ID: 1023054881

View in Genome Browser
Species Human (GRCh38)
Location 7:36283387-36283409
Sequence GGCCATCGGGGAGCCCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023054868_1023054881 3 Left 1023054868 7:36283361-36283383 CCCCACCGCAGAGGCTTCCCCTC 0: 1
1: 0
2: 1
3: 23
4: 204
Right 1023054881 7:36283387-36283409 GGCCATCGGGGAGCCCCTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 239
1023054870_1023054881 1 Left 1023054870 7:36283363-36283385 CCACCGCAGAGGCTTCCCCTCCA 0: 1
1: 0
2: 2
3: 23
4: 258
Right 1023054881 7:36283387-36283409 GGCCATCGGGGAGCCCCTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 239
1023054869_1023054881 2 Left 1023054869 7:36283362-36283384 CCCACCGCAGAGGCTTCCCCTCC 0: 1
1: 0
2: 0
3: 21
4: 208
Right 1023054881 7:36283387-36283409 GGCCATCGGGGAGCCCCTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 239
1023054872_1023054881 -2 Left 1023054872 7:36283366-36283388 CCGCAGAGGCTTCCCCTCCAGGG 0: 1
1: 0
2: 5
3: 49
4: 312
Right 1023054881 7:36283387-36283409 GGCCATCGGGGAGCCCCTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023054881 Original CRISPR GGCCATCGGGGAGCCCCTGA AGG Intronic
901407133 1:9056877-9056899 GGCCCTCGGGCAGACCCGGAAGG - Intronic
902074825 1:13775923-13775945 GGACAGTGGGGAGCCACTGAAGG - Intronic
902082335 1:13829487-13829509 GCCCATCGGGGACCAGCTGAAGG - Intergenic
902174481 1:14638949-14638971 GGACAACAGGGAGCCACTGAAGG - Intronic
903342311 1:22662119-22662141 GGGCAGTGGGGAGCCACTGAAGG - Intergenic
903350679 1:22714613-22714635 GGGCAGCAGGGAGCCCTTGAAGG + Intronic
903440926 1:23387347-23387369 GGCCATCCGTGAGCACCAGATGG - Exonic
904045935 1:27608273-27608295 GGACAATGGGGAGCCACTGAAGG - Intergenic
904587683 1:31589001-31589023 GGCCGGCGGGGAGCCCCGAAGGG + Intergenic
905249464 1:36638695-36638717 GGCCATCTGGTATCCCCTGCAGG + Intergenic
912704970 1:111904883-111904905 GGCCAGCTGGGAGCCCCCGAGGG - Intronic
913222321 1:116668917-116668939 GACCATTGGGAAGCCACTGAAGG + Intergenic
913965206 1:143371045-143371067 GGGCAGTGGGGAGCCACTGAAGG + Intergenic
914059582 1:144196647-144196669 GGGCAGTGGGGAGCCACTGAAGG + Intergenic
914119568 1:144769724-144769746 GGGCAGTGGGGAGCCACTGAAGG - Intergenic
915980312 1:160416131-160416153 GGCTCCCGGGGAGCCCCTGCTGG + Exonic
916067436 1:161147714-161147736 GTGCATCGGAGAACCCCTGAAGG - Intergenic
916890677 1:169109380-169109402 GGCTAGTGGGGAGCCCCTGGTGG + Intronic
917924176 1:179775125-179775147 GGCCAATGGGGAGCCTCTGGGGG - Intronic
922686019 1:227639291-227639313 GGCCAGCAGGGGGCCCCTGATGG + Intronic
922790646 1:228309109-228309131 GACCATCCTGGAGCCCCTGCAGG + Exonic
923256199 1:232223607-232223629 GGGCACTGGGGAGCCACTGAAGG + Intergenic
1063125377 10:3132379-3132401 GTCCAACGTGGAGCACCTGACGG + Exonic
1066928612 10:41728853-41728875 GGACATTTGGGAGCCCATGAAGG + Intergenic
