ID: 1023052723

View in Genome Browser
Species Human (GRCh38)
Location 7:36267316-36267338
Sequence ATGGGGGCCCCTGCATGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023052723 Original CRISPR ATGGGGGCCCCTGCATGGCC AGG Intronic
900318559 1:2071093-2071115 AGGGGGGCGCCTGCACTGCCAGG + Intronic
900473561 1:2865984-2866006 ATTGGGGCCCCTGCAGGTCAGGG - Intergenic
900473606 1:2866137-2866159 GTGGGGGCCCCTCCATGGGGGGG + Intergenic
900587630 1:3440770-3440792 AAGGGGTCCCCTGCGTGACCTGG - Intergenic
900689838 1:3973801-3973823 ATGGGGACTCCAGCATGGTCAGG + Intergenic
900792486 1:4689563-4689585 ATGGGGGTGCCTGGATGGCCTGG + Intronic
901473478 1:9473427-9473449 CTGGGGGCCCCTGGATACCCCGG + Intergenic
903169621 1:21544017-21544039 ATGGAGGCCTGTGCAGGGCCTGG + Intronic
903352100 1:22723481-22723503 CTGGGTGCCCCTGGCTGGCCCGG + Intronic
904820343 1:33238889-33238911 ATCGAGGCACCTGCATGGTCCGG - Intergenic
904825866 1:33273363-33273385 AGGGTGGCCCCTGCCTGACCAGG + Intronic
905919938 1:41712725-41712747 AGCTGGTCCCCTGCATGGCCCGG + Intronic
910846463 1:91609430-91609452 ATGGGGCTGTCTGCATGGCCTGG - Intergenic
915018867 1:152761081-152761103 ATTTGGGCCCCAGCATGGGCTGG - Exonic
916195909 1:162222414-162222436 TTGGGTGCCCCTGCATTGTCAGG + Intronic
922205082 1:223439212-223439234 TGGGGTGCCCCTGCAAGGCCTGG - Intergenic
923130865 1:231073553-231073575 ATGCAGGCCCTTGCCTGGCCTGG - Intergenic
1063087622 10:2833778-2833800 TTGTGGGCCACTGCATGTCCTGG + Intergenic
1067185088 10:44020641-44020663 ATGGGGAGGCCTGCAAGGCCAGG - Intergenic
1067452984 10:46393732-46393754 GTAGCGGCCCCTGCAGGGCCAGG + Intergenic
1067584248 10:47466028-47466050 GTAGCGGCCCCTGCAGGGCCAGG - Intronic
1068551489 10:58412895-58412917 ATGCTGCCCTCTGCATGGCCTGG - Intergenic
1070281379 10:75051214-75051236 ATGGGGGACCCTGGGTGGCAAGG + Intronic
1070759917 10:79017675-79017697 CTGGGGGGCCCTGCATCTCCTGG - Intergenic
1071537557 10:86447764-86447786 ATGAGCCACCCTGCATGGCCAGG - Intronic
1074316951 10:112369720-112369742 GTGGGAGCCCCTGCCTGGGCTGG + Intergenic
1074915335 10:117950039-117950061 ATTGGGGTGCCTGCATGGTCAGG - Intergenic
1075173721 10:120140223-120140245 GTGGGTGCCCCTTCAAGGCCTGG + Intergenic
1076624960 10:131816086-131816108 ATGGGTGCGGCTGCATGGCGGGG - Intergenic
1076720660 10:132391215-132391237 CGGGAGGCCCCTGCCTGGCCTGG - Intergenic
1077325313 11:1961227-1961249 CTGGGGGACCCCCCATGGCCAGG - Intronic
1081489156 11:43554039-43554061 ATGGGAGCCCCTGCAAGCCGGGG + Intergenic
1081592498 11:44434363-44434385 TTGGGAATCCCTGCATGGCCTGG + Intergenic
