ID: 1023055578

View in Genome Browser
Species Human (GRCh38)
Location 7:36287299-36287321
Sequence CTATATAAGAAGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023055578 Original CRISPR CTATATAAGAAGGAGGTGGA AGG (reversed) Intronic
900768334 1:4520405-4520427 TCATATAAGGTGGAGGTGGAAGG - Intergenic
900768334 1:4520405-4520427 TCATATAAGGTGGAGGTGGAAGG - Intergenic
903041176 1:20531890-20531912 CCTTATAAGAAGGAGGCAGAAGG + Intergenic
903041176 1:20531890-20531912 CCTTATAAGAAGGAGGCAGAAGG + Intergenic
908242195 1:62196833-62196855 CTTTAGGAGATGGAGGTGGAAGG - Intronic
908242195 1:62196833-62196855 CTTTAGGAGATGGAGGTGGAAGG - Intronic
908610811 1:65858274-65858296 ATTTATAATAAGGAGGTGGCAGG - Intronic
908610811 1:65858274-65858296 ATTTATAATAAGGAGGTGGCAGG - Intronic
912402653 1:109408216-109408238 GTATATAAGATGGTGGGGGACGG - Intronic
912402653 1:109408216-109408238 GTATATAAGATGGTGGGGGACGG - Intronic
912999114 1:114562157-114562179 CTTTTTAAGAGGGAGGTAGAAGG - Intergenic
912999114 1:114562157-114562179 CTTTTTAAGAGGGAGGTAGAAGG - Intergenic
915620215 1:157077664-157077686 GGATAGAAGAAGGAGGAGGAAGG - Intergenic
915620215 1:157077664-157077686 GGATAGAAGAAGGAGGAGGAAGG - Intergenic
916441636 1:164831751-164831773 CAAAATAAGAAGGAAATGGAAGG + Intronic
916441636 1:164831751-164831773 CAAAATAAGAAGGAAATGGAAGG + Intronic
917231282 1:172840612-172840634 ATATATAAGACGGAGGAGGAGGG - Intergenic
917231282 1:172840612-172840634 ATATATAAGACGGAGGAGGAGGG - Intergenic
917943410 1:179945956-179945978 CTATCGAAGGTGGAGGTGGAAGG + Intergenic
917943410 1:179945956-179945978 CTATCGAAGGTGGAGGTGGAAGG + Intergenic
918809611 1:189099289-189099311 CTCAATAAGAAGCAGGTGGTCGG + Intergenic
918809611 1:189099289-189099311 CTCAATAAGAAGCAGGTGGTCGG + Intergenic
919540486 1:198839328-198839350 CCATAGAAGATGAAGGTGGAGGG + Intergenic
919540486 1:198839328-198839350 CCATAGAAGATGAAGGTGGAGGG + Intergenic
919663810 1:200273224-200273246 CTATCTATGGAGGAGGTGAATGG - Intergenic
919663810 1:200273224-200273246 CTATCTATGGAGGAGGTGAATGG - Intergenic
920217911 1:204374599-204374621 CTATAAAAGATGGAAGAGGAGGG - Intronic
920217911 1:204374599-204374621 CTATAAAAGATGGAAGAGGAGGG - Intronic
921514285 1:216070578-216070600 CTCATAAAGAAGGAGGTGGATGG + Intronic
921514285 1:216070578-216070600 CTCATAAAGAAGGAGGTGGATGG + Intronic
921546206 1:216478009-216478031 CTTTATAAGAAGGAGGCAGAGGG + Intergenic
921546206 1:216478009-216478031 CTTTATAAGAAGGAGGCAGAGGG + Intergenic
921691290 1:218153667-218153689 TTATGTAAGATGGAGTTGGAGGG + Intergenic
921691290 1:218153667-218153689 TTATGTAAGATGGAGTTGGAGGG + Intergenic
921829893 1:219715438-219715460 AAATATAAGAAGGAAGTAGAGGG + Intronic
921829893 1:219715438-219715460 AAATATAAGAAGGAAGTAGAGGG + Intronic
921873356 1:220166488-220166510 CATTTTAAAAAGGAGGTGGAAGG + Intronic
921873356 1:220166488-220166510 CATTTTAAAAAGGAGGTGGAAGG + Intronic
923172220 1:231428574-231428596 ATATGGCAGAAGGAGGTGGAAGG + Intergenic
923172220 1:231428574-231428596 ATATGGCAGAAGGAGGTGGAAGG + Intergenic
923611529 1:235499903-235499925 TTATATAGAAAGGAGGTGGTGGG + Intronic
923611529 1:235499903-235499925 TTATATAGAAAGGAGGTGGTGGG + Intronic
1063170809 10:3508448-3508470 TTATGTAAGAGGGAGGTGGGAGG + Intergenic
1063170809 10:3508448-3508470 TTATGTAAGAGGGAGGTGGGAGG + Intergenic
1063186929 10:3660194-3660216 TGATATAAGATGGAGGTGGGAGG + Intergenic
1063186929 10:3660194-3660216 TGATATAAGATGGAGGTGGGAGG + Intergenic
