ID: 1023054774

View in Genome Browser
Species Human (GRCh38)
Location 7:36282819-36282841
Sequence GCAGTATTGTGGGCCCAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023054769_1023054774 -9 Left 1023054769 7:36282805-36282827 CCAGTTGTTACCCTGCAGTATTG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1023054774 7:36282819-36282841 GCAGTATTGTGGGCCCAATGTGG 0: 1
1: 0
2: 0
3: 7
4: 93
1023054766_1023054774 24 Left 1023054766 7:36282772-36282794 CCTGGCTCTGGCTGCTGCTGGGT 0: 2
1: 0
2: 8
3: 85
4: 616
Right 1023054774 7:36282819-36282841 GCAGTATTGTGGGCCCAATGTGG 0: 1
1: 0
2: 0
3: 7
4: 93
1023054768_1023054774 -8 Left 1023054768 7:36282804-36282826 CCCAGTTGTTACCCTGCAGTATT 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1023054774 7:36282819-36282841 GCAGTATTGTGGGCCCAATGTGG 0: 1
1: 0
2: 0
3: 7
4: 93
1023054767_1023054774 1 Left 1023054767 7:36282795-36282817 CCATGTCTACCCAGTTGTTACCC 0: 1
1: 0
2: 1
3: 10
4: 115
Right 1023054774 7:36282819-36282841 GCAGTATTGTGGGCCCAATGTGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023054774 Original CRISPR GCAGTATTGTGGGCCCAATG TGG Intronic
908742230 1:67341056-67341078 CCAGAATTGTGGGCCCAAGAAGG + Intronic
913558716 1:119996832-119996854 GGAGTTTTATGGGCCCACTGTGG - Intronic
913639130 1:120793639-120793661 GGAGTTTTATGGGCCCACTGTGG + Intergenic
914279322 1:146156315-146156337 GGAGTTTTATGGGCCCACTGTGG - Intronic
914312794 1:146482209-146482231 GCAGCAGTGAGGGCCCAAGGGGG + Intergenic
914501554 1:148251164-148251186 GCAGCAGTGAGGGCCCAAGGGGG - Intergenic
914540366 1:148607245-148607267 GGAGTTTTATGGGCCCACTGTGG - Intronic
914626279 1:149463969-149463991 GGAGTTTTATGGGCCCACTGTGG + Intergenic
1062817056 10:508467-508489 GCAGTATGCTGGGCCGGATGCGG - Intronic
1067209044 10:44243204-44243226 GCAGAAATGTGAGCACAATGAGG - Intergenic
1075723946 10:124602355-124602377 GCAGAGGTGTGGGCCCATTGTGG + Intronic
1077439349 11:2560724-2560746 GCAGGATTTTGGGCACAAGGTGG + Intronic
1077500080 11:2905384-2905406 GCAGCAGTGTGGGGTCAATGGGG + Intronic
1078339034 11:10486010-10486032 GTAGCATAGTGAGCCCAATGTGG + Intronic
1079314359 11:19395277-19395299 GCAGATGTGTGGGCCCAATGAGG - Intronic
1079616418 11:22498906-22498928 GCACTATTCTAGGCCAAATGTGG - Intergenic
1087967442 11:104435022-104435044 GCAGTATTTTTGGCTGAATGAGG - Intergenic
1091072360 11:132579765-132579787 GCAGTCTAATGGGCCCAGTGAGG + Intronic
1096237657 12:49940611-49940633 GCAGTATTCTGGGCAGTATGAGG + Intergenic
1098320883 12:69241673-69241695 TTAGTTTTGTGGACCCAATGAGG + Intronic
1100691155 12:97039676-97039698 TCACTAGTGTGGGCCCCATGGGG - Intergenic
1101333047 12:103772653-103772675 GCTGTAATGTGGCCACAATGAGG + Exonic
1102324484 12:111968216-111968238 GCACTATTGTTGGCACCATGTGG - Intronic
