478743 19:28595226-28595248 ATGAGTGGATAGAAGGAAAGAGG + Intergenic
1164726193 19:30467562-30467584 ATGAATGACGACAAGGAGGGTGG + Intronic
1164903151 19:31945495-31945517 ATGATGGAACAGAAGGCAAGAGG - Intergenic
1164915117 19:32046065-32046087 AAGGAAGAAAAGAAGGAAGGAGG + Intergenic
1164953625 19:32361783-32361805 AGGAAGGAAAGGAAGGAAGGAGG - Intronic
1164978273 19:32592218-32592240 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1165113239 19:33514069-33514091 ATGAATGAAAAAACGGATGGTGG + Intronic
1165204273 19:34170749-34170771 ATGAATGAACAGCAGGATGAAGG - Intergenic
1165563489 19:36702651-36702673 ATGAATGAAATGAAGCAAGAAGG - Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165919905 19:39289908-39289930 CTGGATGAACAGAAAGAAAGTGG - Intergenic
1166173165 19:41046642-41046664 GTGAAAGAAAGGAAGGAAGGAGG - Intergenic
1166182412 19:41118224-41118246 AGGGACCAACAGAAGGAAGGAGG + Intronic
1166299883 19:41907547-41907569 ATGAATGAACAACTGGAGGGAGG - Intronic
1166594671 19:44034920-44034942 ATGCCTGGACATAAGGAAGGCGG + Intergenic
1166666530 19:44683705-44683727 TTGAAGGAACAGACCGAAGGCGG - Exonic
1167058667 19:47129793-47129815 AAGAAAGAAAGGAAGGAAGGAGG - Intronic
1167218680 19:48182875-48182897 ATGAATGAACGGATGAATGGAGG - Intronic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
1167455210 19:49594269-49594291 ATGAATGAGGGGAGGGAAGGGGG - Intronic
1167915058 19:52734097-52734119 ATGAAGGATCACAAGGTAGGGGG - Intronic
1202658620 1_KI270708v1_random:48255-48277 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1202670458 1_KI270709v1_random:45201-45223 ATGAATGAAACGAAGGGAGAAGG + Intergenic
925358552 2:3261341-3261363 ATGAATGAGCAGAAGGCTGAGGG + Intronic
925502220 2:4518199-4518221 ATCAAGGTACACAAGGAAGGAGG + Intergenic
925862240 2:8190472-8190494 AAGAAGGAAAAGAATGAAGGAGG - Intergenic
925961442 2:9020977-9020999 ATGAAAGAAAAGGAGGAAGAAGG - Intergenic
926048246 2:9726037-9726059 ATGAAAGAAAAGAAGAAAGAAGG + Intergenic
926221070 2:10935712-10935734 GTGAATGAACAGCAGGAGGCCGG - Intergenic
926266880 2:11331001-11331023 AGGAAGGAGCAGAAAGAAGGAGG + Intronic
926460611 2:13125224-13125246 AGGAAAGAAAAGAATGAAGGAGG + Intergenic
926653492 2:15371842-15371864 ATGAATGAAGAGAAAGGATGTGG + Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926771414 2:16379567-16379589 ATAAATGGACAGAATGAAAGAGG + Intergenic
926947706 2:18206179-18206201 AGGAAGGAAGGGAAGGAAGGAGG - Intronic
927709158 2:25314434-25314456 GTGAATGAAGAGAAGGGAGGAGG - Intronic
928166121 2:28973363-28973385 AGGAAGGAAGGGAAGGAAGGAGG - Intronic
928260985 2:29766488-29766510 ATGAATGAACAGGAGGTGGTGGG - Intronic
928269500 2:29843418-29843440 CTGGAAGAAAAGAAGGAAGGAGG + Intronic
928463488 2:31497709-31497731 ATGAATGAAATGAAGCAAGAAGG + Intergenic
928540401 2:32278599-32278621 AAGAATGAGAAAAAGGAAGGAGG + Intronic
928743871 2:34388978-34389000 ATGAATGAAAAGTAGGACAGTGG + Intergenic
928762362 2:34599805-34599827 ATGGAAAAACAGAAGGTAGGAGG - Intergenic
928789007 2:34928735-34928757 AGGAAGGAACAGAGGGAGGGAGG - Intergenic
928900126 2:36308723-36308745 ATGAATGAACTGACAGAAGTGGG + Intergenic
928955123 2:36858277-36858299 ATGGAAGGACAAAAGGAAGGGGG - Intronic
929344957 2:40870790-40870812 ATGAATGAACCAAATGAAAGGGG - Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929566649 2:42990752-42990774 ATGAATGAAAAGAAGTAAGAAGG + Intergenic
930255219 2:49082760-49082782 ATGAATGAAATGAAGCGAGGAGG + Intronic
930392384 2:50778543-50778565 TGGAATGAACAAAAGGAAGGTGG + Intronic
930615432 2:53588301-53588323 ATGAATGAAATGAAGCAAGAAGG + Intronic
930654359 2:53993328-53993350 AGGAGTGAAATGAAGGAAGGAGG + Intronic
930665868 2:54097896-54097918 AAGAAAGAAAGGAAGGAAGGAGG - Intronic
930830760 2:55741090-55741112 ATGAATGAAATGAAGCAAGAAGG - Intergenic
930990781 2:57651102-57651124 ATGAAAGGACAGAAAGAAGCAGG - Intergenic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
931261860 2:60626984-60627006 ATGAATGAAGAGGGGGAAGAAGG + Intergenic
931619618 2:64196678-64196700 GTGAAAGAACAGAAAGAAAGGGG - Intergenic
931853890 2:66281524-66281546 ATGAATGGACAGAGAGATGGAGG - Intergenic
931947336 2:67324793-67324815 ATTAAAGAAGAAAAGGAAGGGGG + Intergenic
931975188 2:67636413-67636435 AAGAATGAAGAGAAGTAAAGAGG - Intergenic
931977193 2:67655477-67655499 ATGAATGAAATGAAGCAAGAAGG + Intergenic
932027609 2:68151365-68151387 CTGAATGAAGAGAAGGATAGAGG - Intronic
932156957 2:69426773-69426795 ATGAATAATCATAATGAAGGGGG + Intronic
932310115 2:70732944-70732966 ATGTATGAACAGACAGATGGAGG - Intronic
932393188 2:71416204-71416226 ATGAATGAAATGAAGCAAGAAGG - Intronic
932406392 2:71515585-71515607 AGGAAAGAGCAGGAGGAAGGGGG - Intronic
932503001 2:72200958-72200980 AAGAATGGAGAGAAGGCAGGGGG - Intronic
932980002 2:76652722-76652744 ATGAATGAAATGAAGCAAGAAGG - Intergenic
933169547 2:79110418-79110440 ATGAATGAAATGAAGCAAGAAGG - Intergenic
933186672 2:79286982-79287004 ATGAATGAAATGAAGCAAGAAGG - Intronic
933296807 2:80500325-80500347 ATGAATGAATAAATGGATGGTGG - Intronic
933373878 2:81453514-81453536 TTCAAAGAACAGTAGGAAGGAGG + Intergenic
933630739 2:84654295-84654317 ATGAATGAATAGAACACAGGTGG - Intronic
933726615 2:85430829-85430851 ATGAAGGAACGGAGGGAGGGAGG + Intronic
933860421 2:86461288-86461310 ATGGAGGAACAGAGGGAAGGAGG - Intronic
933876551 2:86625722-86625744 ATGAATGAAACAAAGCAAGGGGG - Intronic
933879935 2:86659969-86659991 ATGAATGAAATGAAGCAAGAAGG - Intronic
933892462 2:86784375-86784397 AAGAAAGAACAAAAGGAAGAAGG + Intergenic
933996933 2:87677014-87677036 ATGAAGGCACAGAAGCAAGACGG + Intergenic
934114652 2:88775739-88775761 GTGAATGAAGAGATGGCAGGAGG + Intergenic
934250972 2:90355071-90355093 ATGAATGAAATGAAGGGAGAAGG - Intergenic
934258591 2:91448339-91448361 ATGAATGAAATGAAGGGAGAAGG + Intergenic
934301970 2:91781768-91781790 ATGAATGGATAGAGGGAGGGAGG - Intergenic
934589814 2:95537044-95537066 AAGAATGGAAGGAAGGAAGGAGG + Intergenic
934613895 2:95759599-95759621 ATGAATGAATGGATGGATGGAGG + Intergenic
934631981 2:95936116-95936138 GTGAATGAAGAGATGGCAGGAGG - Intronic
934701221 2:96441858-96441880 ATGAATGAAAGGAAGCAAGAAGG + Intergenic
934801521 2:97167083-97167105 GTGAATGAAGAGATGGCAGGAGG + Intronic
935303795 2:101717779-101717801 ATAAATGAACAGAATGGAGACGG + Intronic
935403711 2:102686395-102686417 AGAAATGACTAGAAGGAAGGAGG - Intronic
935438967 2:103069298-103069320 AGGAAGGAAGGGAAGGAAGGAGG - Intergenic
935986171 2:108675332-108675354 GGGAAGGAAGAGAAGGAAGGAGG + Intronic
936138612 2:109918947-109918969 GGGAAGGAAGAGAAGGAAGGAGG + Intergenic
936206084 2:110452538-110452560 GGGAAGGAAGAGAAGGAAGGAGG - Intronic
936296917 2:111273896-111273918 ATGAAGGCACAGAAGCAAGACGG - Intergenic
936523065 2:113224242-113224264 ATGAATTAAAAGATGGATGGAGG + Intronic
936553876 2:113476216-113476238 ATGAATGAAATGAAGCAAGAAGG - Intronic
936576168 2:113657419-113657441 ATGAATGAAATGAAGCAAGAAGG + Intergenic
936621311 2:114101025-114101047 ATGAATGAAATGAAGCAAGAAGG - Intergenic
936681038 2:114771612-114771634 ATAGGTGAATAGAAGGAAGGAGG + Intronic
936930133 2:117779568-117779590 ATGAATGAACTGAAGCAAGAAGG + Intergenic
937085095 2:119166394-119166416 ATGAAGGCAGAGAAGGAAGTTGG - Intergenic
937250250 2:120519348-120519370 ATGAAGGAGGAGAGGGAAGGAGG - Intergenic
937580374 2:123478941-123478963 AGGAAAGAAAAGAAGGAAGAAGG - Intergenic
937619588 2:123970589-123970611 AGGAAGGAAGAGAGGGAAGGAGG + Intergenic
937676564 2:124597870-124597892 ATGAATGAAATGAAGCAAGAAGG - Intronic
937752869 2:125499032-125499054 AGGAATGAACATAACCAAGGAGG - Intergenic
938328962 2:130435347-130435369 ATGCAGGAAAGGAAGGAAGGGGG + Intergenic
938360985 2:130686145-130686167 ATGCAGGAAAGGAAGGAAGGGGG - Intergenic
938397363 2:130961445-130961467 AAGAAGGAACAGCAGCAAGGTGG + Intronic
938399991 2:130982609-130982631 AAGAAAGAAAAGAAGAAAGGAGG - Intronic
938520671 2:132067595-132067617 ATGAATGAAATGAAGCAAGAAGG - Intergenic
938860569 2:135364051-135364073 ATAAAAGAAATGAAGGAAGGAGG + Intronic
939117676 2:138079348-138079370 AGGAAGGAAAAGGAGGAAGGAGG - Intergenic
939121961 2:138127657-138127679 ATGAAAGAAAACAAGGAAGAAGG - Intergenic
939169267 2:138675000-138675022 ATGAAACAGGAGAAGGAAGGTGG - Intronic
939430590 2:142100915-142100937 ATGAAGGGAGAGAGGGAAGGAGG + Intronic
939478237 2:142714147-142714169 ATAGATGAAAAGAAAGAAGGAGG - Intergenic
939554999 2:143662830-143662852 ATGAATGAAATGAAGCAAGAAGG + Intronic
940168630 2:150802616-150802638 AGGAAAGGAGAGAAGGAAGGAGG - Intergenic
940253299 2:151703586-151703608 ATGAATGAAATGAAGCAAGAAGG - Intronic
940448052 2:153801495-153801517 ATGAATGAACAGCTGGTAGGTGG + Intergenic
940984873 2:160043060-160043082 GTGAATGAAGAAGAGGAAGGAGG + Intronic
941271702 2:163438169-163438191 ATGATTTAACAGAAAGAAAGAGG + Intergenic
941437248 2:165487210-165487232 ATGAATGAAATGAAGCAAGAAGG + Intronic
941626558 2:167836442-167836464 ATGAATGAAATGAAGCAAGAAGG + Intergenic
941758990 2:169220002-169220024 ATGAAGGCACAGAAGTATGGCGG - Intronic
941932652 2:170957574-170957596 AGGGATGAAGAAAAGGAAGGAGG - Intronic
942056809 2:172191994-172192016 ATGAATGAAATGAAGCAAGAAGG - Intergenic
942214345 2:173704109-173704131 ATGAATGAAATGAAGCAAGAAGG - Intergenic
942396350 2:175553798-175553820 ATGAATGAAAAGTGGGAAGAAGG - Intergenic