1065069842 10:22011890-22011912 CAATTTTAGAAGGAGGTAGAAGG - Intergenic
1065069842 10:22011890-22011912 CAATTTTAGAAGGAGGTAGAAGG - Intergenic
1065317445 10:24477196-24477218 ATGTATAGGAAGGAGGTGAATGG + Intronic
1065317445 10:24477196-24477218 ATGTATAGGAAGGAGGTGAATGG + Intronic
1066078157 10:31901894-31901916 CTTTATAAGAGAGAGGTAGAGGG - Intronic
1066078157 10:31901894-31901916 CTTTATAAGAGAGAGGTAGAGGG - Intronic
1069489410 10:68848457-68848479 ATATTTAAGAAGGGGGAGGAGGG + Intronic
1069489410 10:68848457-68848479 ATATTTAAGAAGGGGGAGGAGGG + Intronic
1069562572 10:69441226-69441248 CTATAAAAGAACATGGTGGAAGG - Intergenic
1069562572 10:69441226-69441248 CTATAAAAGAACATGGTGGAAGG - Intergenic
1069988082 10:72297818-72297840 CTATTAAGGAAGGGGGTGGAAGG - Intergenic
1069988082 10:72297818-72297840 CTATTAAGGAAGGGGGTGGAAGG - Intergenic
1070525962 10:77296193-77296215 CTTTATAAAAGGGAGGTAGAGGG + Intronic
1070525962 10:77296193-77296215 CTTTATAAAAGGGAGGTAGAGGG + Intronic
1071085127 10:81861420-81861442 CTATGTAAGCAGGAGGTGAGGGG - Intergenic
1071085127 10:81861420-81861442 CTATGTAAGCAGGAGGTGAGGGG - Intergenic
1072139386 10:92576008-92576030 CTCAATAAAGAGGAGGTGGATGG + Intergenic
1072139386 10:92576008-92576030 CTCAATAAAGAGGAGGTGGATGG + Intergenic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1078757100 11:14221686-14221708 ATTGATAAGAAGGAGATGGAGGG - Intronic
1078757100 11:14221686-14221708 ATTGATAAGAAGGAGATGGAGGG - Intronic
1081341038 11:41927915-41927937 TTGTATAAAAAGGAGGTGTAGGG + Intergenic
1081341038 11:41927915-41927937 TTGTATAAAAAGGAGGTGTAGGG + Intergenic
1081706642 11:45185906-45185928 CTTAATAAGAGGGAGGTGGGAGG + Intronic
1081706642 11:45185906-45185928 CTTAATAAGAGGGAGGTGGGAGG + Intronic
1082733698 11:56831760-56831782 AAATACAAGAAGGAGGAGGAAGG + Intergenic
1082733698 11:56831760-56831782 AAATACAAGAAGGAGGAGGAAGG + Intergenic
1083708123 11:64530557-64530579 CCTTCTAAGAGGGAGGTGGAGGG + Intergenic
1083708123 11:64530557-64530579 CCTTCTAAGAGGGAGGTGGAGGG + Intergenic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1085705615 11:78784629-78784651 CAATATAAGAATAAGGTTGACGG - Intronic
1085705615 11:78784629-78784651 CAATATAAGAATAAGGTTGACGG - Intronic
1086374985 11:86190975-86190997 ATGTATAAGAAGCAGGTAGAAGG - Intergenic
1086374985 11:86190975-86190997 ATGTATAAGAAGCAGGTAGAAGG - Intergenic
1087114060 11:94504555-94504577 CTATATAAGAAGGATTTGGTTGG + Intergenic
1087114060 11:94504555-94504577 CTATATAAGAAGGATTTGGTTGG + Intergenic
1088409851 11:109522348-109522370 CTATACAAGCAGGCTGTGGATGG + Intergenic
1088409851 11:109522348-109522370 CTATACAAGCAGGCTGTGGATGG + Intergenic
1088880000 11:113965639-113965661 CTATAAAATACGGTGGTGGATGG + Intergenic
1088880000 11:113965639-113965661 CTATAAAATACGGTGGTGGATGG + Intergenic
1089279183 11:117360913-117360935 CCATATAAGAAGGATGCGGGAGG - Intronic
1089279183 11:117360913-117360935 CCATATAAGAAGGATGCGGGAGG - Intronic
1090334120 11:125951280-125951302 CCATGTAACAAGGAGGTGGGCGG + Intergenic
1090334120 11:125951280-125951302 CCATGTAACAAGGAGGTGGGCGG + Intergenic
1090662889 11:128894350-128894372 CTATTTAGGCTGGAGGTGGAAGG + Intronic
1090662889 11:128894350-128894372 CTATTTAGGCTGGAGGTGGAAGG + Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1092811650 12:12276326-12276348 CTATATCAGAAGGGAATGGAGGG + Intergenic
1092811650 12:12276326-12276348 CTATATCAGAAGGGAATGGAGGG + Intergenic
1094320774 12:29180460-29180482 CTAAACATGAAGGATGTGGATGG - Intronic
1094320774 12:29180460-29180482 CTAAACATGAAGGATGTGGATGG - Intronic
