ID: 1023055360

View in Genome Browser
Species Human (GRCh38)
Location 7:36286021-36286043
Sequence AAGCCTCCTAACACCACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023055355_1023055360 29 Left 1023055355 7:36285969-36285991 CCATGGGTTGTATCTGTGGTACT 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1023055360 7:36286021-36286043 AAGCCTCCTAACACCACCCTGGG 0: 1
1: 0
2: 1
3: 16
4: 183
1023055357_1023055360 -8 Left 1023055357 7:36286006-36286028 CCAGGTATCACCTTTAAGCCTCC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1023055360 7:36286021-36286043 AAGCCTCCTAACACCACCCTGGG 0: 1
1: 0
2: 1
3: 16
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023055360 Original CRISPR AAGCCTCCTAACACCACCCT GGG Intronic
901302273 1:8208511-8208533 CAGCTTCCCAACACCAGCCTAGG - Intergenic
902291337 1:15437298-15437320 AAAGCTTCTAACACCAGCCTGGG - Intergenic
902409410 1:16204358-16204380 AATCCTCCAAATACCTCCCTGGG - Intronic
910553668 1:88505345-88505367 ATGCCTCTTCACTCCACCCTGGG + Intergenic
913614630 1:120546151-120546173 AAGGCTCCTGCCACCACACTGGG + Intergenic
914385498 1:147165838-147165860 GAGCCTCCTCACTCCAGCCTGGG - Intronic
914575641 1:148964750-148964772 AAGGCTCCTGCCACCACGCTGGG - Intronic
919913986 1:202128924-202128946 CATCCTCCTACCACCAACCTGGG + Exonic
922488319 1:225994217-225994239 CAGGCTCCTAACACCACACCTGG + Intronic
923659607 1:235946757-235946779 AACCCTGCAAACACAACCCTTGG + Intergenic
1065141822 10:22725683-22725705 AAGCCTCCTACCCCCATCCCAGG - Intergenic
1067930500 10:50556132-50556154 CAGCCTCCTAATACAACTCTCGG + Intronic
1069186487 10:65429496-65429518 GAGCCTCCTAACCCCTCCGTGGG - Intergenic
1069645786 10:69996001-69996023 ATGCCACCTAACTCCAGCCTGGG - Intergenic
1069995113 10:72337079-72337101 AAGCCTCTTAACCCTACACTGGG - Intronic
1070720960 10:78756848-78756870 CAGCCTCCTCATGCCACCCTCGG + Intergenic
1070737230 10:78871599-78871621 AAGCCCCTTAGCTCCACCCTGGG + Intergenic
1072413881 10:95231033-95231055 AAGCCTGCCACCACCACCCTCGG + Intergenic
1072543307 10:96414671-96414693 ATGCCTCGTAACACCTCCCCTGG + Intronic
1075066253 10:119290964-119290986 AATCCTCCTCACTCCATCCTGGG - Intronic
1075258014 10:120940447-120940469 AAGCCTCCTAACAGGCCTCTAGG + Intergenic
1075672194 10:124270370-124270392 ACCCCTCCCAACACCACCCTTGG + Intergenic
1076134065 10:128032622-128032644 AAGCCTCCTCCCGCCACACTGGG - Intronic
1076348634 10:129799058-129799080 AATCCACCTCACTCCACCCTGGG - Intergenic
1078898193 11:15616723-15616745 CAGCCTCCCACCACCACCCCAGG - Intergenic
1079144111 11:17835390-17835412 CTGCCTCTTACCACCACCCTAGG - Intronic
1083752649 11:64769381-64769403 AAGCCTCCTAGCAGAAACCTAGG - Intronic
1084878490 11:72152473-72152495 AAGCCACCTCACTCCAGCCTGGG - Intergenic
1085736718 11:79045483-79045505 AAGCATCCTCAAACCACACTAGG - Intronic
1089753112 11:120665914-120665936 AAACATCCCAAAACCACCCTTGG - Intronic
1091971344 12:4789526-4789548 ATGCCTCCTACTGCCACCCTTGG - Intronic
1098902950 12:76131853-76131875 CACCCTCCCAACACCTCCCTGGG + Intergenic
1100865564 12:98853378-98853400 AAGCCTCTGAACACCACCGAGGG + Intronic
1109106088 13:58252868-58252890 TGGCCTCCCAACACCAGCCTTGG + Intergenic
1111427098 13:88100691-88100713 AACTGTCCTAACACAACCCTGGG + Intergenic
1111661713 13:91220457-91220479 AAGCCACCAAACTCCAGCCTGGG + Intergenic
1112301361 13:98233512-98233534 AACCCTCCTGGCCCCACCCTGGG - Intronic
1112413827 13:99187992-99188014 ACGCCACCTCACACCAGCCTGGG + Intergenic
1114887522 14:26872345-26872367 AAGCTTCCTAACCCCACACGTGG - Intergenic
1119186077 14:72643528-72643550 AAGCCCAGTAACACCACCATAGG - Intronic
1119651434 14:76386853-76386875 AGGTCTCCTAACAGCACCCAGGG + Intronic
1132208520 15:100003118-100003140 CAGCCTCCCAACCCCACCATGGG + Intronic