1103137713 12:118522081-118522103 GCAGTATTGGGGCCCCTCTGGGG + Intergenic
1105077020 13:16043523-16043545 GGAATATTGTGAGCCCATTGAGG + Intergenic
1108698098 13:52920607-52920629 GCAGGATTGTGGGTGAAATGTGG + Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114149057 14:20014671-20014693 GCCTTACTGTGGCCCCAATGAGG - Exonic
1114157170 14:20117997-20118019 GCCCTTTTGTGGTCCCAATGTGG + Exonic
1114323937 14:21570222-21570244 GCCCTACTGTGGGCCCAATCAGG - Exonic
1114327313 14:21602292-21602314 GCCCTACTGTGGGCCCAATCAGG - Intergenic
1114330710 14:21634308-21634330 GCCCTACTGTGGGCCCAATCAGG - Exonic
1115879287 14:37896773-37896795 GAAGTATTGTGAGGGCAATGAGG + Intronic
1125734964 15:41918560-41918582 CCAGGAGTGTGTGCCCAATGGGG - Intronic
1127216078 15:56824265-56824287 GCAGCACTGTGGGCTCACTGGGG + Intronic
1128984201 15:72207453-72207475 GCAGAATTGTTGGCCCACTCTGG - Intronic
1134815840 16:17205239-17205261 GCAGCATTGTGGGTCAAACGAGG + Intronic
1135886702 16:26316642-26316664 ACAGCAATGTGGGCCCAGTGTGG + Intergenic
1138382803 16:56615221-56615243 GCAATAATTTGGCCCCAATGTGG - Intergenic
1140171689 16:72611311-72611333 ACAGTATTGGGGTCCAAATGAGG + Intergenic
1141156585 16:81601386-81601408 CCAGCATCGGGGGCCCAATGGGG + Intronic
1141399822 16:83737841-83737863 GCAGAAGTGTGGTTCCAATGTGG - Intronic
1143184809 17:5003723-5003745 GCAGTGTTGTGGGCTGTATGTGG + Intronic
1143481870 17:7231973-7231995 GCAGAATTTTGTGCCCAGTGAGG - Intronic
1145719015 17:27050443-27050465 GCTGCATTGTGGGCCCAAGCTGG - Intergenic
1147019528 17:37520456-37520478 GCAGTAAAGTGGGCCAGATGAGG + Intronic
1150409285 17:64929962-64929984 GCAGTATTCTGGGCCCTACATGG - Intergenic
1150566013 17:66340859-66340881 GAAGTCCTGTGGGCCCAAGGAGG + Intronic
1155357464 18:24967192-24967214 GCCCTATTCTGGGGCCAATGGGG - Intergenic
1167134240 19:47608028-47608050 GCAGTGCTGGGGGCCCAGTGGGG - Intergenic
1168554411 19:57326156-57326178 ACAGTCTTTGGGGCCCAATGAGG + Intronic
925179657 2:1808779-1808801 GCAGAAATGTGGGCACACTGGGG + Intronic
927455253 2:23243144-23243166 AGAGCATTGTGGCCCCAATGTGG + Intergenic
927662624 2:25005754-25005776 GCAGTATTTTGGGCCGGGTGCGG + Intergenic
929196432 2:39189592-39189614 GCAGGAGTGTGGGCCAAATCTGG + Intronic
933051866 2:77611070-77611092 GCTGCATTGTGGGCCCAAGCTGG - Intergenic
944454546 2:199879456-199879478 GCATCACTGTGGGCCCAATCAGG + Intergenic
945818756 2:214637151-214637173 GAAGTAATGTGACCCCAATGCGG - Intergenic
947771740 2:232675719-232675741 GAAGAATTGTGGGTCCAATAAGG + Intronic
1171856197 20:30345591-30345613 GGAGGATTGTGGGGCCAAGGAGG + Intergenic
1173919955 20:46736766-46736788 GTAGGAATGTGGGCCCAATGTGG + Intergenic
1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG + Intergenic