1081915145 11:46725988-46726010 ATGGGCTCCCCTGCCTGGCCTGG + Exonic
1083720905 11:64603095-64603117 AAGGGGGTCACTGCTTGGCCTGG + Intergenic
1084024372 11:66438652-66438674 GTGGGGGCCCGGGCATGGCCAGG + Exonic
1084785177 11:71437973-71437995 ATGGGGGCCCCAGGAGGGCCGGG - Intronic
1084906267 11:72350189-72350211 CTGAGGGCCCCTTCAAGGCCTGG + Intronic
1086319224 11:85627943-85627965 GTGGGGGGCACTGCAAGGCCTGG - Intergenic
1086750725 11:90490286-90490308 ATGGGAACCCCTGGATGCCCAGG + Intergenic
1089075072 11:115731839-115731861 ACGGGGACCCCTGCATGTCTAGG + Intergenic
1089168769 11:116498338-116498360 ATGGCCACCCCAGCATGGCCTGG + Intergenic
1089755139 11:120680983-120681005 ACAGGGGCCCCTGCACTGCCTGG + Intronic
1089789324 11:120931263-120931285 AGGAGGGCCCCTGCAGGGACTGG + Intronic
1090225775 11:125071434-125071456 GTGGGGGACCCTGAATGGTCAGG - Intronic
1090305679 11:125688972-125688994 GTGGAGGCCCCCGCATGGTCTGG - Intergenic
1090532126 11:127601475-127601497 ATGGAGGCCACTCCAAGGCCTGG - Intergenic
1202808294 11_KI270721v1_random:16406-16428 CTGGGGGACCCCCCATGGCCAGG - Intergenic
1091652259 12:2319151-2319173 GTGGGGACCCCTGCCTGCCCAGG - Intronic
1091706451 12:2696796-2696818 AAGGGAGCCACTGCTTGGCCTGG - Intronic
1092056168 12:5510113-5510135 CTGGGCCCCCCAGCATGGCCTGG + Intronic
1092366490 12:7881213-7881235 ATGGGAGCCCCTTCCTGGGCTGG + Intronic
1096215011 12:49793772-49793794 CTGTGGGCCCCGGAATGGCCTGG - Exonic
1102525891 12:113512200-113512222 ATGGGGGGCCCTGCAGAGCTAGG + Intergenic
1104786687 12:131454919-131454941 CTGGGAGCTGCTGCATGGCCGGG - Intergenic
1113877130 13:113601538-113601560 TTGGGGGCCCCTGCAGGGCCAGG + Intronic
1115906871 14:38210592-38210614 CTCAGGGCCCCTGCGTGGCCCGG - Exonic
1118440131 14:65804551-65804573 AAGGGGGCCCCTGTGTGGTCCGG + Intergenic
1120740733 14:88106190-88106212 CTGGGGGCTGCCGCATGGCCAGG - Intergenic
1121105216 14:91274964-91274986 ATGGGGCTCCCTGCGTGGCCAGG - Intronic
1122156684 14:99754305-99754327 ATGGGGCCCCCTCCTTGCCCTGG - Intronic
1122325769 14:100879981-100880003 AAGAGGGCCCCTGCATGCCTTGG - Intergenic
1122792955 14:104192183-104192205 ATCGGGGCCCCTCCATGTCCAGG + Intergenic
1122811685 14:104292381-104292403 CTGGGAGGCCCTGCAGGGCCTGG - Intergenic
1122895692 14:104755728-104755750 CTCGGGGCCCCTGTAGGGCCAGG - Exonic
1122927021 14:104908765-104908787 AATGAGGCCACTGCATGGCCAGG - Intergenic
1122970661 14:105150859-105150881 ATGGGGGCACCTGCAAGGTGAGG - Exonic
1123038171 14:105479691-105479713 AGGGGGGCCCCTGCAGGGTCTGG - Exonic
1124655697 15:31504722-31504744 ATGTGGCCCCTGGCATGGCCTGG + Intronic