1132788461 16:1671316-1671338 ACTCCTCCTATCACTACCCTGGG - Intronic
1133339356 16:5026866-5026888 AAACCTCCTGCCCCCACCCTGGG + Intronic
1133556974 16:6915008-6915030 AAGCCGACTTACACCACCCTGGG - Intronic
1135220494 16:20610835-20610857 AAGCCTCCCAGCCACACCCTTGG - Intronic
1136364563 16:29803720-29803742 GAGCCTCCTCACCCCTCCCTGGG - Intronic
1136554125 16:30997720-30997742 CTGGCTCCTAACACCACCCTGGG - Intronic
1137720450 16:50624731-50624753 AGGCCTCCTCACCCCTCCCTGGG - Intronic
1138070062 16:53984040-53984062 CAGGCTCCAAACACCTCCCTTGG - Intronic
1138472496 16:57249287-57249309 AGGCCTCTTAACAGCCCCCTGGG + Intronic
1140772013 16:78213883-78213905 CAGCCTCCTGAAACCGCCCTGGG - Intronic
1140791758 16:78398773-78398795 AAGGATACTAACACCACTCTGGG + Intronic
1140944234 16:79752867-79752889 GAGCCTCCTAAGACCTCCCTGGG - Intergenic
1141622079 16:85241713-85241735 AAGCCCTCCCACACCACCCTAGG - Intergenic
1142242598 16:88954403-88954425 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242633 16:88954517-88954539 AAGGCTCCTGACTCCACCCAAGG + Intronic
1142242659 16:88954612-88954634 AAGGCTCCTGACTCCACCCAAGG + Intronic
1142242691 16:88954726-88954748 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242701 16:88954764-88954786 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242708 16:88954783-88954805 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242725 16:88954840-88954862 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242742 16:88954897-88954919 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242778 16:88955011-88955033 AAGGCTCCTGACTCCACCCAAGG + Intronic
1142242793 16:88955068-88955090 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242803 16:88955106-88955128 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242810 16:88955125-88955147 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242827 16:88955182-88955204 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242844 16:88955239-88955261 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242881 16:88955353-88955375 AAGGCTCCTGACTCCACCCAAGG + Intronic
1142242896 16:88955410-88955432 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242906 16:88955448-88955470 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242913 16:88955467-88955489 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242926 16:88955505-88955527 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242933 16:88955524-88955546 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242946 16:88955562-88955584 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242953 16:88955581-88955603 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242960 16:88955600-88955622 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242973 16:88955638-88955660 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242985 16:88955676-88955698 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242992 16:88955695-88955717 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243003 16:88955733-88955755 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243010 16:88955752-88955774 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243021 16:88955790-88955812 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243038 16:88955847-88955869 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243089 16:88955999-88956021 AAGGCTCCTGACCCCACCCAAGG + Intronic
1143544418 17:7588060-7588082 GAACCTCCTCACCCCACCCTGGG - Exonic
1143734147 17:8898614-8898636 AACCCTCAGAACACCTCCCTGGG - Intronic
1144734240 17:17546115-17546137 GAGCCTCCCCACACCTCCCTGGG + Intronic
1146905820 17:36617313-36617335 AAGCCTCCCAGCACAACCGTGGG - Intergenic
1146918111 17:36691036-36691058 ATCCCTCCTCACACCCCCCTCGG + Intergenic