942439673 2:176019602-176019624 ATGAATGACTTTAAGGAAGGAGG + Intergenic
942731511 2:179065904-179065926 ATGAATGAAATGAAGCAAGAAGG - Intergenic
943097965 2:183453035-183453057 ATGAATGAAATGAAGCAAGAAGG - Intergenic
943191684 2:184685773-184685795 ATGAATGAACTGAAGCCTGGGGG - Intronic
943272399 2:185823543-185823565 AGGGAGGGACAGAAGGAAGGAGG + Intronic
943843349 2:192607120-192607142 AGAAATAAACAGAAGGAAAGAGG - Intergenic
943921162 2:193709633-193709655 ATGAATGAAATGAAGCAAGAAGG - Intergenic
944853424 2:203743370-203743392 ACAAATGCACAGAAGGAAGGGGG + Intergenic
944999805 2:205336450-205336472 AGAAATGAAGAGAAGGAAAGAGG - Intronic
945047035 2:205790725-205790747 ATGAATCAACAAGAGGAAGGTGG - Intronic
945270055 2:207929053-207929075 CTGAATGGATAGATGGAAGGAGG - Intronic
945856664 2:215077022-215077044 CTTCAGGAACAGAAGGAAGGAGG + Intronic
945876133 2:215279898-215279920 AGGAAGGAAGGGAAGGAAGGAGG + Intergenic
947189461 2:227487119-227487141 AGAAATTAACAGAAGGAGGGCGG - Intronic
947336303 2:229088413-229088435 AAGGAAGAAAAGAAGGAAGGAGG + Intronic
947465475 2:230341218-230341240 ATGAATGAAATGAAGCAAGAAGG - Intronic
947681566 2:232038306-232038328 AAGAAAGAACAGAAAGATGGTGG + Intronic
948005954 2:234607628-234607650 AAGAAGGAATAGAAGAAAGGAGG - Intergenic
948525720 2:238569779-238569801 AGGACAGAACAGAAGGCAGGCGG + Intergenic
948791954 2:240383734-240383756 AAGAAAGAACAAAAGGAAGATGG - Intergenic
948977884 2:241474831-241474853 ATAAATAAAAAGAAAGAAGGGGG + Intronic
1168915517 20:1482511-1482533 AAGAAAGAAAGGAAGGAAGGAGG - Intronic
1169096095 20:2900141-2900163 ATGAATGAAAAAAAAAAAGGAGG - Intronic
1169305090 20:4482682-4482704 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1170030690 20:11940788-11940810 AGGTATGCACAAAAGGAAGGAGG + Intergenic
1170250137 20:14271909-14271931 ATGAATGAAAAGAAGTGAGAAGG + Intronic
1170280062 20:14636404-14636426 AAGAAAGAAGAGAGGGAAGGAGG - Intronic
1170343613 20:15357774-15357796 ATGAATGAACAGTAAGAATGTGG - Intronic
1170348606 20:15415747-15415769 ATGGAAGAAAAGATGGAAGGAGG - Intronic
1170405605 20:16032668-16032690 ATGGATGAGAAGAGGGAAGGAGG + Intronic
1170514931 20:17119512-17119534 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1170536506 20:17346152-17346174 ATGAATCAACAAAATGAAGGAGG + Intronic
1170708264 20:18765798-18765820 ATAAATAAGCAGAAAGAAGGAGG - Intergenic
1170880994 20:20296315-20296337 AGGAAGGAAGGGAAGGAAGGAGG - Intronic
1171892900 20:30732514-30732536 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1171905053 20:30893704-30893726 AGGAGAGAACAGAGGGAAGGAGG - Intergenic
1172013505 20:31860188-31860210 ATGAATGAGGAGTAGGAAGTTGG + Intronic
1172493750 20:35362977-35362999 AAGAAAGAAAAGAAAGAAGGGGG - Intronic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1172898251 20:38315748-38315770 AGGAAAGAAAGGAAGGAAGGAGG - Intronic
1173056111 20:39614631-39614653 ATGGATGAACAGACAGAAAGAGG - Intergenic
1173156903 20:40620609-40620631 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173355398 20:42282888-42282910 ATGAGTGAGCAGATGGAAGGAGG + Intronic
1173438873 20:43057389-43057411 AAGGAGGAAAAGAAGGAAGGAGG + Intronic
1173623681 20:44455812-44455834 ATGAGTGAAGAGAAGAAGGGAGG + Intronic
1173787391 20:45804336-45804358 AAGGATGAACAGAAGGAAATAGG - Intronic
1174076878 20:47943657-47943679 AGAAATGAACAGAAGGAGGTTGG - Intergenic
1174356020 20:49998347-49998369 ATGAATGAGCAGACTGAGGGAGG + Intergenic
1174547174 20:51334303-51334325 AGGAGGGAAGAGAAGGAAGGAGG + Intergenic
1174660225 20:52205937-52205959 ATGAAAAATCAGAAGGTAGGTGG - Intergenic
1174684981 20:52446037-52446059 ATGAGGGAAAAGAAGGCAGGAGG + Intergenic
1174928181 20:54783786-54783808 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1174966763 20:55225048-55225070 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1175026130 20:55904971-55904993 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1175086500 20:56463861-56463883 ATGAATGAACGAAAGGAAAAGGG - Intergenic
1175142537 20:56871824-56871846 ATGGGTGATCAAAAGGAAGGCGG - Intergenic
1175499858 20:59442086-59442108 AGGAAGGAAGAGAAGGAGGGAGG - Intergenic
1175503420 20:59466152-59466174 ATCAATGAAGAGAAAGAAGGAGG + Intergenic
1175565420 20:59971951-59971973 ATTATTGAACAGCTGGAAGGAGG - Exonic
1175652345 20:60736254-60736276 ATGGAGGAACAGGAGGCAGGAGG - Intergenic
1175695151 20:61097627-61097649 AAGAAAGAAAGGAAGGAAGGAGG + Intergenic
1175745789 20:61456064-61456086 AGGGATGGAGAGAAGGAAGGAGG + Intronic
1175984011 20:62755280-62755302 AGGAATGAATGGAGGGAAGGAGG - Intronic
1176286558 21:5022003-5022025 ATGCATGAATGGAAGGAGGGAGG - Intergenic
1176292362 21:5052858-5052880 ATGAATGGAGGGAAGGAGGGAGG - Intergenic
1176292364 21:5052862-5052884 ATGGATGAATGGAGGGAAGGAGG - Intergenic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1176598644 21:8772164-8772186 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1176661927 21:9644908-9644930 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1176792054 21:13329154-13329176 ATGAAGGAACAAAATGAAGTCGG - Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1176941263 21:14928361-14928383 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1177112714 21:17048174-17048196 AGGAAAGAAGAGAAGGAAGGAGG + Intergenic
1177214403 21:18109760-18109782 ATGGATGAAAAGCAGGGAGGAGG + Intronic
1177369333 21:20181064-20181086 AGGGAAGAAGAGAAGGAAGGAGG - Intergenic
1177421675 21:20867365-20867387 AAGAATGAAAAAAAGAAAGGGGG - Intergenic
1177752655 21:25304725-25304747 GTGTCAGAACAGAAGGAAGGCGG + Intergenic
1178264575 21:31131075-31131097 ATGAATGAATGGAAGGTGGGTGG - Intronic
1178337879 21:31759937-31759959 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1178672167 21:34601451-34601473 ATCAATGTACAGCAGTAAGGAGG - Intronic
1178788779 21:35678658-35678680 ATGAATGAATGGATGCAAGGAGG + Intronic
1178940703 21:36902648-36902670 AAGAGAGAAAAGAAGGAAGGAGG + Intronic
1179163453 21:38916764-38916786 AGGAAGGAAGAAAAGGAAGGAGG + Intergenic
1179163460 21:38916801-38916823 AAGGAAGAAGAGAAGGAAGGAGG + Intergenic
1179163467 21:38916838-38916860 AAGGAAGAAGAGAAGGAAGGAGG + Intergenic
1179163477 21:38916883-38916905 AAGGAAGAAGAGAAGGAAGGAGG + Intergenic
1179269862 21:39842295-39842317 AAGAAGGGAGAGAAGGAAGGAGG - Intergenic
1179292069 21:40027603-40027625 ATGAATGAAATGAAGCAAGAAGG - Intronic
1179292969 21:40034429-40034451 ATGAATGAAATGAAGCAAGAAGG + Intronic
1179343407 21:40533630-40533652 ATGGATGGACAGATGGATGGAGG - Intronic
1179440056 21:41387303-41387325 ATTAATGCTCATAAGGAAGGGGG + Intronic
1179497321 21:41780945-41780967 AAGAAAGAAAGGAAGGAAGGAGG + Intergenic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1179864893 21:44210788-44210810 ATGGATGAATGGAGGGAAGGAGG + Intergenic
1179864895 21:44210792-44210814 ATGAATGGAGGGAAGGAGGGAGG + Intergenic
1179870623 21:44241472-44241494 ATGCATGAATGGAAGGAGGGAGG + Intergenic
1180070863 21:45435281-45435303 AGGAAGGAAGAGGAGGAAGGTGG + Intronic
1180693677 22:17738578-17738600 CTGAATGGACAGGAGGAAGGGGG + Intronic
1180814459 22:18780955-18780977 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1180897408 22:19346909-19346931 AAGAATAATCAGCAGGAAGGAGG + Intronic
1181200647 22:21215291-21215313 ATGAATGGATAGAGGGAGGGAGG + Intronic
1181343265 22:22199525-22199547 ACGAAAGGAGAGAAGGAAGGGGG + Intergenic
1181536744 22:23550218-23550240 ATGAATGGAAAGATGGATGGAGG - Intergenic
1181536826 22:23550642-23550664 ATGCATGAGAAGATGGAAGGAGG - Intergenic
1181779458 22:25182250-25182272 AAGAAGGGACAAAAGGAAGGAGG - Intronic
1181783283 22:25208062-25208084 ATAGATGAATGGAAGGAAGGAGG - Intergenic
1181824874 22:25507032-25507054 ATGGATGAATAAAAGGATGGGGG - Intergenic
1181824895 22:25507153-25507175 ATGGATGAATAAAAGGATGGAGG - Intergenic
1181824938 22:25507437-25507459 ATGAATGAATTAATGGAAGGAGG - Intergenic
1181885192 22:26016627-26016649 ATGGAGGAACAGAAAGATGGGGG - Intronic
1181902194 22:26165712-26165734 ATGGATGAATGGAAGGGAGGAGG + Intergenic
1181917373 22:26292063-26292085 ATGAAGGAAGAAAATGAAGGAGG + Intronic
1182059937 22:27389559-27389581 AAGAGTGCACAGAAGAAAGGAGG + Intergenic
1182072614 22:27474375-27474397 ATGAACGAACAGCAGGAGGGAGG + Intergenic
1182106123 22:27691020-27691042 AAGAAAGAATGGAAGGAAGGAGG + Intergenic
1182164749 22:28161884-28161906 AGGGATGAAGGGAAGGAAGGAGG + Intronic
1182452212 22:30428395-30428417 ATGAGGGAACAGAAGGCAGAAGG - Intronic
1182546982 22:31082139-31082161 ATGAATCAACAGGAGGTGGGGGG + Intronic
1182664777 22:31949648-31949670 AAGAATGTACACATGGAAGGTGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1182923243 22:34099338-34099360 ATGGATGAACATGAGGATGGTGG - Intergenic
1183099956 22:35577941-35577963 ATGGATGAATGGGAGGAAGGTGG + Intergenic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183826635 22:40393469-40393491 AAGAAGGAACAGAAGAAAAGTGG - Intronic
1184164270 22:42718652-42718674 ATGAATTAACCGAAAGAAGTAGG - Intronic
1184414668 22:44345394-44345416 ATGAGTGAACAGATGGTAGATGG + Intergenic
1184443344 22:44532472-44532494 AGGAAGGAAGAAAAGGAAGGAGG + Intergenic
1184880738 22:47302849-47302871 ATGGATGAATAGAAGGTAGACGG - Intergenic
1184991045 22:48170278-48170300 ATGAATGAATGGATGGAAAGAGG - Intergenic
1184991158 22:48170868-48170890 AAGAATGAAGAGAAGGAGAGAGG - Intergenic