1067136111 10:43608569-43608591 GCTCATCCGGGAACCCCTGAGGG - Intronic
1069901844 10:71710920-71710942 GGGCAGCAGGGAGCCCTTGAGGG + Intronic
1070794893 10:79210751-79210773 GGGCAATGGGGAGCCCTTGAAGG + Intronic
1071397976 10:85241792-85241814 GGCCATAAGGCAGCCCATGAGGG - Intergenic
1071498064 10:86182212-86182234 GGCCACTGGGCAGCCCCTCAGGG - Intronic
1073662295 10:105489846-105489868 GGTCATTGAAGAGCCCCTGAAGG + Intergenic
1074469649 10:113715399-113715421 GGCCAGCAGGGACACCCTGAAGG + Intronic
1074855745 10:117472140-117472162 GGGCAATGGGGAGCCACTGAAGG + Intergenic
1075526315 10:123190086-123190108 GGTCATCATGGAGCTCCTGAAGG - Intergenic
1076935568 10:133566160-133566182 GGCCACCGTGGAGGCCCGGAGGG + Intronic
1077044308 11:537711-537733 AGCCATCGGGGACCCAGTGATGG + Intronic
1077094061 11:791941-791963 GGGCATCGCGGAGTCCCTGCTGG - Exonic
1077108724 11:852937-852959 GGGCATGGGGGAGCCCCAGTGGG + Intronic
1077342692 11:2033070-2033092 GCCCATCAGGGAGCCCCAGCAGG + Intergenic
1077497799 11:2894926-2894948 GCCCACCCGGAAGCCCCTGAAGG - Intronic
1077501669 11:2912277-2912299 TGCCTTCGGTGAGCCCCCGAGGG - Intronic
1077558234 11:3237861-3237883 GGCCATAGGGGTCCCACTGAGGG - Intergenic
1077866292 11:6224202-6224224 GGCCCTCGGGCAGCTCCTGGGGG - Exonic
1077889150 11:6406088-6406110 GGCCATCTGGGAGGCCCTTCTGG + Intronic
1083214577 11:61210394-61210416 GGAGACCGGGGAGGCCCTGAAGG - Intronic
1083217461 11:61229223-61229245 GGAGACCGGGGAGGCCCTGAAGG - Intronic
1084070958 11:66734336-66734358 GGGCAGTGGGGAGCCACTGAAGG - Intergenic
1084538922 11:69774778-69774800 GGCCGTCGGGGAGCGCCTGGAGG + Exonic
1085207917 11:74748162-74748184 AGCAATCTGGGAGCTCCTGAGGG + Intergenic
1088738124 11:112745437-112745459 GGGCAGCGGGGAGCTCTTGAAGG + Intergenic
1090855007 11:130603256-130603278 CGCCATCTGGCAGCTCCTGAAGG + Intergenic
1202815593 11_KI270721v1_random:45229-45251 GGCCAATGGGGAGCCCCTCGGGG + Intergenic
1202825678 11_KI270721v1_random:88259-88281 GCCCATCAGGGAGCCCCAGCAGG + Intergenic
1091937478 12:4445258-4445280 GGCCGTCGGGGAGCACCTGGAGG + Exonic
1095388914 12:41682061-41682083 GGCCTTCAGGGAGCCCCTGCTGG - Intergenic
1096224127 12:49853993-49854015 GGACACCGGGGAGCCTTTGAGGG - Intergenic
1097971939 12:65642539-65642561 GGCCAATGGGGAGTCACTGAAGG + Intergenic
1101726008 12:107388642-107388664 AGCCATCCTGGAGCCCTTGAAGG + Intronic
1101837004 12:108302900-108302922 GGACTTCTGGGGGCCCCTGATGG + Intronic
1102567891 12:113808979-113809001 GGGCAGCAGAGAGCCCCTGAAGG - Intergenic
1102959741 12:117084877-117084899 GGCCTTGGGGGTGCCCCTCAGGG - Intronic
1103596889 12:122029645-122029667 GGCCACCAAGGAGCCACTGATGG - Intronic
1104771278 12:131366333-131366355 GGTCATCAGGGAGCACGTGAGGG - Intergenic
1105681739 13:22735651-22735673 GGCGAGGGGGGAGCGCCTGAAGG + Intergenic