1126124425 15:45282658-45282680 ATGCATGCCCCTGCATGGCAGGG - Intergenic
1126165587 15:45651432-45651454 GTGGGGGCCCCTCTATGGGCTGG - Intronic
1126793818 15:52243907-52243929 GAGGGGGTCCCTGCAAGGCCTGG - Intronic
1128711051 15:69872281-69872303 ATCCTGGCCCCTGCATGCCCTGG + Intergenic
1129697163 15:77747197-77747219 ATGTGGCCCCCTGCTAGGCCTGG - Intronic
1131059023 15:89393072-89393094 ATGGGGCACCCTGCCTGACCTGG + Intergenic
1131456230 15:92584691-92584713 ATGGGGCCCTCTGCCTGGCAGGG - Intergenic
1131558524 15:93419768-93419790 ATGGGGTCCTCTGCCTGGCAGGG + Intergenic
1131622577 15:94083090-94083112 ATGGGGGAGCCTGCATGGATTGG - Intergenic
1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG + Intronic
1137429330 16:48405720-48405742 ATGGGGGCCAGACCATGGCCTGG + Intronic
1139356870 16:66371810-66371832 CTGGGGGCCCCTCAATGGGCTGG - Intronic
1140634104 16:76890261-76890283 ATGGGGCCCCCTCCATGGTAAGG + Intergenic
1141638938 16:85329954-85329976 ATGGGAGCCCCTGGAGGGCGGGG - Intergenic
1141772136 16:86095964-86095986 CTGGTGGCCTCTGCATGTCCAGG + Intergenic
1141842182 16:86580107-86580129 CTGCGGGCCCTTGCATGCCCGGG - Exonic
1142172667 16:88630965-88630987 AAGGGGCTCCCTGGATGGCCAGG - Intronic
1142395334 16:89828537-89828559 ATGACGGCCCCGCCATGGCCCGG + Exonic
1142513583 17:413032-413054 ATGGGGGCCCCTCCGTACCCAGG - Intronic
1143970949 17:10795295-10795317 ATATGAGCCACTGCATGGCCAGG + Intergenic
1145064212 17:19751040-19751062 CTGTGAGCCCCTGCCTGGCCTGG + Intergenic
1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG + Intronic
1148152078 17:45402897-45402919 ATGGGGTCACTGGCATGGCCAGG + Intronic
1148438070 17:47697423-47697445 CACGGGGCCACTGCATGGCCAGG - Intronic
1148872631 17:50667798-50667820 CTGGGTGCCCAGGCATGGCCAGG + Intronic
1149902375 17:60492217-60492239 ATGGGAACGCCTGCATGTCCAGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150623400 17:66824719-66824741 AGAGGGGCCCCAGCATGCCCAGG + Intergenic
1151827196 17:76530046-76530068 TTGGGGGCCCGTGCAGAGCCCGG + Intronic
1152144704 17:78561323-78561345 AGGGGAGCCCCGGCTTGGCCTGG - Intronic
1152728232 17:81958070-81958092 GAGGAGGCCCCAGCATGGCCTGG - Intronic
1154446225 18:14437886-14437908 AAGAGGGCCCCTCCATGGCCTGG + Intergenic
1156610543 18:38718809-38718831 ATGGGAGCCCCTTTCTGGCCTGG - Intergenic
1157333448 18:46720286-46720308 GTGGGGGCCCATGCTTGTCCTGG - Intronic
1160053066 18:75455266-75455288 ACGGGGCACCCTGCAGGGCCGGG + Intergenic
1160303108 18:77704490-77704512 ATGGGGCCATCTGCATGGCCTGG - Intergenic
1160754954 19:752225-752247 AAGATGGCCCCTGCAAGGCCCGG - Intronic