1185018754 22:48360914-48360936 ATGAATGAAGGGAAGGGAGGAGG + Intergenic
1185129196 22:49028092-49028114 ATGGAGGTACAGAAGGAAGGAGG + Intergenic
1203226270 22_KI270731v1_random:80144-80166 ATGAATGGATAGAGGGAGGGAGG - Intergenic
1203264558 22_KI270734v1_random:6642-6664 ATGAATGGATAGAGGGAGGGAGG + Intergenic
949201823 3:1388828-1388850 ATGAATGAAATGAAGCAAGAAGG + Intronic
949425389 3:3910198-3910220 ATGAATGAAATGAAGCAAGAAGG + Intronic
949500126 3:4671794-4671816 ATGAAAGAACAGAATACAGGAGG - Intronic
949626242 3:5869737-5869759 ATAAATGATCAGAAGAAAGAAGG - Intergenic
949930109 3:9071713-9071735 AGGTAGGAAGAGAAGGAAGGAGG + Intronic
949984238 3:9527004-9527026 AGGAAGGAAGAGAAGGAGGGAGG + Intronic
950175697 3:10872726-10872748 ATGAATGAACAAATGGGTGGAGG + Intronic
950254186 3:11491198-11491220 ATGAATGAAATGAAGCAAGAAGG - Intronic
950575794 3:13831452-13831474 GTGGCCGAACAGAAGGAAGGTGG + Intronic
950635511 3:14311650-14311672 AGGAATGAAGAGAGGGAAGGAGG - Intergenic
951053973 3:18126219-18126241 AGGAATGAAGGGAGGGAAGGAGG - Intronic
951175563 3:19594986-19595008 ATGAATGAAATGAAGCAAGAAGG - Intergenic
951247525 3:20358477-20358499 ATGAATGAAATGAAGCAAGAAGG - Intergenic
951257101 3:20462590-20462612 ATGAATGCTCAGAAGAAAAGTGG + Intergenic
951321792 3:21254455-21254477 ATGAATGAAACGAAGCAAGAAGG - Intergenic
951497910 3:23350651-23350673 ATGAATGAAATGAAGCAAGAAGG + Intronic
951838817 3:27011516-27011538 ATATAGGAACAGAAGGAAGAGGG - Intergenic
951960481 3:28313322-28313344 ATCAATAAACAGTAGGAATGCGG - Intronic
952059589 3:29491616-29491638 AGGAAGGAAGAGAGGGAAGGAGG + Intronic
952096848 3:29963879-29963901 ATGGATGTAAAGAATGAAGGAGG + Intronic
952238854 3:31509184-31509206 AAGAAATAAAAGAAGGAAGGAGG + Intergenic
952330155 3:32357305-32357327 ATAAAGAAAAAGAAGGAAGGAGG - Intronic
952472729 3:33672857-33672879 ATGAATGAAATGAAGCAAGAAGG + Intronic
952766346 3:36957294-36957316 ATGAAGGGGAAGAAGGAAGGGGG - Intergenic
952871795 3:37907070-37907092 AGGAAAGAACAAAAGGAAGTGGG - Intronic
953555629 3:43944735-43944757 ATGAATGAAATGAAGCAAGAAGG - Intergenic
953713080 3:45291577-45291599 ACCAAAGGACAGAAGGAAGGAGG + Intergenic
953826145 3:46252600-46252622 ATGAAGGAAGGGAAGGAAGTGGG + Intronic
954718200 3:52537580-52537602 ATGGATGAACAGAAGGACTAAGG - Intronic
954890788 3:53926475-53926497 ATGAATGAAATGAAGCAAGAAGG - Intergenic
954949260 3:54454970-54454992 ATGAATGAACAGAGCAAATGTGG - Intronic
955081622 3:55663119-55663141 ATGGATGAACGGAAGGGAGATGG + Intronic
955099514 3:55833023-55833045 ATGAATGAAATGAAGCAAGAAGG + Intronic
955626519 3:60924974-60924996 ATGAATGAAATGAAGCAAGAAGG + Intronic
955824263 3:62928672-62928694 ATGGATGAATAGATGGATGGGGG + Intergenic
955861999 3:63340788-63340810 AATTATGTACAGAAGGAAGGGGG - Intronic
956104480 3:65802637-65802659 AGGAATGAACAAAAGAAAGATGG - Intronic
956230148 3:67005647-67005669 ATGAAAGAAAAGAAGGGAAGGGG - Intronic
956328648 3:68081039-68081061 ATGAATGAAATGAAGCAAGAAGG - Intronic
956954227 3:74318064-74318086 ATGAATGAAATGAAGCAAGAAGG - Intronic
957308446 3:78488441-78488463 ATGAATGAAATGAAGCAAGAAGG + Intergenic
957416924 3:79917417-79917439 AGGAAGGAAGAGAAGGAAGGAGG + Intergenic
957731367 3:84141685-84141707 AAGAATGAATAGTAGGAATGAGG + Intergenic
957846572 3:85744593-85744615 ATGTTTGGACAGAATGAAGGTGG + Intronic
958587667 3:96111255-96111277 ACGAATGAACACATGGAATGTGG - Intergenic
958769369 3:98407988-98408010 ATGAATGAAATGAAGGAAGAAGG + Intergenic
958871300 3:99562228-99562250 AGGAGAGAACAGAAGAAAGGAGG - Intergenic
959119024 3:102211114-102211136 TTTTATAAACAGAAGGAAGGTGG + Intronic
959554022 3:107696924-107696946 ATGAATGAAATGAAGCAAGAAGG - Intronic
960155430 3:114293202-114293224 ATGAATGAAGGGAGGGAGGGAGG + Intronic
960553802 3:119006190-119006212 ATGAATGAAAAGAAGCGAGAAGG - Intronic
960563484 3:119111317-119111339 ATGAATGAAATGAAGCAAGAAGG - Intronic
960737764 3:120799371-120799393 AGGAAGGAAAAGAAGGAAAGAGG - Intergenic
961355099 3:126332836-126332858 ATGAATGAAATGAAGCAAGAAGG + Intergenic
961499656 3:127323304-127323326 ATGAATGAACGGAAGACAGGAGG - Intergenic
961953492 3:130775002-130775024 ATAAATGCACAGGAAGAAGGGGG + Intergenic
962042660 3:131723367-131723389 ATGAAGGAAGAGAGGGAAAGGGG + Intronic
962060329 3:131920085-131920107 ATGAATCCACAGAAGGATGTTGG - Intronic
962659127 3:137583379-137583401 GTGAATGAACAGTATGAAGCGGG - Intergenic
962982814 3:140506302-140506324 AAGAATGGGCAGAAGGAGGGAGG - Intronic
963553536 3:146756485-146756507 ATGAATGAATGGAATGAATGAGG - Intergenic
963559907 3:146851310-146851332 ATGAAGGAAAAGGAGAAAGGAGG + Intergenic
963793099 3:149604496-149604518 ATGCAGGAAGTGAAGGAAGGAGG + Intronic
963922255 3:150916872-150916894 ATGAATGTACTGAAGGAATAAGG - Intronic
963979806 3:151524882-151524904 ATGATGGAAGAGAAGGAAGAAGG - Intergenic
964251220 3:154719656-154719678 AAAAAAGAAAAGAAGGAAGGAGG + Intergenic
964550655 3:157880757-157880779 ATGAATGAAATGAAGCAAGAAGG + Intergenic
964602333 3:158515825-158515847 ATGAATGAAATGAAGTAAGAAGG - Intronic
964621775 3:158726010-158726032 AGGAAAGAACAGCAGGGAGGGGG - Intronic
964676694 3:159290290-159290312 ATGTAAGAACAGCAGGAAGGGGG + Intronic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
965110063 3:164409621-164409643 AAGGAGGAACAGAGGGAAGGAGG - Intergenic
965548619 3:169940602-169940624 ATGAATAAAAAGAGGGAAAGAGG - Intergenic
965756210 3:172029909-172029931 AGGAAGCAAGAGAAGGAAGGAGG - Intergenic
965974644 3:174606585-174606607 ATGAATGAAATGAAGCAAGAAGG + Intronic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966351251 3:179034619-179034641 ATGGATGACCAGGAGGAAGCTGG - Intronic
966476277 3:180351260-180351282 ATGAATGAATAAAAGAAATGTGG - Intergenic
966693422 3:182764121-182764143 AAGGATGAAAGGAAGGAAGGAGG - Intergenic
967167765 3:186798455-186798477 ATGAATGGACAGGAAGAGGGAGG - Intronic
967397211 3:189021958-189021980 ATGAATGAAATGAAGCAAGAAGG - Intronic
967985152 3:195088941-195088963 ATGAATGAAATGAAGCAAGAAGG + Intronic
968155180 3:196374952-196374974 AAGAAAGAAAAAAAGGAAGGAGG + Intronic
968159973 3:196418243-196418265 AAGGAAGAAAAGAAGGAAGGAGG + Intronic
968914350 4:3490741-3490763 AGGAATGAGCAGGAGGAAGAAGG - Intronic
968914403 4:3491000-3491022 ATGAATGAGCAGGAAGAAGAAGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969495220 4:7522727-7522749 AGGAAAGAAAGGAAGGAAGGAGG - Intronic
969528493 4:7716524-7716546 GTGAATGAATAGATGGATGGTGG - Intronic
969528517 4:7716657-7716679 ATGAATGAATAGATAGATGGTGG - Intronic
969950172 4:10828026-10828048 ATGAATGAAATGAAGCAAGAAGG - Intergenic
969971395 4:11052050-11052072 AAGAATGAACAGAACGAGGTAGG - Intergenic
970020186 4:11558852-11558874 ATGAATGAAATGAAGCAAGAAGG + Intergenic
970084968 4:12335824-12335846 ATGAATGAAATGAAGCAAGAAGG + Intergenic
970220003 4:13800264-13800286 ATGAATGAAATGAAGCAAGAAGG + Intergenic
970241489 4:14014185-14014207 ATGAATGAAATGAAGCAAGAAGG - Intergenic
970283369 4:14482029-14482051 ATGAATGAAATGAAGCAAGAAGG + Intergenic
970500624 4:16673047-16673069 GTGAAAGAAAAGAAGGATGGAGG - Intronic
970513569 4:16804993-16805015 ATGAATACACAGAGAGAAGGTGG - Intronic
970931015 4:21512020-21512042 AGGGAGGAAGAGAAGGAAGGAGG + Intronic
971192607 4:24441675-24441697 AGGAAGAAACAGAAGGAAGGAGG + Intergenic
971289835 4:25327429-25327451 AGGAAGGAACGGAAGGAAGGAGG - Intronic
971318703 4:25588220-25588242 GAGAATGGACAGAAGGGAGGGGG - Intergenic
971665530 4:29478667-29478689 AGGAATGAAAGGAGGGAAGGAGG + Intergenic
971919444 4:32917824-32917846 AGGAAAGAAAAGAAAGAAGGAGG - Intergenic
971990515 4:33886565-33886587 ATGAAAGAACAGCTGGAAGAGGG - Intergenic
972570172 4:40303438-40303460 ATGGAAGGAGAGAAGGAAGGAGG + Intergenic
972874622 4:43343449-43343471 AGGAATGAAGGAAAGGAAGGAGG - Intergenic
972910335 4:43808434-43808456 ATGAATGTAGAGAGGGAGGGAGG + Intergenic
972996666 4:44887640-44887662 ATGAATGGACAGAAAAAATGTGG - Intergenic
973003337 4:44979326-44979348 ATAAATGGATAGAAGGAATGAGG + Intergenic
973124668 4:46568521-46568543 ATGAATGAAATGAAGCAAGAAGG + Intergenic
973170525 4:47137241-47137263 AAGAAGGAACAGTAGGAAAGAGG + Intronic
973252867 4:48078940-48078962 AAGAAGGAAGAGAAGGAAGAAGG + Intronic
973269293 4:48244958-48244980 ATTAATGAACAAAGGGAGGGAGG - Intronic
973399113 4:49622329-49622351 ATGAATGAAATGAAGCAAGAAGG + Intergenic
973550033 4:52025059-52025081 GTGAATGAAAAGAAGAAAGGAGG - Intronic
974247092 4:59333849-59333871 GTGGAAGAGCAGAAGGAAGGAGG - Intergenic
974301669 4:60076902-60076924 AAGAATGAAGAGAAAGACGGAGG + Intergenic
974404529 4:61448757-61448779 AGGAAGGAAGAGAGGGAAGGAGG + Intronic
974426141 4:61745130-61745152 ATGAATGAACTGAAGCGAGAAGG + Intronic
974814553 4:66988430-66988452 ATGAATGAACTGACAGAAGTAGG - Intergenic
975154690 4:71058560-71058582 ATGAATGAAATGAAGCAAGAAGG - Intergenic
975187464 4:71420251-71420273 ATGAATGAAATGAAGCAAGAAGG + Intronic
975256332 4:72240057-72240079 AAGATTAAACAAAAGGAAGGAGG + Intergenic
975436785 4:74363204-74363226 ATCAATGAACAGTAGGATAGAGG - Intergenic
975513492 4:75219736-75219758 ATGAATGAAATGAAGCAAGAAGG - Intergenic
975518713 4:75275308-75275330 ATGAATGAAATGAAGCAAGAAGG - Intergenic
975535608 4:75447263-75447285 ATGAATGAAATGAAGCAAGAAGG - Intergenic
975672485 4:76795503-76795525 AGGAAAGAACAGAAGCAAGAAGG - Intergenic