1105841917 13:24261087-24261109 GGGCAACTGGGAGCCACTGAGGG + Intronic
1106080563 13:26497204-26497226 GGGCAATGGGGAGCCACTGAGGG - Intergenic
1113800301 13:113082918-113082940 GGCCTTCGGTGACCCCCTAAAGG - Intronic
1116958107 14:50944385-50944407 AGCCATGGCGAAGCCCCTGACGG - Exonic
1117985064 14:61379016-61379038 GGGCAATGGGGAGCCACTGAGGG - Intronic
1119807004 14:77488742-77488764 GGCGAGGGGGGTGCCCCTGATGG - Intronic
1120224823 14:81778881-81778903 GGGCAATGGGGAGCCACTGAAGG - Intergenic
1120802395 14:88705806-88705828 GGTCATTGGGGAGCCAGTGAAGG - Intronic
1121970896 14:98354886-98354908 GGCCATGGGGGAGCCAAGGAGGG + Intergenic
1122852988 14:104546753-104546775 GGCCCTCCGGGCGCCGCTGAAGG - Intronic
1122934608 14:104950165-104950187 GTCCATCTGGGGGCCCTTGAGGG + Exonic
1123791446 15:23724464-23724486 GGACAGTGGGAAGCCCCTGAGGG - Intergenic
1126711351 15:51460348-51460370 AGCCATAGGGGAGTCCCTGGAGG - Intronic
1128546835 15:68574055-68574077 GGACACCAGGGAGCCCCTGATGG + Intergenic
1129229530 15:74189088-74189110 GGCCTCCAGGGAGCCCCTGAGGG - Intronic
1132469235 16:92710-92732 GGCCAGCGGGGAGTACCTGCAGG + Exonic
1132580417 16:682260-682282 GGACATCGAGGAGCACCTGCAGG + Exonic
1132698476 16:1212304-1212326 GGCCGTCGGGGAGCCCGCCATGG + Intronic
1132882108 16:2167065-2167087 GGCCCCTGGAGAGCCCCTGAGGG - Intronic
1134026525 16:10958240-10958262 TGCCCTGGGGGAGTCCCTGAGGG + Intronic
1135742929 16:24992143-24992165 GGGCAACAGGGAGCCACTGATGG + Intronic
1138096884 16:54218854-54218876 GGTCAGTGGGGAGCCTCTGAAGG + Intergenic
1141365116 16:83435423-83435445 GGGCAACGGGGAGCCACAGAAGG - Intronic
1142253678 16:89003709-89003731 TGCCAGCTGGGTGCCCCTGATGG - Intergenic
1142376199 16:89708284-89708306 TGCCTTCGGGCAGCCCCTGTGGG - Intronic
1142501674 17:336578-336600 GGGCAACGGGGAGCCCCAGCAGG - Intronic
1142592090 17:1010714-1010736 GGGCATCGGTGAGGCCCTGAGGG - Exonic
1142746818 17:1963511-1963533 AGGCAGCAGGGAGCCCCTGAAGG - Intronic
1143245926 17:5485975-5485997 GGGCCTCGGGGAGGCCCAGAGGG - Intronic
1143781480 17:9231778-9231800 AGCCTTCTGGGAGCCCCGGAGGG + Intronic
1147331601 17:39702386-39702408 GGCCTAGGGGGAGCCCCAGAGGG + Intronic
1149982369 17:61321557-61321579 GGCCATCTGGATGCCCCTGCAGG + Intronic
1150195690 17:63296038-63296060 GGGCATCTGAGAGCCCTTGATGG - Intronic
1151455949 17:74225905-74225927 GGCCATCAGGGAGGCCCAGCTGG + Intronic
1151578689 17:74965350-74965372 AGGCAGTGGGGAGCCCCTGAAGG - Intronic
1151654925 17:75491404-75491426 GGCCATCGGTGAGGTCCTCATGG - Exonic
1152111723 17:78360552-78360574 GGCCCTCGGGGAGGCCCGGGTGG - Intergenic
1152612753 17:81323579-81323601 GGCCATCCGGGAGCCACAAAGGG + Intronic
1152873512 17:82772350-82772372 GGCCCTCGGGGAGCTGGTGAGGG + Intronic
1155155004 18:23150583-23150605 GGATATGGGGGAGCCCCGGAGGG + Intronic
1160903574 19:1441222-1441244 GGCCATCAGAGAGCCCATGGAGG - Intergenic