1160815045 19:1031274-1031296 TTGGGGGGCCGGGCATGGCCTGG + Intronic
1160862923 19:1245238-1245260 GTGGGTGGCCCTGCCTGGCCGGG + Intergenic
1161263065 19:3348221-3348243 AAGGGCTCCCCTGCCTGGCCTGG + Intergenic
1161851664 19:6740601-6740623 CTGGGGGCCCCTGAGTGGCCAGG - Intronic
1162419581 19:10558385-10558407 GTGGGAGGCCCTGCATGTCCAGG + Intronic
1162566682 19:11448636-11448658 GTGGGGGCCCCTGCATTCCTGGG - Intronic
1163513301 19:17748444-17748466 GTGGGGTCCCCTGCCTGGCACGG + Intronic
1163514234 19:17753518-17753540 CTGGGGACTCCTGCAGGGCCAGG + Intronic
1163580847 19:18137670-18137692 ATGGGGCCCCATGCCTGGTCAGG - Intronic
1163597079 19:18226400-18226422 CGGGGGGGCCCTGCATCGCCAGG + Intronic
1163600764 19:18247904-18247926 ATGGGGACCGCTGCAAGGTCCGG - Intronic
1164214126 19:23129089-23129111 ATGGGAACCCCTGGATGGCCAGG + Intronic
1164737600 19:30553353-30553375 ATGGGGCCCACTGCATGGAACGG + Intronic
1164753573 19:30673267-30673289 ATGTGTGCCCCTGAAGGGCCAGG - Intronic
1164888529 19:31803638-31803660 ATATGGGTTCCTGCATGGCCAGG + Intergenic
1165422299 19:35728220-35728242 AGCGTGGCCCCTGCATGCCCTGG - Intronic
1165741126 19:38205956-38205978 ATGTGTGCCCCGGCCTGGCCTGG + Intronic
1165820970 19:38675831-38675853 CTGGGGCCCTCTGCTTGGCCTGG - Intronic
1165939619 19:39408501-39408523 CTGGGGGCCCTTGGGTGGCCTGG + Exonic
1166015991 19:39979865-39979887 GTGAGGGCCCCCGCATGGTCCGG + Exonic
1166377020 19:42333450-42333472 CTGGGGGCCCCTTCAAGGCGGGG + Intronic
1166943642 19:46383995-46384017 CTTGGTGCCCCAGCATGGCCAGG - Intronic
1167511446 19:49897298-49897320 ATGGGGGGCCCTGCAGGACATGG - Intronic
924977029 2:187188-187210 GTGGGGGCTCCTGTGTGGCCAGG + Intergenic
927199893 2:20571655-20571677 ATGTGGGCCCCAGCAGGTCCAGG - Intronic
929453532 2:42051367-42051389 CTGGGGGCCCATCCAAGGCCTGG - Intronic
929484657 2:42342779-42342801 ACGGGGGGCGCTGAATGGCCAGG - Intronic
931872827 2:66479806-66479828 ATGGGGAATCCTTCATGGCCCGG - Intronic
932864171 2:75324354-75324376 ATGGGGGCTCATGATTGGCCAGG + Intergenic
933824011 2:86142002-86142024 AAAGGGGACCCTGCTTGGCCAGG - Exonic
934027412 2:88012757-88012779 ATGGAGGCCCCTGCAAGTCCAGG + Intergenic
934561248 2:95314671-95314693 GTGAGGGGCCCAGCATGGCCAGG + Intronic
935799925 2:106685672-106685694 ATGGGGGCCAATGCATTGCAAGG - Intergenic
936126055 2:109789889-109789911 ACGGGGGGCCCAGCAGGGCCTGG + Intergenic
936218638 2:110581579-110581601 ACGGGGGGCCCAGCAGGGCCTGG - Intergenic
936373069 2:111919223-111919245 ATGGGGGGCACTGAATGGCCTGG - Intronic
937313665 2:120917525-120917547 AAGGGGGCGCATGGATGGCCTGG - Intronic