975750529 4:77518521-77518543 ATGAATGAAATGAAGCAAGAAGG - Intronic
975822205 4:78283039-78283061 AAAAATGAAAAGAAGCAAGGGGG - Intronic
976169467 4:82288015-82288037 ATGAATGAACAGATGTGAAGCGG - Intergenic
976342045 4:83956910-83956932 ATGAATGAAATGAAGCAAGAAGG - Intergenic
976352285 4:84073772-84073794 ATGAATGAAATGAAGCAAGAAGG + Intergenic
976372009 4:84300057-84300079 ATGAATGAAATGAAGCAAGAAGG + Intergenic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
976529560 4:86135950-86135972 ATGAATGAAATGAAGCAAGAAGG + Intronic
976532358 4:86169479-86169501 ATGAATGAAATGAAGCAAGAAGG + Intronic
976858934 4:89639607-89639629 AGGAATGGAAGGAAGGAAGGAGG + Intergenic
977039926 4:92002830-92002852 ATGAATGAACTGACAGAAGTAGG + Intergenic
977164486 4:93678192-93678214 ATGAATGAAATGAAGCAAGAAGG + Intronic
977169228 4:93739696-93739718 ATAAATGTACTGAAGGAAGTTGG - Intronic
977516086 4:98022744-98022766 ATGAATGAAATGAAGCAAGAAGG - Intronic
977740968 4:100481929-100481951 AGGAAGGGAAAGAAGGAAGGAGG - Intronic
977919984 4:102632301-102632323 ATGAATGAAGTGAAGGATGAGGG + Intronic
977929477 4:102735381-102735403 ATGAAAGAATTGAAGGAATGGGG - Intronic
978226550 4:106342007-106342029 AGGAATGAACCTAATGAAGGAGG - Intronic
978246222 4:106575773-106575795 ATGAATGAAATGAAGCAAGAAGG - Intergenic
978258946 4:106728578-106728600 AGGAATGAACTTAAGCAAGGAGG + Intergenic
978274774 4:106936381-106936403 ATGAATGAAATGAAGCAAGAAGG + Intronic
978277319 4:106967727-106967749 AGGAAGGAACAGAGGGAGGGAGG + Intronic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
978386476 4:108180535-108180557 AGGAAGGAAGAGAAGGAAGAAGG + Intergenic
978418552 4:108504531-108504553 ATGAATGAAATGAAGAAAGAAGG + Intergenic
978622006 4:110641866-110641888 AAGAATAAGCAAAAGGAAGGAGG - Intronic
978680896 4:111379321-111379343 ATGAATGAAATGAAGTAAGAAGG + Intergenic
978820068 4:112956837-112956859 CTGAATGAAGAGAATGAAGTGGG + Intronic
978864671 4:113493869-113493891 ATGAATGAAATGAAGCAAGAAGG - Intronic
979026541 4:115584537-115584559 ATGAATAAACAGAAGGCTAGTGG - Intergenic
979299067 4:119066631-119066653 ATGAATGAAATGAAGCAAGAAGG - Intergenic
979299913 4:119075041-119075063 ATGAATGAAATGAAGCAAGAAGG + Intergenic
979634718 4:122944362-122944384 ATGAATGAAATGAAGCAAGAAGG - Intronic
979640027 4:123003031-123003053 ATGAATGAAATGAAGCAAGAAGG - Intronic
979640340 4:123006189-123006211 ATTAAAGAACACAAGGAGGGAGG - Intronic
979778906 4:124624807-124624829 ATGAGAGAAGAGAAGGGAGGAGG - Intergenic
979961090 4:127021843-127021865 ATGAATGAAATGAAGCAAGAAGG + Intergenic
979965030 4:127067304-127067326 ATGAATGAAATGAAGCAAGAAGG - Intergenic
980010619 4:127590211-127590233 ATGAATGAAATGAAGCAAGAAGG + Intergenic
980018301 4:127678016-127678038 ATGAATGAAATGAAGCAAGAAGG + Intronic
980033827 4:127860939-127860961 ATGAATGAAATGAAGCAAGAAGG + Intergenic
980418427 4:132524091-132524113 ATGGAGGAACAGAGTGAAGGAGG - Intergenic
980619782 4:135285683-135285705 ATTAGTGAAGAGAATGAAGGTGG + Intergenic
981028232 4:140097595-140097617 AGGAATGTACTGAAGGAAGACGG + Intronic
981074859 4:140580715-140580737 AAGAAAGAAAGGAAGGAAGGAGG + Intergenic
981439820 4:144769955-144769977 ATGAATGAAATGAAGCAAGAAGG + Intergenic
981683436 4:147426513-147426535 ATGAAAGAACGGCAGGCAGGTGG - Intergenic
982047513 4:151463581-151463603 AGGAAAGAACAGAAGGCTGGGGG - Intronic
982511550 4:156289315-156289337 ATGAATGAAATGAAGCAAGAAGG - Intergenic
983173117 4:164558223-164558245 ATGAATGAAATGAAGCAAGAAGG - Intergenic
983349684 4:166571254-166571276 ATGAATGAAATGAAGCAAGAAGG + Intergenic
983506853 4:168562692-168562714 ATGTTTGAAGAGAGGGAAGGAGG + Intronic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
983907293 4:173197357-173197379 ATGAAGGAACAGAAAGCATGGGG + Intronic
984044466 4:174779728-174779750 ATGAATGAAATGAAGCAAGAAGG + Intronic
984659824 4:182361446-182361468 ATGAATGAAATGAAGCAAGAAGG - Intronic
984764702 4:183391098-183391120 AGGAAGGAAGGGAAGGAAGGAGG - Intergenic
984881380 4:184412704-184412726 AGCAAGGAGCAGAAGGAAGGTGG - Intronic
984908839 4:184653072-184653094 AGGAAAGAAGGGAAGGAAGGAGG + Intronic
984938401 4:184909880-184909902 CTGAATGCAAAGAAGGAATGAGG - Intergenic
985075383 4:186208944-186208966 ATAAAGGAACAGAAGGAAAAAGG - Exonic
985219213 4:187685118-187685140 AGGAAAGAAAGGAAGGAAGGAGG - Intergenic
985383184 4:189417060-189417082 ATGAATGAATAAATGCAAGGAGG - Intergenic
985413468 4:189711638-189711660 AGGAGTGAAGAGCAGGAAGGTGG - Intergenic
985703779 5:1389056-1389078 ATGGATGGACAGAAGAAGGGAGG - Intergenic
985837191 5:2280239-2280261 ATGAATGGACAGATGGGTGGTGG + Intergenic
985932204 5:3067464-3067486 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
986090589 5:4501072-4501094 ATGAATGAAATGAAGCAAGAAGG - Intergenic
986101616 5:4616705-4616727 ATGAATGAAATGAAGCAAGAAGG + Intergenic
986736147 5:10668805-10668827 ATGACTGAACAGAAGGAGCCTGG - Intergenic
986955494 5:13145359-13145381 ATGAATGGCCAGCAGGAAGGGGG + Intergenic
986978354 5:13417776-13417798 ATGAATGAAATGAAGCAAGAAGG + Intergenic
987002670 5:13675969-13675991 GTGGATGAACAGGAGGCAGGTGG + Intergenic
987232634 5:15911251-15911273 ATGAATGAAATGAAGCAAGAAGG - Intronic
987273414 5:16336688-16336710 ATGAATGAAATGAAGCAAGAAGG + Intergenic
987642583 5:20631616-20631638 AGGAAAGAGAAGAAGGAAGGAGG + Intergenic
987759067 5:22135640-22135662 AAGAATGAAGAGAAGGCTGGAGG + Intronic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988233646 5:28510082-28510104 ATGAAGGAACATAATGAAGTTGG - Intergenic
988375278 5:30428100-30428122 ATGAATGAAATGAAGCAAGAAGG - Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
988456270 5:31389684-31389706 AAGAAAGAAAAGAAAGAAGGAGG + Intergenic
988495681 5:31743682-31743704 ATGGATGAACTGAAGGATGAAGG - Intronic
988677451 5:33447153-33447175 AAGAATGGAAAGAAGGAGGGAGG + Intronic
988690809 5:33570011-33570033 ATGAATGAAATGAAGCAAGAAGG + Intronic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
988956603 5:36326353-36326375 AAGAAAGAATAGAAGAAAGGAGG + Intergenic
989242899 5:39220602-39220624 ATGAATGAGTAGAAGGAAGGTGG - Intronic
989248665 5:39282085-39282107 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
989493078 5:42079560-42079582 ATGAATGAAATGAAGCAAGAAGG + Intergenic
989653527 5:43719230-43719252 ATGAATGAAATGAAGCAAGAAGG + Intergenic
989673816 5:43950770-43950792 CTGAAAGAATAGAAGGAAGGAGG + Intergenic
989701193 5:44266853-44266875 ATAAATGAATCAAAGGAAGGTGG + Intergenic
989725341 5:44580203-44580225 ATGAATGAAATGAAGCAAGAAGG + Intergenic
989732998 5:44669779-44669801 ATGAATGAAATGAAGCAAGAAGG + Intergenic
989794179 5:45446303-45446325 ATGAATGAAATGAAGCAAGAAGG + Intronic
989849799 5:46194693-46194715 ATGAATGAAATGAAGCAAGAAGG + Intergenic
989947893 5:50261707-50261729 ATGAATGAAATGAAGCAAGAAGG - Intergenic
989968066 5:50488711-50488733 ATGAATGAAATGAAGCAAGAAGG - Intergenic
989969364 5:50504139-50504161 AGGGATGAAGGGAAGGAAGGAGG - Intergenic
990050390 5:51493017-51493039 ATGAAGGAAGAGAGGAAAGGAGG - Intergenic
990444465 5:55881350-55881372 AGGAATGGAAAGAAGGAAGAAGG + Intronic
990470654 5:56112197-56112219 TTCAATGAGCAGAAGGATGGAGG + Intronic
990706972 5:58540862-58540884 ATGAATGAAATGAAGCAAGAAGG - Intergenic
990958090 5:61363897-61363919 AAGAATGGAAGGAAGGAAGGAGG - Intronic
991434232 5:66580124-66580146 ATTAATCAATAGAAGGAAGCAGG - Intergenic
991893779 5:71369086-71369108 AAGAATGAAGAGAAGGCTGGAGG + Intergenic
991942135 5:71863230-71863252 AAGAAACAACAGAGGGAAGGAGG - Intergenic
992148643 5:73879151-73879173 ATGAATGAAATGAAGCAAGAAGG - Intronic
992301807 5:75389886-75389908 AGAAATGAAAAGAAGGAAGATGG + Intronic
992329099 5:75696970-75696992 ATGAATGAAATGAAGCAAGAAGG + Intronic
992360848 5:76036971-76036993 ATGAATGAAATGAAGCAAGAAGG - Intergenic
992489127 5:77223969-77223991 ATGGATGAACAAAGGGAAGATGG - Intronic
992605967 5:78456911-78456933 ATGAATGAAATGAAGCAAGAAGG - Intronic
992651962 5:78868077-78868099 ATGAATGAAATGAAGCAAGAAGG + Intronic
992755745 5:79903703-79903725 ATGAATGAAATGAAGGGAGAAGG + Intergenic
992899835 5:81283048-81283070 AAGAATAAAAAGAATGAAGGAGG - Intergenic
993006486 5:82434132-82434154 ATGAATGAAATGAAGCAAGAAGG - Intergenic
993187496 5:84637915-84637937 AGGAAGGAAAAGAAGGAAGAAGG - Intergenic
993261403 5:85662323-85662345 ATGAATGAAATGAAGCAAGAAGG - Intergenic
993420904 5:87700184-87700206 ATGGATGAACTGACAGAAGGAGG - Intergenic
993449252 5:88053609-88053631 ATGAATGAAATGAAGCAAGAAGG + Intergenic
993612726 5:90074497-90074519 ATGAATGAAAAGAAGTGAGAAGG + Intergenic
993858589 5:93105630-93105652 ATGAAGTATCAGAATGAAGGGGG - Intergenic
994251186 5:97539488-97539510 ATCAATGAAGAGAGGAAAGGAGG - Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994688500 5:102987163-102987185 ATGAATGGATAGAGAGAAGGTGG + Intronic
994784446 5:104138530-104138552 AGGAAAAAACAGAAGGAAAGAGG + Intergenic
995116483 5:108486167-108486189 AAGAAAGAAAGGAAGGAAGGAGG + Intergenic
995149809 5:108829701-108829723 AAGAAAGAAAAAAAGGAAGGAGG - Intronic
995309428 5:110693719-110693741 ATGAATGAAATGAAGCAAGAAGG + Intronic
995334867 5:110987006-110987028 ATGAATGAAATGAAGCAAGAAGG + Intergenic
995413329 5:111882245-111882267 ATGAATGAAATGAAGCAAGAAGG + Intronic
995624288 5:114059577-114059599 ATGCATAAACAAAGGGAAGGTGG + Intergenic