1147949993 17:44102020-44102042 AAGCCTCCTCTCACAACCCCAGG + Intronic
1147950735 17:44106337-44106359 AAGCCTCCTCTCACAACCCCAGG + Intronic
1149342307 17:55699459-55699481 AAGCCAACTCCCACCACCCTAGG + Intergenic
1153993305 18:10418944-10418966 AAGCCTCCTAACCTCTTCCTGGG + Intergenic
1156833803 18:41528344-41528366 ATCCCTTCTAACACCACCTTGGG + Intergenic
1158616046 18:58987932-58987954 AAGCCTACTCCCACCACCCTAGG - Intergenic
1159427866 18:68312187-68312209 AAGCTTCCTGAGACCACTCTTGG + Intergenic
1162042258 19:7978042-7978064 TAGGCTCCTAAGCCCACCCTGGG + Intronic
1162315248 19:9934849-9934871 ATTCCTCCCAACACCCCCCTCGG + Intronic
1164262356 19:23579166-23579188 AAGCCACTGAACACCAGCCTGGG - Intronic
1166832223 19:45645544-45645566 AAGCCCCCCAACACAATCCTAGG + Exonic
933917641 2:87012235-87012257 AGGCCACCTAACACCAAACTGGG + Intronic
934005355 2:87757682-87757704 AGGCCACCTAACACCAAACTGGG - Intronic
935768313 2:106391769-106391791 ATGCCACCTAACACCAAACTGGG - Intronic
938043009 2:128091420-128091442 AGGCCTCCTCACGCCACCCCTGG - Intronic
942511725 2:176709709-176709731 CAGCCTCCTACCACCTCACTCGG + Intergenic
944124804 2:196281121-196281143 AAGCCTCTTAACATCACATTAGG - Intronic
946365249 2:219245218-219245240 AAGCCTCCTACCTCCAACATTGG + Exonic
948307049 2:236956110-236956132 AAACCTCCTTCCACCACACTAGG - Intergenic
1169455869 20:5751899-5751921 AAGACTTCTAAGACCACCCTTGG - Intronic
1171040366 20:21757096-21757118 AAGCCCCATAAGCCCACCCTTGG - Intergenic
1171960924 20:31493622-31493644 AAGCCTCTGAACACCAACCTTGG + Intergenic
1173990708 20:47300978-47301000 AAACCTCTTAATACCAGCCTGGG - Intronic
1174546190 20:51327067-51327089 AAGCCTCTGCACACCAGCCTGGG - Intergenic
1176135315 20:63519937-63519959 AATCCTCCCCACACCTCCCTCGG - Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1178870464 21:36370087-36370109 CAGCCTCCCACCACCACGCTAGG - Intronic
1181022170 22:20109348-20109370 AAGCCTCCTAAAGCCACCTTGGG + Intronic
1181751225 22:24990562-24990584 AAACCTCATACCACCACCCAGGG - Intronic
1183194254 22:36342664-36342686 AAGACTCCCAAGACCACCCAGGG + Intronic
1183219577 22:36504038-36504060 AACCCTCCTGACCCCTCCCTAGG - Intronic
1184091473 22:42295152-42295174 AAGCCTCCTAACCCCAGCCTGGG + Intronic
1185302460 22:50089718-50089740 ACGACTCCTAACATCACTCTGGG + Intergenic
949897325 3:8777988-8778010 AAGCCTCCACAGACCAGCCTGGG + Intronic
950487245 3:13281074-13281096 ATGCCTCACAACACCACCCTGGG - Intergenic
952593673 3:34988650-34988672 GAGCCTCCCACCACCTCCCTGGG + Intergenic
968536078 4:1130486-1130508 AAGGAGCCAAACACCACCCTAGG - Intergenic
972750057 4:41979748-41979770 AAACCTCCTGACCCCACCATCGG - Intergenic
972834619 4:42854892-42854914 TTGCCTGATAACACCACCCTTGG + Intergenic
975850508 4:78567035-78567057 AAGCCTCCCACCACCACCGCAGG - Intronic
980885900 4:138761905-138761927 AAGTCATCTAACTCCACCCTGGG + Intergenic
982262363 4:153505877-153505899 CAGCCTCCTCACCACACCCTGGG - Intronic
992827388 5:80564403-80564425 GAACCTCCTGACACCAACCTTGG - Intronic
993968887 5:94392346-94392368 AAGTCTACTAACACCACACCAGG + Intronic
994097435 5:95859753-95859775 GAGCCTGCTAATAGCACCCTGGG + Exonic
994105829 5:95947517-95947539 GAGCCTCCTAAAACCAGCCCTGG + Intronic
995152295 5:108863160-108863182 AAGCCTCTTCACTCCAGCCTGGG - Intronic
996004893 5:118407795-118407817 AAGCCTCCAAACACTCCCCTTGG - Intergenic
996873718 5:128218188-128218210 AACCCTCCTACCATTACCCTTGG - Intergenic
998175607 5:139900149-139900171 AGTCCTCCCTACACCACCCTAGG + Intronic
998506729 5:142678435-142678457 AAGGCTGCAAACACCAACCTGGG + Intronic
1001582322 5:172807278-172807300 AAGCCTGCTGAAACCACCCTTGG - Intergenic
1003242365 6:4355686-4355708 AGGCCTTTAAACACCACCCTTGG + Intergenic
1003939638 6:11011321-11011343 ACGCCACCTCACACCAGCCTGGG + Intronic