937872910 2:126798688-126798710 ATGGGGACCCCTGCAGGAGCAGG - Intergenic
937999242 2:127719504-127719526 GTGGAGGCCCCTGCATGCCTCGG + Exonic
939287694 2:140154236-140154258 ATGGAAACCCCTGCATGCCCAGG - Intergenic
942231414 2:173863869-173863891 ATAGGGTCACCAGCATGGCCAGG + Intergenic
944227233 2:197360040-197360062 CTAGGGGCCCCTGCTGGGCCAGG + Intergenic
947166068 2:227263800-227263822 AGAGGAGCCCCTGGATGGCCAGG + Exonic
948299241 2:236889625-236889647 CTGGGGGCCCCTGGATAACCCGG + Intergenic
948627028 2:239275695-239275717 CTGGGGGCCTCTGCAGTGCCTGG + Intronic
948918917 2:241052388-241052410 ATGGGGGCACCTGCGAGGACCGG + Exonic
949013029 2:241692724-241692746 ATGGGGGTCGCTGACTGGCCAGG - Intergenic
1170159552 20:13297632-13297654 ATGGTGACCCCTCCATGGACAGG - Intronic
1171892375 20:30728349-30728371 AGGGCGGCCCGTGCAGGGCCTGG - Intergenic
1173251389 20:41365971-41365993 ATGGGAGCCCCAGCGTGGCCGGG - Intronic
1175999901 20:62827098-62827120 ATGGGGGCCCCTCCAGGCCTGGG - Intronic
1175999925 20:62827157-62827179 ACGGGGGCCCCTCCAGGCCCGGG - Intronic
1176122426 20:63460168-63460190 TTGGGGACCCCTGCTTGGCCTGG + Intronic
1176449757 21:6851960-6851982 AAGAGGGCCCCTCCATGGCCTGG - Intergenic
1176827929 21:13716984-13717006 AAGAGGGCCCCTCCATGGCCTGG - Intergenic
1178743682 21:35226909-35226931 AGAGGGGCCCCTGCTAGGCCGGG - Intronic
1180099457 21:45577796-45577818 CTGGGGGCCCCTGAAGGACCTGG + Intergenic
1180174070 21:46079025-46079047 ATGGGGGCCTCTGCCCAGCCAGG - Intergenic
1180182887 21:46125709-46125731 ACGAGGGCCTCTGCATGGCTGGG + Intronic
1181014341 22:20060697-20060719 CTGGGGGCCCCAGCAGAGCCAGG + Intronic
1181818780 22:25459536-25459558 ATTGGTGCCCCTGCATGTCGTGG - Intergenic
1183217745 22:36492106-36492128 ATGGAGGCCCCTGGGAGGCCAGG + Intronic
1183452895 22:37906368-37906390 TTCGGGGCCCCGGCTTGGCCGGG - Exonic
1184389009 22:44192440-44192462 TTAGAGGCCCCTGCATGGCCAGG + Intronic
1184682558 22:46080017-46080039 CTGTGGGCGCCTGCCTGGCCGGG - Intronic
1185228548 22:49667657-49667679 CTGGGGGCCCCAGGATGGTCAGG - Intergenic
1185228581 22:49667755-49667777 CTGGGGGCCCCAGGATGGTCAGG - Intergenic
1185228618 22:49667853-49667875 CTGGGGGCCCCAGGATGGTCAGG - Intergenic
1185228635 22:49667902-49667924 CTGGGGGCCCCAGGATGGTCAGG - Intergenic
1185228670 22:49668000-49668022 CTGGGGGCCCCAGGATGGTCAGG - Intergenic
1185228704 22:49668098-49668120 CTGGGGGCCCCAGGATGGTCAGG - Intergenic
1185310012 22:50149111-50149133 CTGTGGCCGCCTGCATGGCCAGG + Intronic
950407330 3:12812977-12812999 AGGTGAGCCCCTGCAGGGCCAGG - Exonic