995688023 5:114792487-114792509 AGGAAGGAACAGACGGAAGAAGG - Intergenic
995980246 5:118093163-118093185 AAGAAAGAGAAGAAGGAAGGGGG + Intergenic
996060839 5:119031625-119031647 AAGAATGAACAGGAGGATGTGGG - Intergenic
996139664 5:119890712-119890734 AAGAATGAACAGAGGGAATATGG - Intergenic
996348585 5:122514336-122514358 ATGAATGAAATGAAGCAAGAAGG - Intergenic
996545991 5:124679384-124679406 AAGAAAGGAAAGAAGGAAGGAGG - Intronic
996654713 5:125923138-125923160 ATGAATGAAATGAAGCAAGAGGG - Intergenic
996753012 5:126908547-126908569 ATGAATGAAATGAAGCAAGAAGG - Intronic
996988224 5:129594571-129594593 AAGAAAGAAAAGAAAGAAGGAGG - Intronic
997419950 5:133758382-133758404 AAGAATAAACATAAGGAAAGTGG + Intergenic
997470863 5:134115960-134115982 ATGCATGAGCAGATTGAAGGCGG - Exonic
997529769 5:134574766-134574788 GTGAATAAACAGAAGATAGGGGG - Intronic
998798493 5:145843776-145843798 ATGAATAAACTGAAGCATGGAGG + Intergenic
999058804 5:148610942-148610964 ATGAATGAAATGAAGCAAGAAGG + Intronic
999112828 5:149136993-149137015 AAGAATGACCATCAGGAAGGAGG + Intergenic
999292704 5:150437211-150437233 AAGAAAGAAAAGAAGGAAGAAGG + Intergenic
999445429 5:151634964-151634986 AAGAAGGAAGAGAAGGAAGGAGG + Intergenic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
999674782 5:153987993-153988015 ATAAAAGAAGAAAAGGAAGGAGG - Intergenic
999867642 5:155718664-155718686 ATGAATGAAATGAAGCAAGAAGG - Intergenic
999946518 5:156602162-156602184 ATGAATAAACTTAAGCAAGGAGG - Intronic
1000181910 5:158819833-158819855 ATGAATGAAGAGAAAGTACGGGG + Intronic
1000313270 5:160064876-160064898 AGGAATGAACAGAAGCAGGAAGG - Intronic
1000380984 5:160629164-160629186 AGGAAGGCACAGAAGGCAGGTGG + Intronic
1000666718 5:164006804-164006826 ATTTATAAACAGAAGGAAAGAGG + Intergenic
1000827081 5:166058417-166058439 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001283505 5:170405553-170405575 ATGAATCAAGAGAAGCCAGGAGG - Intronic
1001365312 5:171132280-171132302 AGGAGAGAAAAGAAGGAAGGAGG + Intronic
1001425768 5:171621322-171621344 ATATATGAACAGATGGAAGGTGG + Intergenic
1001487444 5:172129540-172129562 ATGAATGAACAAGTGGATGGAGG - Intronic
1001490980 5:172155090-172155112 ATGAATGGACAGAAAGTGGGTGG + Intronic
1001514334 5:172344948-172344970 ATGGAGGAAAGGAAGGAAGGAGG + Intronic
1001517038 5:172363163-172363185 ATGGATGGACAGATGGATGGAGG - Intronic
1001600555 5:172925604-172925626 GTGTTTGAATAGAAGGAAGGAGG - Intronic
1001815311 5:174663824-174663846 CTGAAATAAAAGAAGGAAGGAGG - Intergenic
1001946902 5:175786754-175786776 AGGCAAGAACAGAGGGAAGGAGG - Intergenic
1002010971 5:176281157-176281179 ATGAATGAAATGAAGCAAGAAGG - Intronic
1002232117 5:177773524-177773546 ATGAATGAAATGAAGCAAGAAGG + Intronic
1002675249 5:180907249-180907271 ATGAATGAAATGAAGCAAGAAGG - Intronic
1002954594 6:1849398-1849420 ATGAATGAACACAGGGGAGTAGG + Intronic
1002988532 6:2215675-2215697 AGGAAGGAAAGGAAGGAAGGGGG + Intronic
1003239688 6:4333469-4333491 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1003672921 6:8176477-8176499 AAGAAAGAAAAGAAGGAAGGGGG - Intergenic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1003953696 6:11142770-11142792 ATGAATAAGGAGAAGGGAGGGGG - Intergenic
1003973432 6:11321138-11321160 AGGGAGGGACAGAAGGAAGGAGG + Intronic
1004077758 6:12360802-12360824 ATAAATGAACATAAGGAGGAAGG + Intergenic
1004103210 6:12636750-12636772 ATAAAGGAAGAGAAGGAAAGAGG - Intergenic
1004114278 6:12750493-12750515 AGGGAAGAAAAGAAGGAAGGAGG + Intronic
1004446200 6:15701137-15701159 AAGCATGAATAGAAGGAGGGAGG + Intergenic
1004604080 6:17177350-17177372 ATGAATGAAAAAAAAGATGGTGG + Intergenic
1004793983 6:19060686-19060708 AACCATGAGCAGAAGGAAGGAGG - Intergenic
1004862880 6:19823529-19823551 ACAAAAGAACAGAAGGAAGGAGG - Intergenic
1005101750 6:22179584-22179606 ATGAATGAACTGAAGCAAGAAGG - Intergenic
1005239296 6:23805329-23805351 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1005310694 6:24556199-24556221 ATGGAAGAAAGGAAGGAAGGAGG - Intronic
1005723188 6:28622638-28622660 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1006755369 6:36410607-36410629 AAGAAAGAAGAAAAGGAAGGAGG + Intronic
1006900925 6:37500470-37500492 AGGAATAAACAGAAGCAAAGAGG - Intergenic
1007137301 6:39534477-39534499 ATGAATGAAATGAAGCAAGAAGG + Intronic
1007289172 6:40772151-40772173 AGGGAAGAAAAGAAGGAAGGGGG + Intergenic
1007972288 6:46064726-46064748 ATGAAGGAAGAGAAGAAGGGAGG + Intronic
1008212189 6:48738623-48738645 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1008262872 6:49388158-49388180 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1008412109 6:51192389-51192411 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1008769614 6:54962701-54962723 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1008863194 6:56176658-56176680 AGGAAGGAAGAGAAGGAGGGAGG + Intronic
1008915653 6:56784451-56784473 ATGAATGAAATGAAGCAAGAAGG - Intronic
1009175941 6:60460077-60460099 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1009221141 6:60985656-60985678 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1009239046 6:61162283-61162305 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1009439346 6:63657979-63658001 TTGAATGAACTGAAGGAAATAGG - Intronic
1009870194 6:69444267-69444289 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1010019395 6:71141612-71141634 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1010263206 6:73840138-73840160 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1010271338 6:73918916-73918938 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1010319032 6:74485283-74485305 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1010345957 6:74811167-74811189 AGGAAGGAAAAGACGGAAGGAGG + Intergenic
1010390854 6:75335509-75335531 AGGAATGAAGGGAAGGAGGGAGG - Intronic
1010441870 6:75904454-75904476 ATGAATGAAATGAAGCAAGAAGG - Intronic
1010593265 6:77735360-77735382 ATGAATGAAATGAAGCAAGAAGG - Intronic
1010618040 6:78037807-78037829 ATGCATAAAAAGAAGGTAGGAGG - Intergenic
1011180064 6:84609715-84609737 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1011181627 6:84627624-84627646 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011244568 6:85308444-85308466 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1011280295 6:85670795-85670817 AGGAAGGAAGAGAGGGAAGGAGG - Intergenic
1011315426 6:86026215-86026237 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1011363256 6:86550957-86550979 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1011392955 6:86874234-86874256 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1011395235 6:86898984-86899006 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1011397265 6:86922573-86922595 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1011505208 6:88034111-88034133 TTGAATGAAAAGAAGAAAGCAGG + Intergenic
1011550287 6:88525935-88525957 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1011555237 6:88566470-88566492 ATGAATGGTAGGAAGGAAGGTGG + Intergenic
1011582117 6:88880204-88880226 ATGAATGAATGAAAGGAAGAAGG + Intronic
1011617730 6:89212380-89212402 ATGATGGAACACCAGGAAGGGGG - Intronic
1011855718 6:91688384-91688406 AGGTATGAAGAGAGGGAAGGAGG - Intergenic
1011949338 6:92944826-92944848 AAGAAAGGAAAGAAGGAAGGAGG + Intergenic
1012081108 6:94759172-94759194 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1012142543 6:95642329-95642351 ATGAATGAAGAAAAGCATGGTGG + Intergenic
1012171151 6:96017443-96017465 ATGAATGAATATGAGCAAGGGGG + Intronic
1012513307 6:100029600-100029622 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1012540482 6:100355983-100356005 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1012734180 6:102918007-102918029 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1012734207 6:102918105-102918127 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1012987400 6:105889258-105889280 GTGGATGAACAGAAGGAAATGGG + Intergenic
1013327735 6:109064549-109064571 ATGAAAGAAGAGAAGAGAGGAGG + Intronic
1013344780 6:109249951-109249973 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1013520464 6:110928180-110928202 AGGAATGAAGGGAAGGAGGGAGG - Intergenic
1013622868 6:111907722-111907744 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1013704325 6:112814299-112814321 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1013966491 6:115961310-115961332 ATGAATGAAATGAAGCAAGAAGG + Intronic
1014120807 6:117722703-117722725 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1014145830 6:117997189-117997211 ATGAATGAAATGAAGCAAGAAGG + Intronic
1014364614 6:120523732-120523754 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1014373482 6:120642221-120642243 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1014414256 6:121163972-121163994 ATGAATGAAATGAAGCAAGAAGG + Intronic
1014529444 6:122541909-122541931 ATGAATGAAATGAAGCAAGAAGG - Intronic
1014704306 6:124726972-124726994 ATGAATGAAATGAAGCAAGAAGG + Intronic
1014711000 6:124805904-124805926 ATGAATGAAATGAAGCAAGAAGG + Intronic
1014743464 6:125172048-125172070 AAGAAAGAAGAGAAAGAAGGTGG - Intronic
1014745120 6:125191791-125191813 CCCAATGAACAGAAGGGAGGGGG - Intronic