1160946280 19:1645431-1645453 GGGCAGCGGGGAGCCCTGGATGG - Intronic
1161161463 19:2763802-2763824 GCCCAGCGGGCAGCCCTTGAGGG + Intronic
1161619475 19:5290693-5290715 GGCCATGGGATGGCCCCTGAGGG - Intronic
1162151150 19:8646586-8646608 GGGCCTCGGGGAGCCACTGACGG - Intergenic
1162520708 19:11177933-11177955 GGCCCTAGGGGAGTCCCAGAAGG - Intronic
1162584844 19:11552366-11552388 GGCCGATGGGGAGCACCTGAGGG - Intronic
1163126740 19:15248351-15248373 GTCCATGGGGCAGTCCCTGAGGG + Intronic
1164055663 19:21620207-21620229 GACCCTCTGGTAGCCCCTGAAGG + Intergenic
1165793463 19:38505826-38505848 GCCCATCAAGGAGTCCCTGAAGG + Exonic
1166158786 19:40936171-40936193 GGCCATACGGGAGGCCCTGGTGG + Intergenic
1166341560 19:42140439-42140461 GGCCAGCGGGGAGGTCCTGTAGG - Intronic
1166956495 19:46468877-46468899 GCCCTTCCAGGAGCCCCTGAAGG + Intronic
1166956622 19:46469528-46469550 GCCCTTCCAGGAGCCCCTGAAGG - Intronic
1202698984 1_KI270712v1_random:148533-148555 GGGCAGTGGGGAGCCACTGAAGG + Intergenic
925284888 2:2709423-2709445 GGCCAACAGGGAGCCCTGGAAGG + Intergenic
926725429 2:15993872-15993894 GGCCAACGGAGAGCCCCAAAGGG - Intergenic
926784918 2:16509259-16509281 GACCATCCGGGATCTCCTGAGGG - Intergenic
927855462 2:26524921-26524943 GGGCACCTGAGAGCCCCTGAAGG - Intronic
928361413 2:30665013-30665035 GGCCATCGCCGTGCCCCTGAAGG - Intergenic
928695840 2:33849154-33849176 GTACATATGGGAGCCCCTGATGG + Intergenic
932571360 2:72940138-72940160 GGCCAGCGGAGAGCCCCTTGAGG - Intergenic
932571739 2:72941877-72941899 GGCCAGCTGGGAGGCCCAGAGGG - Intergenic
932793162 2:74673410-74673432 GGCTATCAGGGACCCACTGAGGG - Intronic
934169934 2:89532014-89532036 GGGCAGTGGGGAGCCACTGAAGG + Intergenic
934280236 2:91606322-91606344 GGGCAGTGGGGAGCCACTGAAGG + Intergenic
935548844 2:104430383-104430405 GGCCATCGGGCTGACCCCGAGGG + Intergenic
936024157 2:109018497-109018519 AGGCAACGGGGAGCCTCTGAAGG - Intergenic
936083867 2:109453267-109453289 GGCCACAGGGCAGCCCCTGCAGG - Intronic
936091173 2:109502187-109502209 GGCCCTGGGGGTGCCCCGGAAGG + Intronic
937069687 2:119053731-119053753 GCCCATTTGGGACCCCCTGATGG + Intergenic
937220433 2:120340187-120340209 GCCTATCGGGGAGGCACTGAGGG - Intergenic
937667564 2:124504052-124504074 GGCCATCTGAGAGTCCCAGAAGG - Intronic
942004042 2:171679799-171679821 GGCCAACGGGAAGCCCCAGGAGG + Intergenic
943469854 2:188280810-188280832 GGCCAATGGGTAGCCCCAGATGG + Intergenic
944936415 2:204573671-204573693 GGGCATCGGGGACACTCTGATGG - Intronic
948801823 2:240436516-240436538 GGCTTTCGGGGCGCCGCTGACGG + Intronic
1171386180 20:24770724-24770746 GCCCATGGGGTAGCCCTTGAGGG - Intergenic
1172113049 20:32558769-32558791 AGCCCCTGGGGAGCCCCTGAAGG + Intronic
1172116345 20:32575606-32575628 GCCCAGTGGGGAGCCCCTTAAGG + Intronic
1172189735 20:33054686-33054708 GGGCAGCGGGGAGCCACTGAAGG + Intergenic