1176532196 21:7979188-7979210 GGAATATTGTGAGCCCATTGAGG - Intergenic
1176532407 21:7983271-7983293 GGAATATTGTGAGCCCATTGAGG - Intergenic
1176804366 21:13464953-13464975 GCTGGATTGTGGGCCCAAGCTGG - Intergenic
1176960854 21:15157404-15157426 GCAGCATGGAGGGCCCAATGAGG + Intergenic
1179275288 21:39886198-39886220 GCAGTATGGTGGGCTGAATTGGG - Intronic
1181468488 22:23123564-23123586 GCAGAAATGTGGGGCCAAGGAGG - Exonic
1182814941 22:33153972-33153994 GCAGAAATCTGGGACCAATGTGG + Intergenic
1185096330 22:48808034-48808056 GCAGCATGGTAGGTCCAATGGGG + Intronic
950672974 3:14538210-14538232 GCAGTCTTCTGTGCCAAATGTGG + Intronic
955158049 3:56436700-56436722 GGAGTCTTGTTGGACCAATGTGG - Intronic
958729586 3:97947378-97947400 GCAGTACTGTGAGGACAATGTGG + Exonic
964668315 3:159197796-159197818 GTGGTACTGTGGACCCAATGTGG + Intronic
977321720 4:95524555-95524577 GCAGGAATATGGGCCCAATATGG - Intronic
978721931 4:111920376-111920398 GCAGTTTTGGGGGGCCAAAGAGG - Intergenic
987031352 5:13979523-13979545 GTAGTATTGTGGGACCAAGGAGG - Intergenic
1000447685 5:161344378-161344400 GCAGTATTCTTAGCCTAATGAGG - Intronic
1006523992 6:34588536-34588558 GCAGCAGTCTGGGCCTAATGAGG + Exonic
1008892149 6:56507407-56507429 GCTGTAGTGTGGGCCCCTTGAGG - Intronic
1010465965 6:76166751-76166773 GCTGCCTTGTGGGCCCAAGGTGG - Intergenic
1013781602 6:113734375-113734397 GCACTTTTGTGAGCCCAAGGCGG - Intergenic
1015314685 6:131805406-131805428 ACAGGATTGTGTGCCCAGTGTGG - Intergenic
1018616611 6:165692512-165692534 GGAGTAAAATGGGCCCAATGTGG - Intronic
1019840258 7:3434847-3434869 TCAGTTTTCTGGGCTCAATGAGG - Intronic
1023054774 7:36282819-36282841 GCAGTATTGTGGGCCCAATGTGG + Intronic
1024944801 7:54797880-54797902 GAAGTATTGTGGGCACAAAAAGG + Intergenic
1027224305 7:76234394-76234416 ATAGTCTTGTGGGCCCAATCTGG + Intronic
1028529854 7:91826634-91826656 GTAGCATAGTGGGCCCACTGGGG - Intronic
1048732137 8:137454492-137454514 GCAGAATGATGGGCCCAAAGGGG - Intergenic
1051594129 9:18807010-18807032 GCTGTACTGTGGGTACAATGAGG + Intronic
1053793795 9:41706228-41706250 GGAGGATTGTGGGGCCAAGGAGG + Intergenic
1054182204 9:61918241-61918263 GGAGGATTGTGGGGCCAAGGAGG + Intergenic
1054471153 9:65539741-65539763 GGAGGATTGTGGGGCCAAGGAGG - Intergenic
1055413559 9:76058094-76058116 GCAGTTTTTTGGGGCCAATGTGG - Intronic
1186439470 X:9573617-9573639 GAGGTATTGTGGGGCAAATGAGG - Intronic
1192082557 X:68062509-68062531 GCAGTGCAGTGGGCCCAATCGGG + Intronic
1193425442 X:81336808-81336830 GCTGCATTGTAGGCCCAAGGTGG + Intergenic
1193912988 X:87328040-87328062 GCTGCATTGTGGGCCCAAGGTGG - Intergenic
1194052877 X:89093819-89093841 GCAGTATTATGGGCCTTGTGAGG + Intergenic
1196155220 X:112420811-112420833 ACAGTTCTGTGGGCCCTATGTGG - Intergenic