1014871205 6:126598548-126598570 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1015000589 6:128209673-128209695 ATGAGTGAGCAAAAGGAAAGGGG + Intronic
1015056581 6:128910363-128910385 ATGAATGAAATGAAGCAAGAAGG - Intronic
1015323402 6:131901292-131901314 ATGGAATAAAAGAAGGAAGGAGG - Intergenic
1015405848 6:132836095-132836117 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG + Intergenic
1015677832 6:135770214-135770236 ATGAATGAAGTGAAGCAAGAAGG - Intergenic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1016087751 6:139935791-139935813 CTGAAGGCACTGAAGGAAGGAGG - Intergenic
1016317657 6:142808313-142808335 GTGAATGGATGGAAGGAAGGAGG + Intronic
1016317704 6:142808506-142808528 ATGAATAGACAGAGGGAAGGAGG + Intronic
1016547363 6:145239132-145239154 ATGACAGAAAAGAAGGAGGGAGG - Intergenic
1016758330 6:147711067-147711089 AGGAAGGAAGGGAAGGAAGGGGG + Intronic
1016801080 6:148169564-148169586 ACCAATGTACAGAAGGCAGGAGG - Intergenic
1017176977 6:151514318-151514340 ATGAAAGAAAGGAAGGAAGGAGG + Intronic
1017788601 6:157776042-157776064 GTGGATGAACAGAAGGAAAATGG + Intronic
1017865771 6:158441991-158442013 ATAACTGAAAAGCAGGAAGGGGG - Intronic
1018650193 6:165986581-165986603 TTGAAGGAAAAGGAGGAAGGAGG - Intronic
1019224474 6:170498780-170498802 ATGCGTGAACAGAATGAAGGGGG + Intergenic
1019334915 7:478513-478535 AAGAAGGGAGAGAAGGAAGGAGG + Intergenic
1019971118 7:4541681-4541703 AAGAAGGAAAACAAGGAAGGAGG - Intergenic
1020226996 7:6288330-6288352 AGGAAGGAAAGGAAGGAAGGAGG - Intergenic
1020454228 7:8353011-8353033 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1020530171 7:9323159-9323181 AAGAATGGGGAGAAGGAAGGAGG + Intergenic
1020925082 7:14314547-14314569 ATGAATGAAATGAAGGGAGAAGG + Intronic
1021319885 7:19196661-19196683 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1021374389 7:19888689-19888711 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1021505333 7:21377535-21377557 AAGAAAGAAAGGAAGGAAGGAGG + Intergenic
1021565071 7:22008760-22008782 ATCAATAAAAAGAAGGAAGTGGG + Intergenic
1021618758 7:22529575-22529597 ATGAATGAAATGAAGCAAGAAGG + Intronic
1021627717 7:22610743-22610765 ATGATTGAAGAGAAGAAGGGAGG + Intronic
1021663103 7:22941175-22941197 ATGAAGGAAGAGAATAAAGGAGG - Intergenic
1021671277 7:23037006-23037028 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1021938737 7:25657757-25657779 ACGAAGGAAGAGAAGGAAGGAGG + Intergenic
1021950500 7:25769542-25769564 ATGGATGGAAAGAAAGAAGGAGG + Intergenic
1021983509 7:26077544-26077566 AGGAAGGAAGGGAAGGAAGGAGG + Intergenic
1022278736 7:28883318-28883340 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1022311435 7:29200294-29200316 AGGAAAGAAGAGAGGGAAGGAGG - Intronic
1022479561 7:30734034-30734056 AAGCATGACCACAAGGAAGGAGG - Intronic
1022491480 7:30823457-30823479 ATGAAGGGAAAGAAGGAAGAAGG - Intronic
1022498584 7:30868517-30868539 ATGTATGGACAGAGGGCAGGTGG + Intronic
1022586828 7:31621022-31621044 ATGAATGAAATGAAGCAAGAAGG + Intronic
1022654873 7:32309164-32309186 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1022702612 7:32775852-32775874 ATAAAGGCAGAGAAGGAAGGTGG - Intergenic
1022782154 7:33596837-33596859 ATGGAAGAATAGAAGGAAGGGGG - Intronic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023084559 7:36557711-36557733 ATGAATGAAATGAAGCAAGAAGG - Intronic
1023466428 7:40460777-40460799 ATAAAAGAACAGAAAGAAGAAGG - Intronic
1023636822 7:42220379-42220401 ATGGATGGACAGAAGGATGGAGG + Intronic
1024022158 7:45382227-45382249 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1024169395 7:46768540-46768562 ATCAATCAGGAGAAGGAAGGAGG - Intergenic
1024278870 7:47701503-47701525 AGGAAAGAAGAAAAGGAAGGAGG + Intronic
1024356826 7:48422113-48422135 AGGAAGGAAGAGAAGGAAGCAGG + Intronic
1024471115 7:49769632-49769654 AGGAATGAAGAGAGGGCAGGAGG - Intergenic
1024655519 7:51448410-51448432 AGGAATGCACAGAACCAAGGGGG - Intergenic
1024694172 7:51838188-51838210 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1024818856 7:53303591-53303613 ACAAATAGACAGAAGGAAGGTGG + Intergenic
1024843457 7:53614823-53614845 ATGAAGGGAGAGAAGAAAGGAGG - Intergenic
1024916249 7:54503447-54503469 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1024919305 7:54541709-54541731 ATGAAGGAAAAGAAGGCAGGAGG + Intergenic
1025320977 7:58092857-58092879 ATGAATGAAACGAAGGGAGAAGG + Intergenic
1025552711 7:62270442-62270464 ATGAATGAAACGAAGGGAGAAGG - Intergenic
1026079724 7:67206991-67207013 ATAAATGCACAGAAGAAAGAAGG - Intronic
1026203537 7:68235736-68235758 ATGGATGAATGGATGGAAGGTGG + Intergenic
1026545889 7:71321837-71321859 AGGAAGGAAAGGAAGGAAGGAGG - Intronic
1026956575 7:74380060-74380082 ATGTATGAACAGAAGTATGAGGG + Intronic
1027007358 7:74706766-74706788 AGGAGTGCAGAGAAGGAAGGTGG - Intronic
1027842884 7:83336781-83336803 TTGAATGAACTGAAGAAAGATGG - Intergenic
1027898880 7:84082326-84082348 AAGAATGAGCAGCAGGAAGTGGG + Intronic
1027971703 7:85091180-85091202 AGGAAGGAAGAGAAGGAGGGAGG + Intronic
1027989096 7:85334447-85334469 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1028119470 7:87041028-87041050 ATGAATGAAATGAAGGGAGAAGG + Intronic
1028499949 7:91508119-91508141 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1028508028 7:91591057-91591079 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1028516900 7:91687856-91687878 AGGAAAGAAGAGAAGGAGGGAGG - Intergenic
1028613212 7:92735214-92735236 AAAAATGATAAGAAGGAAGGTGG - Intronic
1028686099 7:93590470-93590492 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1028877135 7:95836694-95836716 ATGAATGAAATGAAGCAAGAAGG - Intronic
1029011066 7:97262785-97262807 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1029088263 7:98028289-98028311 AGGAATGAAAGGAGGGAAGGAGG + Intergenic
1029180914 7:98701023-98701045 AGGAAGGAAGAGAAGGAATGGGG + Intergenic
1029633768 7:101770104-101770126 AAGAAAGAAAAGAAGGAAGGAGG - Intergenic
1030241672 7:107332836-107332858 AACACTGAAAAGAAGGAAGGAGG + Intronic
1030256009 7:107509312-107509334 ATGAATGAACTGAAGCGAGAAGG + Intronic
1030319868 7:108154573-108154595 TTGAAAGAAGAGAAGGAAGTGGG + Intronic
1030367686 7:108663934-108663956 TTGAATGAAGCGAAGGACGGAGG - Intergenic
1030466506 7:109909477-109909499 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1030677986 7:112404907-112404929 GTGAATGGAGAGAGGGAAGGAGG + Intergenic
1030716315 7:112811837-112811859 CTGAATGAAGAGAAGGAATGGGG + Intergenic
1030927822 7:115479528-115479550 AGGAAGGAAGAGAGGGAAGGAGG - Intergenic
1030996687 7:116367986-116368008 ATGAATGAAAACAAGGAAAAGGG - Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1033248901 7:139741717-139741739 ATGAATGCACAGGAGACAGGAGG - Intronic
1033301785 7:140192624-140192646 AAGAAGGAAGAGAAGAAAGGAGG + Intergenic
1033479595 7:141726527-141726549 TAGACTGAACAAAAGGAAGGAGG - Intronic
1033567708 7:142595650-142595672 AAGAAAGGAAAGAAGGAAGGAGG - Intergenic
1033684967 7:143630462-143630484 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033688140 7:143709681-143709703 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033699646 7:143827159-143827181 AAAAATGCACAGAAGGAAGAAGG + Intergenic
1033848237 7:145461912-145461934 ATGAATGAAGTAAAGGAAGCAGG - Intergenic
1033890703 7:146009384-146009406 ATGAAAGAAGAGCAGGAAGATGG + Intergenic
1033965038 7:146965109-146965131 ATGTAAGAACGGCAGGAAGGTGG + Intronic
1034064833 7:148126344-148126366 ATGAATGAAATGAATGAATGAGG + Intronic
1034332694 7:150296669-150296691 ATGTATGAACTGGAGGTAGGGGG - Intronic
1034665343 7:152813207-152813229 ATGTATGAACTGGAGGTAGGGGG + Intronic
1035067116 7:156114334-156114356 AAGAAAGAATAGAAGGAAGAAGG + Intergenic
1035776588 8:2191868-2191890 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1035792692 8:2322437-2322459 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1035800112 8:2399268-2399290 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1035862056 8:3039478-3039500 AAGAATTGAAAGAAGGAAGGAGG - Intronic
1036599130 8:10242937-10242959 ATGAATGACCAGGATGCAGGTGG - Intronic
1036708439 8:11061771-11061793 AAGAATGAGAAGAAGGAAGGGGG + Intronic
1037420037 8:18692454-18692476 AAGAATGAACAGGAGAAAAGAGG + Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037480428 8:19300316-19300338 GGGAATGAAGAGAAGAAAGGGGG - Intergenic
1037677601 8:21065231-21065253 ATGAAATAACAGAAGCCAGGTGG + Intergenic
1037897797 8:22669720-22669742 ATGAAGGAATAGAACGAATGGGG - Intergenic
1038234089 8:25735068-25735090 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1038305457 8:26396887-26396909 ATGAATGAAATGAAGCAAGAAGG + Intronic
1038371808 8:27001470-27001492 AAGAATGAACAGAAGCAAACAGG - Intergenic
1038438321 8:27554128-27554150 ATGAATGAAGTGAAGCAAGAAGG - Intergenic
1038503952 8:28068175-28068197 AGGAAGGAAGGGAAGGAAGGAGG + Intronic
1038653479 8:29427414-29427436 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1038654034 8:29432171-29432193 AAGAAAGGAAAGAAGGAAGGAGG + Intergenic
1038896889 8:31793886-31793908 AAGAATGGAGAGATGGAAGGAGG - Intronic
1038902157 8:31856339-31856361 ATGAATGAAATGAAGCAAGAAGG - Intronic
1039126716 8:34211519-34211541 ATGAATGAATAGAAGAAAGTAGG + Intergenic
1039151546 8:34512236-34512258 AAGGATGGAAAGAAGGAAGGAGG - Intergenic