950496099 3:13335486-13335508 ATCGGGGCAGCTGTATGGCCTGG - Exonic
952426966 3:33185393-33185415 ATGGGGGCCCCTTGATGACTGGG + Intronic
953748526 3:45593304-45593326 CTTGGCGCCCCCGCATGGCCCGG - Intronic
954369204 3:50161411-50161433 ATGTGGGCGCCGGCAAGGCCAGG - Intronic
954398086 3:50303510-50303532 ATGGGGGCCTAAGCAGGGCCTGG + Exonic
955429524 3:58828129-58828151 ATGGGGGCTCCTGTATGCCAAGG + Intronic
959457450 3:106580415-106580437 TTAGAAGCCCCTGCATGGCCTGG - Intergenic
959650347 3:108745007-108745029 ATGATGTGCCCTGCATGGCCTGG + Intronic
961451736 3:127005262-127005284 ATGGTGCCCGCTGCCTGGCCAGG + Intronic
961862203 3:129926049-129926071 ATGTGGGCCCCTGCAGGAGCTGG - Intergenic
964848426 3:161068653-161068675 CTGGGACCCACTGCATGGCCTGG - Intronic
967082809 3:186065876-186065898 CTGGGGGCCCTGGCATGCCCGGG + Exonic
968634017 4:1668541-1668563 CTGGGGGGCCCTGCTGGGCCAGG - Intronic
968984520 4:3867863-3867885 CTGGGGGCCCCTGGAAGGCAGGG - Intergenic
969414597 4:7050295-7050317 CTGGTGGCCCCTGCAGGGCCAGG - Intronic
973571179 4:52241358-52241380 ATGAGGGTCCCAGCATGGTCTGG + Intergenic
974785824 4:66618862-66618884 AAAGGGCCCACTGCATGGCCAGG + Intergenic
977682019 4:99807339-99807361 ATGTGGCCCCCTTCAGGGCCAGG + Intergenic
978226242 4:106338584-106338606 ATGGAAGCCCCTGGATGTCCTGG + Intronic
980267705 4:130540897-130540919 TTGGGAGCCCATGTATGGCCGGG - Intergenic
980859799 4:138485616-138485638 AAGGGAGCCACTGCATGGCTGGG - Intergenic
982758282 4:159250856-159250878 ATGGGGGCCCCTCTCTGGGCTGG + Intronic
985615482 5:917780-917802 ATGGGCGCCCCTGCATTGCTGGG + Exonic
985697018 5:1346388-1346410 TTGGGGTCCCCTACAGGGCCAGG + Intergenic
986441539 5:7786978-7787000 ATGGGGTCCCAGGCATGTCCTGG + Intronic
986685319 5:10271129-10271151 GTGGGGGCCCCAGCAAGGCCTGG - Intergenic
992744693 5:79807565-79807587 ATGTGGGTGCCTGCAGGGCCTGG - Intergenic
997413930 5:133710640-133710662 AGGGGTACCTCTGCATGGCCAGG - Intergenic
997653599 5:135539377-135539399 ATGGTGGCCCTTGAATGGCCAGG + Intergenic
998203476 5:140143515-140143537 ATAGGGTCCCCTGCTAGGCCAGG + Intergenic
998426974 5:142037023-142037045 GTGGGGGCCCGGGCATGGCCAGG + Intergenic
999430883 5:151524494-151524516 ATCGGGGTGCCAGCATGGCCAGG - Intronic
1000449857 5:161372281-161372303 AAGGATGCCCCTGCATGGCCAGG + Intronic
1001603388 5:172943610-172943632 ATGGGGCCCACTGCAGGGACCGG - Intronic
1001633168 5:173191766-173191788 ATGGGGGCCGCAGCGTGGCAGGG - Intergenic
1002422855 5:179158650-179158672 CCGGGGCCCCTTGCATGGCCAGG + Intronic
1002433551 5:179218178-179218200 GTGGTGGCCCCTGCAGGCCCTGG - Intronic