1006441490 6:34056386-34056408 AGGCCTCCCAACTCCACCCCAGG + Intronic
1011077486 6:83452674-83452696 ATGCCACCTCACTCCACCCTGGG + Intergenic
1015928051 6:138329795-138329817 AAGCCACCTAACATCACATTGGG - Intronic
1016130652 6:140464623-140464645 AAGTCTGCTACCACCATCCTTGG + Intergenic
1018129154 6:160711938-160711960 ATGCCACCTAACACCAAACTGGG - Intronic
1018385113 6:163296057-163296079 GAGTCTCCTAACACCCCCCAGGG - Intronic
1019205457 6:170357866-170357888 CAGCCTCTTCACACCATCCTTGG - Intronic
1019890757 7:3943997-3944019 CAGCCACCTAAAACCAGCCTGGG + Intronic
1022191881 7:28024417-28024439 AATCCTCCTTTCTCCACCCTTGG - Intronic
1022648513 7:32253927-32253949 AAGCCTGAGAACACCATCCTAGG + Intronic
1023055360 7:36286021-36286043 AAGCCTCCTAACACCACCCTGGG + Intronic
1028505486 7:91565996-91566018 AACCCTCCTGAAGCCACCCTAGG + Intergenic
1029234969 7:99107744-99107766 ATGCCACTTAATACCACCCTGGG - Intronic
1030513323 7:110512246-110512268 AAGCTTCCTGAGACCTCCCTAGG - Intergenic
1033063239 7:138127879-138127901 AGGGTTCCTAAGACCACCCTCGG - Intergenic
1033741937 7:144282758-144282780 AAGCCTCCCATCACCTCCTTTGG + Intergenic
1033751965 7:144366856-144366878 AAGCCTCCCATCACCTCCTTTGG - Exonic
1036895957 8:12635688-12635710 AAGCCCCCTAACCCATCCCTAGG + Intergenic
1039162360 8:34636765-34636787 ATGCCTCCTAAAACCACCTTGGG + Intergenic
1040886321 8:52267256-52267278 CACCCTCCTAATACCACTCTTGG - Intronic
1042227267 8:66523556-66523578 AATCCTCCAAACAACACCATGGG + Intergenic
1044041037 8:87368592-87368614 AAGCCACTTCACTCCACCCTGGG + Intronic
1045046656 8:98285380-98285402 AAGCCTGGTAACTCCAGCCTTGG + Intronic
1049917623 9:333768-333790 AAGCTTCCTAACAACTCCTTAGG - Intronic
1051013369 9:12446563-12446585 CAGGCTCCCAACACCACACTCGG - Intergenic
1051193524 9:14538655-14538677 AAGCCTCCTAAAGCCACTCAGGG + Intergenic
1052447987 9:28588831-28588853 CTGCCTCCTATCCCCACCCTTGG + Intronic
1052923883 9:33996925-33996947 AATCCTCCTACCACTACGCTCGG - Intronic
1054965684 9:71024657-71024679 AACCCTCCTAACAAAACCCTAGG - Intronic
1055720293 9:79165682-79165704 TAGCCTCCTAACTCCAACCAAGG + Intergenic
1056206115 9:84320845-84320867 CAGCCTCCCACCACCACCCTCGG - Intronic
1056466474 9:86860691-86860713 AAGCCTGCTATAATCACCCTTGG - Intergenic
1056661810 9:88549226-88549248 AAGCCTCCCAACATCTCCATAGG + Intronic
1057839452 9:98473909-98473931 AGGCCTCATAACACAACCCAGGG + Intronic
1058923078 9:109636465-109636487 AAGCTTCCTAAGACCTCACTAGG + Intergenic
1060176090 9:121498719-121498741 AAGCCTCAAAACACCTGCCTCGG + Intergenic
1060890657 9:127186068-127186090 GAGCCTCCTAACAACAGCCTTGG - Intronic
1061138192 9:128748612-128748634 AAGCCACCGAACTCCAGCCTGGG - Intronic
1062324002 9:136003943-136003965 ATTCCTCCAAACCCCACCCTAGG + Intergenic
1186888378 X:13937751-13937773 CAGCCGCCTTACACCAGCCTCGG + Intronic
1189280681 X:39818533-39818555 AGGGCTCCTAGCTCCACCCTTGG + Intergenic
1199896763 X:152134621-152134643 AAGCCTCCTCATACCACAGTGGG + Exonic
1200686564 Y:6264494-6264516 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200992112 Y:9355743-9355765 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200994764 Y:9376021-9376043 CAGCCGCCTCACACCACCCCCGG - Intronic
1200997428 Y:9396367-9396389 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200999940 Y:9464903-9464925 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201002601 Y:9485213-9485235 CAGCCGCCTCACACCACCCCCGG - Intronic
1201005256 Y:9505497-9505519 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201007917 Y:9525826-9525848 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201010534 Y:9546017-9546039 CAGCCGCCTCACACCACCCCCGG - Intergenic
1202137066 Y:21676751-21676773 GAGCCTCCTACCCCCTCCCTGGG - Intergenic