1039300060 8:36199974-36199996 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1039330236 8:36529866-36529888 ACCAATGAACATAATGAAGGTGG + Intergenic
1039352961 8:36782329-36782351 AGGAATGAACGGAGGGAGGGAGG - Intergenic
1039694741 8:39898540-39898562 ATGAATGGATAGAAGAAATGTGG - Intergenic
1039816570 8:41099993-41100015 ATAAATAAAAAGAAGGAAGAAGG - Intergenic
1039903936 8:41772781-41772803 AGGATGGAACAGATGGAAGGAGG - Intronic
1040398254 8:47020009-47020031 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1041097114 8:54361355-54361377 AGGAAGGAAAAGAGGGAAGGAGG - Intergenic
1041136631 8:54766002-54766024 AGGAAGGAAGGGAAGGAAGGAGG + Intergenic
1041578121 8:59423063-59423085 ATGTATGAGCAGAGGGCAGGGGG - Intergenic
1041613911 8:59883257-59883279 ATGAATGAAAAGAAGCGAGAAGG + Intergenic
1041766511 8:61423811-61423833 ATGAATGGACTGAACTAAGGTGG + Intronic
1041854921 8:62440672-62440694 AAGAAGAAAAAGAAGGAAGGAGG - Intronic
1041982104 8:63873767-63873789 ATGGACGAACAGAAGAAAGAAGG + Intergenic
1042397703 8:68311104-68311126 AAGAAAGAAAGGAAGGAAGGAGG - Intronic
1042397828 8:68311925-68311947 AGGAAGGGAAAGAAGGAAGGAGG - Intronic
1042421103 8:68590149-68590171 AGGAAAGGAAAGAAGGAAGGAGG + Intronic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1042773771 8:72406309-72406331 ATGAATGAACTGACAGAAGTAGG + Intergenic
1042819709 8:72916671-72916693 ATGAATGAATTGAATGAAGATGG + Intronic
1042905273 8:73766162-73766184 GTGAATGCATAGGAGGAAGGCGG + Intronic
1043016602 8:74947378-74947400 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1043074324 8:75676991-75677013 AAGTATGAAGGGAAGGAAGGAGG + Intergenic
1043352959 8:79382755-79382777 ATGTTTGAAGAGGAGGAAGGAGG - Intergenic
1043601922 8:81950466-81950488 AGGAAGGAAAAGAAGGAAGGAGG - Intergenic
1043707867 8:83376645-83376667 AGGAAGGAAAGGAAGGAAGGAGG - Intergenic
1043757304 8:84019567-84019589 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1043803528 8:84642748-84642770 AGGAATGGAGAGAAGAAAGGAGG + Intronic
1043932961 8:86111460-86111482 ATGAATGGACAAAGGAAAGGTGG - Intronic
1043976506 8:86591066-86591088 ATGAATGAAATGAAGCAAGAAGG - Intronic
1043995145 8:86805076-86805098 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1044353735 8:91196571-91196593 ATGAATGAAATGAAGCAAGAAGG - Intronic
1044357749 8:91244385-91244407 AAGAATGAAAAGAGGGAAAGAGG - Intronic
1044403122 8:91794831-91794853 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1044409925 8:91870790-91870812 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1044544851 8:93448394-93448416 ATGAATGAATAGAATGATGCTGG - Intergenic
1044804780 8:95993984-95994006 AATAATGAACAGAAGAAAGGGGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044962421 8:97543547-97543569 AGGAATGGAAAGAAGGAAGATGG + Intergenic
1045231749 8:100312600-100312622 ATGAAAGAAGGGAAGGAGGGAGG + Intronic
1045737952 8:105318584-105318606 AAGAAGGAAGAGAAGGAGGGAGG - Intronic
1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG + Intronic
1046861881 8:119102239-119102261 AGGAAGGAAAAGAAGGAAGGAGG - Intronic
1046922514 8:119747790-119747812 ACAAATGAACAGAAGAAAAGTGG + Intronic
1046973805 8:120251115-120251137 ATGAATGACCAAATGGAAGCAGG - Intronic
1047006658 8:120627432-120627454 AGGAAGGAAGAGAAGGGAGGAGG + Intronic
1047008748 8:120648893-120648915 ATGAATGAAATGAAGCAAGAAGG - Intronic
1047046138 8:121055416-121055438 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1047388226 8:124429178-124429200 AGAAAAGAAAAGAAGGAAGGAGG + Intergenic
1047460914 8:125064515-125064537 ATTAATAAACAGAATTAAGGCGG - Intronic
1047598794 8:126406003-126406025 AGGAAGGAAGGGAAGGAAGGAGG - Intergenic
1047686787 8:127312857-127312879 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1047765208 8:127984967-127984989 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
1048093276 8:131263513-131263535 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1048213880 8:132479236-132479258 ATGCATGGCCAGAAGGAAGAAGG - Intronic
1048250960 8:132866588-132866610 AAGAAAGGAAAGAAGGAAGGAGG + Intergenic
1048529672 8:135235949-135235971 ATGAGTGAACTTCAGGAAGGGGG - Intergenic
1048551661 8:135438938-135438960 AGGAAGGAAGAGAAGGAAGAAGG + Intergenic
1048741248 8:137563312-137563334 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1049335974 8:142085544-142085566 AGGAAGGAAAGGAAGGAAGGAGG + Intergenic
1049899126 9:140956-140978 ATGAATGAAATGAAGCAAGAAGG + Intronic
1050020791 9:1282650-1282672 AGAAATGGAAAGAAGGAAGGTGG + Intergenic
1050339350 9:4620300-4620322 ATGAAGCCACAGGAGGAAGGAGG - Intronic
1050446710 9:5730557-5730579 ATGATTTAAAAGAAAGAAGGAGG + Intronic
1050664953 9:7925459-7925481 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1050867847 9:10526631-10526653 ATTAAAGAACAGGAGTAAGGAGG - Intronic
1051048918 9:12908495-12908517 ATGAATGATGAGAGGAAAGGAGG + Intergenic
1051179495 9:14395612-14395634 ATGAATGAACTGTAGGGTGGTGG - Intronic
1051299155 9:15629442-15629464 ATGAATGAAATGAAGCAAGAAGG + Intronic
1051395587 9:16616718-16616740 ATGAAAGAAAGGAAGAAAGGGGG + Intronic
1051846803 9:21460527-21460549 CTAAATAAACAGAATGAAGGGGG - Intergenic
1051867811 9:21700982-21701004 ATGATTGCTCAGAAGGAAGGGGG - Intergenic
1051889506 9:21927830-21927852 ATGGCTAACCAGAAGGAAGGGGG + Intronic
1051926337 9:22331587-22331609 ATCAATGAACAGCAAGAAGCAGG - Intergenic
1051959391 9:22739505-22739527 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1052239201 9:26251048-26251070 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1052993306 9:34535402-34535424 ATGAAGGAAAAGAGGGAAGGAGG - Intergenic
1053198650 9:36137986-36138008 AGGGAGGAACAGAGGGAAGGAGG - Intronic
1053562511 9:39210477-39210499 AAGAAAGAAGAGAGGGAAGGGGG + Intronic
1053601124 9:39610477-39610499 ATAAAAGAAGAAAAGGAAGGAGG - Intergenic
1053714674 9:40874866-40874888 ATGAATGAAATGAAGCAAGGAGG + Intergenic
1053742182 9:41151266-41151288 ATGAATGAAATGAAGCAAGAAGG + Intronic
1053858773 9:42364275-42364297 ATAAAAGAAGAAAAGGAAGGAGG - Intergenic
1054134640 9:61408562-61408584 AAGAAAGAAGAGAGGGAAGGGGG - Intergenic
1054252411 9:62731962-62731984 ATAAAAGAAGAAAAGGAAGGAGG + Intergenic
1054345913 9:63914658-63914680 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1054347455 9:63981081-63981103 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1054445181 9:65307424-65307446 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1054485091 9:65714082-65714104 ATGAATGAAATGAAGCAAGAAGG - Intronic
1054566525 9:66766461-66766483 ATAAAAGAAGAAAAGGAAGGAGG + Intergenic
1054686163 9:68280034-68280056 ATGAATGAAATGAAGCAAGAAGG - Intronic
1054880212 9:70136634-70136656 ATGAAAAAAAAGGAGGAAGGGGG + Intronic
1055500332 9:76896597-76896619 AAGAAAGGAAAGAAGGAAGGTGG - Intronic
1055511035 9:76995791-76995813 TGGAAGGAGCAGAAGGAAGGGGG - Intergenic
1055725696 9:79226018-79226040 AGGAATGAAGGGAAGGAGGGAGG - Intergenic
1055742086 9:79401255-79401277 AGGAGTGGATAGAAGGAAGGAGG - Intergenic
1055845912 9:80563453-80563475 AGGAAGGAAGAGAGGGAAGGAGG + Intergenic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1056484644 9:87043154-87043176 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1056521128 9:87402542-87402564 AAGAAAGAAAGGAAGGAAGGAGG + Intergenic
1056656875 9:88516786-88516808 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1056932912 9:90893489-90893511 ATGAAGGGAGAGAAGGAGGGAGG + Intronic
1057163019 9:92904643-92904665 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1057631499 9:96722565-96722587 ATCAATGAACACAATCAAGGGGG - Intergenic
1057728282 9:97585731-97585753 ATGAATGAAATGAAGCAAGAAGG - Intronic
1057787462 9:98097681-98097703 ACGAATGAACACATAGAAGGTGG + Intronic
1057840504 9:98482121-98482143 ATGGATGAACTGCAGGAAGGTGG - Intronic
1058144598 9:101398085-101398107 ATGAATGAACAAACAAAAGGAGG + Intronic
1058215032 9:102222633-102222655 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1058319410 9:103611006-103611028 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1058595534 9:106611363-106611385 ATGAAAGAACTGGAAGAAGGAGG + Intergenic
1058875874 9:109244400-109244422 GAGAAAGAAGAGAAGGAAGGAGG + Intronic
1058935807 9:109768136-109768158 ATGGAAGGAAAGAAGGAAGGAGG + Intronic
1059066289 9:111088828-111088850 AAGAAAGAAAAAAAGGAAGGAGG - Intergenic
1059260757 9:112973983-112974005 AGGAATGAACTGATGGAAGTAGG + Intergenic
1059667241 9:116460018-116460040 ATGAATGAATAAACGAAAGGTGG + Intronic
1059672277 9:116502937-116502959 AGGAAAGAAAAAAAGGAAGGAGG + Intronic
1059684763 9:116624491-116624513 ATGAGAATACAGAAGGAAGGGGG + Intronic
1059926987 9:119219480-119219502 ATAAATGGGAAGAAGGAAGGAGG - Intronic
1059929897 9:119250091-119250113 AGGAAGGAAGAAAAGGAAGGAGG + Intronic
1060004721 9:119989849-119989871 AAGAATGAACAGAAAGTATGAGG + Intergenic
1060166355 9:121419820-121419842 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1060306043 9:122413354-122413376 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1060850726 9:126873100-126873122 ATGCAAGGACAAAAGGAAGGTGG - Intronic
1061074452 9:128332651-128332673 AAGAGTGAACAGAAGGGAGTAGG - Intronic
1061237092 9:129349528-129349550 ATGAAACAAGAGCAGGAAGGGGG + Intergenic
1061244647 9:129395186-129395208 ATGAATGAAAAAATGGATGGAGG + Intergenic