1002907129 6:1457738-1457760 GTGGGGGCCATGGCATGGCCAGG + Intergenic
1003357034 6:5383357-5383379 TTTGGAGCCCCTCCATGGCCTGG + Intronic
1003955889 6:11164794-11164816 AAGGGGGCTCCTGAGTGGCCGGG + Intergenic
1007229982 6:40341491-40341513 CTGGGGGCTCCTGGATAGCCTGG + Intergenic
1007622340 6:43222763-43222785 ATGGGAGCCCCTGCAGGTGCTGG + Exonic
1007709061 6:43810234-43810256 CTAGGGGCCCCTGCAGGGCAGGG - Intergenic
1009312333 6:62170394-62170416 AAGGGGGCTCCTCCAAGGCCTGG + Intronic
1013294842 6:108749788-108749810 TTGGGGGCCCCTACATTGTCTGG - Intergenic
1017716904 6:157219111-157219133 GTGGGGGCCGGTGAATGGCCTGG + Intergenic
1019029862 6:169000738-169000760 GTGGTGTCCTCTGCATGGCCCGG + Intergenic
1019439986 7:1041142-1041164 AGGGAGGCCCCTGCACGGCAAGG + Intronic
1019539231 7:1544304-1544326 CTGGGGGCCCTGGCCTGGCCCGG - Exonic
1019621797 7:1996142-1996164 CCGGGGGACCCTGCATGCCCAGG - Intronic
1020079960 7:5282020-5282042 ATGGTGGCCCCGGGAGGGCCGGG - Intronic
1022725769 7:32980214-32980236 ATGGGGGCCCATTCAAGACCTGG + Intronic
1023000308 7:35801398-35801420 ATGGGGGCCACTGCGGGCCCGGG + Intronic
1023052723 7:36267316-36267338 ATGGGGGCCCCTGCATGGCCAGG + Intronic
1023531157 7:41155829-41155851 ATGAGGGCCCCTGCTTTTCCTGG - Intergenic
1023687484 7:42751521-42751543 ATGAAGGCACCTGCATGGCTTGG - Intergenic
1023821928 7:43985429-43985451 CTGGGGCCCCTTGCCTGGCCTGG + Intergenic
1024049006 7:45606255-45606277 TTGGGGGCCCCTTCACAGCCTGG + Intronic
1025047843 7:55707483-55707505 ATGGGGGCCCATTCAAGACCTGG - Intergenic
1028641269 7:93044295-93044317 ATGGGGCCTCCAGCAGGGCCTGG - Intergenic
1028974312 7:96894685-96894707 ATGGGGGCACCAGCATGGGGAGG - Intergenic
1029109741 7:98206901-98206923 TTGGGTGGTCCTGCATGGCCCGG + Exonic
1029490430 7:100867491-100867513 AGGTGGGCCCCGACATGGCCTGG - Exonic
1030692971 7:112553566-112553588 ATGGAGGCACCTCCATGGCAGGG + Intergenic
1033311447 7:140264832-140264854 CTTGGGACCCCTGCATTGCCTGG - Intergenic
1034203291 7:149295569-149295591 CTGGGGGCCACTTCTTGGCCAGG + Intronic
1034973860 7:155436690-155436712 AAGGGGGGCCCTGCAGGCCCTGG - Intergenic
1035166431 7:156993158-156993180 ATGGGGGTCCCTGCAGGTCTGGG - Intergenic
1035335906 7:158126783-158126805 CTGGGGGAACCTGCAGGGCCAGG + Intronic
1036710452 8:11075099-11075121 ATGGGAGCCTCTGCAGGGCGGGG - Intronic
1037888375 8:22607159-22607181 ATGGGGTCCCCTGAATTTCCTGG + Intronic
1038083916 8:24173029-24173051 ATTGGTGCTCCTGCTTGGCCAGG - Intergenic
1039439788 8:37587148-37587170 ATGGCAGCCCCTGCATTTCCAGG + Intergenic
1039884919 8:41649318-41649340 ATGGAGGCCCCTGCCTGACGTGG + Intronic