1173193857 20:40897505-40897527 GGGGTTCAGGGAGCCCCTGAGGG - Intergenic
1173607618 20:44342969-44342991 AGCCATCTGGGAGGACCTGAGGG - Intronic
1173746395 20:45440600-45440622 GGACATGGGGGAGCACCTGTTGG + Intergenic
1173790331 20:45824057-45824079 GGCCTCCGGGGAGCACGTGACGG - Exonic
1174480398 20:50827361-50827383 GGGCATCGGGGACCCTCTGATGG - Intronic
1175890783 20:62314995-62315017 GGCCCTCGCGGTGCCCCTGATGG - Intronic
1176239778 20:64070539-64070561 GGCCATCCGAGAGCACCAGATGG + Exonic
1179805691 21:43835659-43835681 GGCCCACAGGGAGCCCCTGGAGG + Intergenic
1180762527 22:18220959-18220981 GGCCATCCAGGAGTACCTGAAGG + Intergenic
1180773140 22:18403649-18403671 GGCCATCCAGGAGTACCTGAAGG - Intergenic
1180804495 22:18653198-18653220 GGCCATCCAGGAGTACCTGAAGG - Intergenic
1180806255 22:18716212-18716234 GGCCATCCAGGAGTACCTGAAGG + Intergenic
1180843349 22:18969430-18969452 GGCCATGGAGGTGGCCCTGAGGG - Intergenic
1181058124 22:20269305-20269327 GGCCATGGAGGTGGCCCTGAGGG + Intronic
1181217202 22:21341993-21342015 GGCCATCCAGGAGTACCTGAAGG + Intergenic
1181489352 22:23251936-23251958 GGCCATGGAGGAGCTCCAGATGG + Intronic
1181496963 22:23292713-23292735 AGCCCTCAGGGAGCCCCTGAAGG - Intronic
1181514666 22:23403754-23403776 GGCCATGGAGGTGGCCCTGAGGG + Intergenic
1182618985 22:31607999-31608021 TGCCATCTGGGAGGCCCAGAAGG + Exonic
1182712709 22:32332549-32332571 GGCCTTCTGGGAGTCTCTGAGGG + Intergenic
1183471127 22:38007317-38007339 AGCCATAGGGCAGACCCTGAGGG + Intronic
1184596469 22:45517104-45517126 GGCCCTCGGGGTGGCCCAGAGGG - Intronic
1203234972 22_KI270731v1_random:144631-144653 GGCCATCCAGGAGTACCTGAAGG - Intergenic
950398957 3:12755746-12755768 GGCCAGTGGGGAGCCCCACAAGG + Intronic
950666349 3:14497605-14497627 GAGCAGCAGGGAGCCCCTGAAGG + Intronic
952968037 3:38633064-38633086 GCTCATCGGAGAGCCCCTGGAGG - Exonic
953238573 3:41127529-41127551 GTCCATTGGCAAGCCCCTGAAGG - Intergenic
953769836 3:45771571-45771593 AGCCCTAGGGGTGCCCCTGATGG - Intronic
954131404 3:48562961-48562983 GGCCATGTGGGAGCAGCTGAGGG + Exonic
954735016 3:52700088-52700110 GGCCTTAGGAGAGCCTCTGAGGG - Intronic
956265148 3:67388063-67388085 GGCTGTCTGGGATCCCCTGATGG - Intronic
961727986 3:128945399-128945421 GGACATCGCGGTGCCACTGAGGG - Exonic
961824035 3:129589455-129589477 GTCCATCCTGCAGCCCCTGAAGG - Exonic
962891433 3:139676504-139676526 AGCCACCCAGGAGCCCCTGAAGG - Intronic
966861372 3:184232738-184232760 GGCAATGGGGGAGCTCCTGATGG + Intronic
968976938 4:3827017-3827039 GCCCTTCCTGGAGCCCCTGAGGG - Intergenic
969030529 4:4209533-4209555 GGGCAGTGGGGAGCCACTGAAGG - Intronic
969696202 4:8736289-8736311 GGCTATCTGGGAGCCGCGGATGG + Intergenic
971878723 4:32340276-32340298 GGCCATAGGGGTCCCACTGAGGG + Intergenic
974136536 4:57825365-57825387 GGCCATAGGGGTCCCACTGAGGG - Intergenic