1061321487 9:129833456-129833478 ATGAAGAAACTGAAGGAAAGGGG - Exonic
1062092369 9:134685161-134685183 ATGAATGAATGGATGGATGGTGG - Intronic
1062100628 9:134726560-134726582 ATGAGTGGACAGACGGATGGAGG + Intronic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062339342 9:136087064-136087086 ACAGATGCACAGAAGGAAGGTGG + Intronic
1062359689 9:136181879-136181901 AGGAAGGGAGAGAAGGAAGGAGG + Intergenic
1062406530 9:136399518-136399540 AGCAATGATCAGCAGGAAGGAGG + Intergenic
1062482990 9:136761042-136761064 ACAGATGCACAGAAGGAAGGTGG + Intronic
1062673823 9:137728064-137728086 AGGAATGAGCAGGAGGGAGGAGG - Intronic
1203639488 Un_KI270750v1:146751-146773 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1185524944 X:770361-770383 AGGGAGGAAAAGAAGGAAGGAGG + Intergenic
1185578538 X:1192795-1192817 AGGAAGGAAGGGAAGGAAGGAGG - Intronic
1185820243 X:3196064-3196086 AAGAAAGAAAGGAAGGAAGGAGG + Intergenic
1185853110 X:3507594-3507616 ATGAATGACCAGGATGAATGTGG + Intergenic
1185954834 X:4478168-4478190 ATGAAAGAAAGGAAGGAGGGAGG + Intergenic
1186047145 X:5548779-5548801 ATGGATGAAGAGGAGGAAGAAGG - Intergenic
1186059370 X:5687283-5687305 AGGAAGGAAGAGAAGGAAGGGGG + Intergenic
1186145783 X:6622114-6622136 ATGGAGGGACAGAAGGAAGGAGG + Intergenic
1186164594 X:6813204-6813226 ATAAAAGAAAAGAAGGAGGGAGG + Intergenic
1186228930 X:7431653-7431675 ATAAATAAACAGAAGATAGGTGG - Intergenic
1186246681 X:7622687-7622709 AGGAAGGAAGAGAGGGAAGGAGG - Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1186732510 X:12425208-12425230 AAGACTAAACAGGAGGAAGGTGG - Intronic
1187213094 X:17248928-17248950 ATGAATGTCCAGCAGGAAAGGGG - Intergenic
1187222929 X:17347207-17347229 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1187259058 X:17668457-17668479 ATGCAGGAACAGAAGGAGTGAGG - Intronic
1187264589 X:17719162-17719184 AGGAATAATGAGAAGGAAGGAGG + Intronic
1187912098 X:24120524-24120546 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1187931613 X:24298484-24298506 ATAAAGGAAGAGCAGGAAGGTGG - Intergenic
1188009025 X:25038716-25038738 AAGAATGGAAAGAAGGATGGTGG + Intergenic
1188450190 X:30301034-30301056 AAGAAAGAAAGGAAGGAAGGAGG + Intergenic
1188669120 X:32861595-32861617 AAGAATGAAAAGAAGGAGAGTGG + Intronic
1188900121 X:35721917-35721939 ATGAATGAACATAAAAAAGAAGG - Intergenic
1189021342 X:37344896-37344918 AAAAAAGAACAAAAGGAAGGAGG - Intergenic
1189207747 X:39256459-39256481 ATGAATGAACACATGCACGGGGG - Intergenic
1189262023 X:39686180-39686202 AAGAAAAAAAAGAAGGAAGGAGG + Intergenic
1189698230 X:43687980-43688002 AAGAAAGAACAGAATGTAGGCGG - Intronic
1189712363 X:43826694-43826716 AAGTATGAGCAGAAGGAAAGGGG + Intronic
1190047520 X:47124624-47124646 AGGAAGGAAAGGAAGGAAGGAGG + Intergenic
1190109582 X:47581502-47581524 ATGAATGAGCATTGGGAAGGGGG - Intronic
1190135023 X:47788399-47788421 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1190519574 X:51263411-51263433 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1190838402 X:54123445-54123467 ATGAATGAAATGAAGCAAGAAGG - Intronic
1191020106 X:55850489-55850511 ATGAATGAAACGAAGCAAGAAGG - Intergenic
1191064109 X:56329718-56329740 ATGAATGAACTAAAGCAAGAAGG - Intergenic
1191186171 X:57614564-57614586 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1191649454 X:63520527-63520549 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1191754122 X:64575795-64575817 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1191768716 X:64732315-64732337 ATGGATGAACTGACGGAAGCAGG - Intergenic
1191911599 X:66157442-66157464 ACCAATGAACAGAAGGTAGAAGG + Intergenic
1192017196 X:67344015-67344037 ATGCATGAACAGAGGCATGGAGG - Intergenic
1192103172 X:68287217-68287239 AAGAAAGGAAAGAAGGAAGGAGG + Intronic
1192376599 X:70569132-70569154 ATGAATGAAATGAAGCAAGAAGG - Intronic
1192392635 X:70746586-70746608 AAGAAAGAACAGAAGCAAAGAGG + Intronic
1192660392 X:73036405-73036427 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1192854872 X:74998736-74998758 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1192871352 X:75187749-75187771 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1192936861 X:75869565-75869587 CTGAAGGAAAAGAAGGAACGAGG - Intergenic
1192942424 X:75926415-75926437 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1193009912 X:76664997-76665019 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1193189158 X:78548960-78548982 ATGACTGAACAATAGGAAAGTGG + Intergenic
1194266010 X:91754075-91754097 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1194516677 X:94863653-94863675 ATGAATGAAATGAAGCAAGACGG + Intergenic
1194570383 X:95548611-95548633 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1194907738 X:99598716-99598738 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1194963013 X:100256888-100256910 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1195279617 X:103318350-103318372 ATCAGTGAACAAAGGGAAGGAGG + Intergenic
1195315484 X:103673401-103673423 ATCAATGTAAAGAAGAAAGGAGG - Intergenic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1195764189 X:108278407-108278429 ATGAATGAAATGAAGCAAGAAGG + Intronic
1195947181 X:110227645-110227667 ATGAAAGAACAGAATGGGGGTGG + Intronic
1195966633 X:110435080-110435102 AGGAAAGAAGGGAAGGAAGGAGG + Intronic
1196181605 X:112698169-112698191 CTGAAGGGCCAGAAGGAAGGCGG - Intergenic
1196380571 X:115085175-115085197 ATGAATGAAATGAAGCAAGACGG - Intergenic
1197013304 X:121593621-121593643 ATGAAGGAACAGAGGCAGGGTGG - Intergenic
1197130777 X:123003087-123003109 AGGAAAGAAAAGAAGGAAGGAGG + Intergenic
1197168295 X:123403522-123403544 AAGTGTGAACAGAAGGTAGGTGG + Intronic
1197389263 X:125840264-125840286 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1197549426 X:127870883-127870905 ATGAATGGATAAAAGGAATGAGG + Intergenic
1198057708 X:133011081-133011103 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1198485070 X:137079449-137079471 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1198757083 X:139993734-139993756 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1198947784 X:142033947-142033969 ATGATGGAAGACAAGGAAGGAGG - Intergenic
1199309254 X:146303552-146303574 AGGAAGGAACGAAAGGAAGGAGG - Intergenic
1199465187 X:148128197-148128219 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1199537297 X:148917224-148917246 ATGAATCAAAAGTATGAAGGTGG - Intronic
1199578260 X:149335277-149335299 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1199595760 X:149504818-149504840 ATGGATGAATAGATGGAAAGAGG + Intronic
1199811313 X:151352644-151352666 ATGAACCAAAGGAAGGAAGGAGG - Intergenic
1199924829 X:152451180-152451202 ATGAATGAACTGAAACAAGTTGG + Exonic
1200006006 X:153084671-153084693 ATGAATGATCAAATGGCAGGTGG - Intergenic
1200413995 Y:2889352-2889374 AAGAAAGGAAAGAAGGAAGGAGG - Intronic
1200574206 Y:4867767-4867789 ATGAATGAAAAGAAGTGAGAAGG + Intergenic
1200820149 Y:7574772-7574794 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1201073578 Y:10170810-10170832 AAGGAAGAACAGAGGGAAGGAGG - Intergenic
1201147286 Y:11072259-11072281 TTAAATGAACAGAAGGAAGCCGG - Intergenic
1201230487 Y:11859793-11859815 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1201274757 Y:12286892-12286914 AGGAATTGTCAGAAGGAAGGGGG + Intergenic
1201349663 Y:13025825-13025847 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1201382258 Y:13394778-13394800 ATGAGTGAGGAGAAGCAAGGAGG - Intronic
1201425881 Y:13850653-13850675 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1201434171 Y:13939018-13939040 AAGAAAGAAAGGAAGGAAGGAGG - Intergenic
1201458910 Y:14201242-14201264 AGGAAGGAAGGGAAGGAAGGAGG + Intergenic
1201496324 Y:14594223-14594245 ATGATCCAACAGAAGGAATGAGG - Intronic
1201519998 Y:14862504-14862526 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1201536299 Y:15052414-15052436 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1201544633 Y:15148190-15148212 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1201558696 Y:15292080-15292102 AAGAAGGAAGGGAAGGAAGGAGG + Intergenic
1201572323 Y:15427326-15427348 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1201600823 Y:15727046-15727068 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1201627198 Y:16027329-16027351 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1201671325 Y:16524708-16524730 ACGAACGAACGGAAGTAAGGAGG - Intergenic
1201703816 Y:16913468-16913490 ATGAATGAAATGAAGCAAGAAGG + Intergenic
1201779965 Y:17709763-17709785 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1201821590 Y:18196229-18196251 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1201885668 Y:18879536-18879558 AAGAAAGGAAAGAAGGAAGGTGG + Intergenic
1201919437 Y:19218680-19218702 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1202072841 Y:21010637-21010659 ATGAATGAAAAGAAGTGAGAAGG - Intergenic
1202077541 Y:21052491-21052513 ATGAATGAAAAGAAGTGAGAAGG - Intergenic
1202089184 Y:21171487-21171509 ATGAATGAAATGAAGCAAGAAGG - Intergenic
1202357315 Y:24065088-24065110 ATGAATGAAATGAAGAAAGAAGG + Intergenic
1202513462 Y:25605026-25605048 ATGAATGAAATGAAGAAAGAAGG - Intergenic
1202577298 Y:26341013-26341035 ATGAATGAAATGAAGCAAGAAGG + Intergenic