1040739733 8:50558236-50558258 ATGGCAGCAGCTGCATGGCCAGG + Intronic
1043734125 8:83723496-83723518 CTGGGTGCCCCTGCATTCCCTGG - Intergenic
1045734102 8:105275158-105275180 ATGGGGCCCCCTCCATCTCCAGG - Intronic
1046375605 8:113376645-113376667 ATGGCGCCTCCTGCCTGGCCAGG - Intronic
1048107499 8:131427552-131427574 ATGGAGACCCCTGGATGACCAGG - Intergenic
1049356484 8:142191692-142191714 AAGGGGGGCCCTGGAGGGCCTGG + Intergenic
1049389152 8:142359179-142359201 ATGGGAGCACCTGGCTGGCCCGG - Intronic
1049616002 8:143576013-143576035 CTGGGGGCCCCTGCAGGTTCTGG - Intronic
1049671800 8:143873321-143873343 ATCAGGGACCCCGCATGGCCTGG + Intronic
1049706370 8:144045012-144045034 GTGGGGGCCCCTGCGTGCCCTGG + Intronic
1049745272 8:144260578-144260600 ATGGGTGCCCTTGCCTGACCCGG - Intronic
1053129190 9:35605606-35605628 CTGGGGGCCCGGCCATGGCCGGG + Exonic
1053286041 9:36850134-36850156 AACGTGGCCCCTGCATGGCCAGG + Intronic
1056403604 9:86252570-86252592 ATTGGGGCCCCTGGAAGTCCAGG + Intronic
1056756599 9:89385720-89385742 AAGAGGGCCCCTGTCTGGCCGGG - Intronic
1059431465 9:114252903-114252925 ATGGGGACCCCTGGAGAGCCTGG + Exonic
1060054301 9:120400656-120400678 CTGTGGGCCCCTGCTTGGCATGG + Intronic
1060518407 9:124280060-124280082 ATTGGAGCCCCTGCCTGTCCAGG + Intronic
1061059538 9:128243576-128243598 ATGGGGGCCCCTGGAAGGGATGG + Intronic
1061202962 9:129147920-129147942 ATGGCCACCCCGGCATGGCCTGG - Exonic
1061945447 9:133906159-133906181 GTGCTGGCCCCTCCATGGCCTGG + Intronic
1062015248 9:134287987-134288009 ATGGGGGTCCCTGCCTGCCCGGG - Intergenic
1062039761 9:134398867-134398889 TTTGGGCTCCCTGCATGGCCCGG + Intronic
1062258658 9:135645337-135645359 GTAGGGGCCCCTGAATGGACAGG - Intergenic
1062287517 9:135779609-135779631 GTGGGGGGCCCAGCATGGACAGG + Intronic
1062363628 9:136198848-136198870 TTGGGGGCCCCCGCAGAGCCGGG - Intronic
1062712778 9:137985786-137985808 ATGGGGACCCGTGCATGAGCAGG + Intronic
1203519427 Un_GL000213v1:32557-32579 AAGAGGGCCCCTCCATGGCCTGG + Intergenic
1192856539 X:75018176-75018198 ATGGAAACCCCTGGATGGCCAGG - Intergenic
1193709024 X:84857029-84857051 GTGGGAGCCCCTTCATGGGCTGG - Intergenic
1195554498 X:106206342-106206364 ATGGGGGCTGCAGCATGCCCTGG + Exonic
1197331240 X:125155887-125155909 GTGGGGGCCCCTTCCTGGGCTGG - Intergenic
1199798842 X:151229671-151229693 GTGGGAGGACCTGCATGGCCAGG + Intergenic
1200251386 X:154556096-154556118 ATGTGGGCCCAGGCAGGGCCCGG + Intronic
1200266381 X:154648320-154648342 ATGTGGGCCCAGGCAGGGCCCGG - Intergenic
1200475229 Y:3634047-3634069 ATGGGGGTCACTGCAAGGTCAGG + Intergenic