979360611 4:119759707-119759729 GACCATCAGGGAGTCACTGAAGG - Intergenic
982856616 4:160390411-160390433 GGCCATCGGGTTGCCAGTGATGG + Intergenic
985644042 5:1076773-1076795 GGCCAACGGGGAGCCCACGTGGG - Exonic
987548509 5:19346235-19346257 GCTCATCAGGGAGCCCCTGTAGG - Intergenic
995831389 5:116359636-116359658 GGCCATTAGGGAGCCCCCCAAGG + Intronic
997588587 5:135059271-135059293 GGACCTCAGGGAGCCCCTGATGG + Intronic
998054914 5:139066152-139066174 GGGCAGCAGGGAGCCACTGAAGG - Intronic
998421129 5:141987432-141987454 GGCCATAGGGGTCCCACTGAGGG - Intronic
999277000 5:150338142-150338164 GGGCAATGGGGAGCCACTGAAGG + Intronic
999319062 5:150602034-150602056 GGCCATCGGGGAGACAGTGGTGG + Intronic
1001041948 5:168342542-168342564 GGACTTCGTGGAGGCCCTGAAGG + Intronic
1001085291 5:168696138-168696160 GGCCTTTGGGGAGCCCCTCTTGG + Intronic
1001526600 5:172433579-172433601 GGCCACCAAGGAGCCCCTGCCGG + Intronic
1001543181 5:172553377-172553399 GGGCAGTGGGGAGCCACTGAAGG + Intergenic
1002026011 5:176396780-176396802 GGGCAGTGGGGAGCCACTGAAGG - Intronic
1003241209 6:4347191-4347213 GGCCATTGGCTGGCCCCTGAGGG - Intergenic
1003645679 6:7911119-7911141 GGCCAGCGGGAAGCCACGGAGGG + Intronic
1006458459 6:34144854-34144876 GGCTTTCCGGGTGCCCCTGAGGG - Intronic
1006500854 6:34457990-34458012 GGCCTTCCTGGGGCCCCTGAGGG - Intergenic
1006588097 6:35132054-35132076 GGTGATGGGGGAGCCCCCGAAGG - Intronic
1006674498 6:35752477-35752499 TGGCAATGGGGAGCCCCTGAAGG - Intergenic
1007393997 6:41566916-41566938 GGCCATGGAGGAGCACATGAGGG - Intronic
1010705971 6:79111174-79111196 GTCCAGTGGGGAGCCCCTGAAGG + Intergenic
1011655968 6:89552357-89552379 GGCCATCAGGGAGGCCCTGAGGG - Intronic
1014747212 6:125214175-125214197 GGCCAATGGGAAGCCCCTGCAGG - Intronic
1017838813 6:158204821-158204843 GGCCATGAGGGAGCCACTGTGGG + Intergenic
1017873109 6:158502830-158502852 GGCCAACGGGGAGGCGCTGGCGG - Exonic
1018640364 6:165898968-165898990 GGCCTTCGGGGACCCCATCAAGG + Intronic
1018687823 6:166317525-166317547 GGCCATCGTGGAGGCTGTGAAGG - Intergenic
1018948874 6:168365453-168365475 GGCCAAGGCCGAGCCCCTGAGGG - Intergenic
1019476219 7:1245696-1245718 GGCCAGGGAGGAGCCCCAGAGGG + Intergenic
1019579191 7:1751635-1751657 GGACATCAGGGAGCCCGTGATGG + Intergenic
1019599474 7:1874079-1874101 GGCCACCGGGGATCCCGGGACGG + Intronic
1020007585 7:4790678-4790700 GGCCATCGGCGAGTACCTGTCGG + Exonic
1022637452 7:32150382-32150404 GGCCAGAGGGGAGCCCAGGAGGG - Intronic
1022715254 7:32892242-32892264 GGTCATGGGAGAGCCCTTGAGGG + Intronic
1023054881 7:36283387-36283409 GGCCATCGGGGAGCCCCTGAAGG + Intronic
1025752818 7:64307836-64307858 GGCCTTTTGGGAGCCCATGATGG + Intronic
1025998791 7:66545197-66545219 GGCCAGCTGGGGGCTCCTGAAGG - Intergenic
1026096854 7:67353329-67353351 GGCTGTCGGGCAGCCCTTGAGGG + Intergenic
1026471068 7:70694446-70694468 GGCTGTCGGGGAGCCCCGGGCGG + Intronic
1027025887 7:74851414-74851436 GGCCACCGGGGAGCAGCCGATGG + Exonic
1027061872 7:75092696-75092718 GGCCACCGGGGAGCAGCCGATGG - Exonic
1028484976 7:91347856-91347878 GGCCAACAGGAAGCCCCTGCTGG - Intergenic
1029599608 7:101556013-101556035 GGGCAGCAGGGAGCCACTGAGGG - Intronic
1032562555 7:132907662-132907684 GGCCATGGGGGGGCCGCTAAAGG + Intronic
1033235861 7:139637268-139637290 GTCCAGTGGGGAGCCCCTGAAGG - Intronic
1033577475 7:142700122-142700144 GACCATGGGGGAGCCACTGAAGG - Intergenic
1034419083 7:150979545-150979567 GGCCATGTGGGGGCTCCTGAGGG + Intergenic
1034957667 7:155344766-155344788 GGCCACGGGGGAGCCCCGGGAGG - Intergenic
1035228019 7:157444245-157444267 GGCCAGCGGGGAGCCCTTTAGGG - Intergenic
1045440410 8:102203095-102203117 GGCTAATGGGGAGCCACTGAAGG + Intergenic
1045568627 8:103347034-103347056 GGCCATCTGGGAATCACTGATGG + Intergenic
1049294080 8:141820809-141820831 GCCCACCAGGGAGCCCCTGGAGG - Intergenic
1051338939 9:16093328-16093350 GGCCTGTGGGAAGCCCCTGAAGG - Intergenic
1052122836 9:24738823-24738845 GGCCATGTGGGAGCCCATGGGGG - Intergenic
1052890968 9:33699950-33699972 GACCATGGGGGAGCCAGTGAAGG - Intergenic
1053423045 9:37992547-37992569 GGGCAACAGGGAGCCACTGAAGG + Intronic
1053557692 9:39154828-39154850 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1053821806 9:41975116-41975138 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1054139422 9:61464123-61464145 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1054608765 9:67212292-67212314 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1058167032 9:101631956-101631978 GGCCATGGGGGAGCCATTGATGG - Intronic
1060270973 9:122141261-122141283 AGCCATTCGTGAGCCCCTGAAGG + Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061099920 9:128484742-128484764 GGCCATCATGGAGCAGCTGAAGG + Exonic
1061425623 9:130496670-130496692 GGCCAAGGAGGAGCCCCTGGAGG + Intronic
1061777125 9:132973083-132973105 GGCTCTCTGGGAGCCCCTGGAGG + Intronic
1062031061 9:134362228-134362250 GGGCACAGGGGAGCCACTGAGGG - Intronic
1062094492 9:134695837-134695859 TGCCATCTGGCAGCCCCTGCAGG - Intronic
1062133492 9:134912843-134912865 GGCCATCGGGGAGGCTGGGAGGG - Intronic
1062231574 9:135484915-135484937 GGCCATCCAGGAGTACCTGAAGG + Exonic
1062524155 9:136971603-136971625 GGCCATGCAGGACCCCCTGAGGG + Exonic
1062587425 9:137255539-137255561 GGCCAACGGCGAGGACCTGAAGG + Exonic
1186173855 X:6904744-6904766 GGCCAATGGGGAGCCCCAGTTGG - Intergenic
1189536142 X:41937127-41937149 GGCCAACGGGAAGCCCCTGTAGG + Intergenic
1192238216 X:69309697-69309719 GGCCATGGTGGAGGCCCTGCAGG - Intergenic
1195766868 X:108305459-108305481 GTCCATGGGGGAGCCATTGAAGG + Intronic
1196709919 X:118752157-118752179 AGCCACCAGGGAGCCACTGAAGG - Intronic
1199743685 X:150758394-150758416 AGCCATCGGGCAGCCACAGAAGG - Intronic