1096635986 12:52959947-52959969 CCTTATAAGAAGGAGGCAGAAGG - Intergenic
1096635986 12:52959947-52959969 CCTTATAAGAAGGAGGCAGAAGG - Intergenic
1097437471 12:59569204-59569226 ATATAGAAGAGGGAGGTTGAAGG - Intergenic
1097437471 12:59569204-59569226 ATATAGAAGAGGGAGGTTGAAGG - Intergenic
1097638441 12:62149903-62149925 CTTTATAAAAGGGAGATGGATGG - Intronic
1097638441 12:62149903-62149925 CTTTATAAAAGGGAGATGGATGG - Intronic
1098501839 12:71202090-71202112 CTTTATGAGAAGGAAGTGGATGG + Intronic
1098501839 12:71202090-71202112 CTTTATGAGAAGGAAGTGGATGG + Intronic
1098965522 12:76783815-76783837 CCATATAAGAGGGAGGTGGAGGG + Intronic
1098965522 12:76783815-76783837 CCATATAAGAGGGAGGTGGAGGG + Intronic
1099217479 12:79870784-79870806 GTATATAAGAAGTATGAGGAAGG - Intronic
1099217479 12:79870784-79870806 GTATATAAGAAGTATGAGGAAGG - Intronic
1099924083 12:88996245-88996267 GTATAGAAGATGGAGCTGGAGGG + Intergenic
1099924083 12:88996245-88996267 GTATAGAAGATGGAGCTGGAGGG + Intergenic
1100939356 12:99708683-99708705 CCTTATAAGAGGGAGGTAGAGGG - Intronic
1100939356 12:99708683-99708705 CCTTATAAGAGGGAGGTAGAGGG - Intronic
1101284724 12:103298986-103299008 CTATATAATCAGGAGGTGAGGGG + Intronic
1101284724 12:103298986-103299008 CTATATAATCAGGAGGTGAGGGG + Intronic
1101846073 12:108364209-108364231 CCATATTAGAATGGGGTGGAGGG - Intergenic
1101846073 12:108364209-108364231 CCATATTAGAATGGGGTGGAGGG - Intergenic
1103237737 12:119387569-119387591 CTATAGAAAAAGGGGGTGGGAGG - Intronic
1103237737 12:119387569-119387591 CTATAGAAAAAGGGGGTGGGAGG - Intronic
1103951359 12:124553205-124553227 CTTTATAAGAAGGAGGCAGGAGG - Intronic
1103951359 12:124553205-124553227 CTTTATAAGAAGGAGGCAGGAGG - Intronic
1104289074 12:127451984-127452006 CATTATAAGAAGGAGGCAGAAGG - Intergenic
1104289074 12:127451984-127452006 CATTATAAGAAGGAGGCAGAAGG - Intergenic
1106074336 13:26444586-26444608 CCTTATAAGAGAGAGGTGGAAGG + Intergenic
1106074336 13:26444586-26444608 CCTTATAAGAGAGAGGTGGAAGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107512639 13:41099915-41099937 CTATATAAGAAAAACGTGGCTGG - Intergenic
1107512639 13:41099915-41099937 CTATATAAGAAAAACGTGGCTGG - Intergenic
1107850420 13:44566910-44566932 CTATATAAGTGGGATGTGGGGGG + Intronic
1107850420 13:44566910-44566932 CTATATAAGTGGGATGTGGGGGG + Intronic
1108278255 13:48833817-48833839 CAACATAAGAGGGAGGTGAAAGG - Intergenic
1108278255 13:48833817-48833839 CAACATAAGAGGGAGGTGAAAGG - Intergenic
1108787296 13:53920669-53920691 ATATACCTGAAGGAGGTGGACGG - Intergenic
1108787296 13:53920669-53920691 ATATACCTGAAGGAGGTGGACGG - Intergenic
1109210759 13:59533171-59533193 TTTTATTGGAAGGAGGTGGATGG - Intergenic
1109210759 13:59533171-59533193 TTTTATTGGAAGGAGGTGGATGG - Intergenic
1109577944 13:64286367-64286389 CTAAAAGAGAAGGAGGTTGAAGG + Intergenic
1109577944 13:64286367-64286389 CTAAAAGAGAAGGAGGTTGAAGG + Intergenic
1109907174 13:68858982-68859004 GTAATTAAGAAGGGGGTGGACGG + Intergenic
1109907174 13:68858982-68859004 GTAATTAAGAAGGGGGTGGACGG + Intergenic
1110758290 13:79201604-79201626 CTATATAAGAAGGAGCAGGGAGG - Intergenic
1110758290 13:79201604-79201626 CTATATAAGAAGGAGCAGGGAGG - Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113014950 13:105818209-105818231 CTAAACAAGACGGAGGTGGCAGG + Intergenic
1113014950 13:105818209-105818231 CTAAACAAGACGGAGGTGGCAGG + Intergenic
1115373345 14:32644606-32644628 CTGTATAACAAGGCCGTGGATGG + Intronic
1115373345 14:32644606-32644628 CTGTATAACAAGGCCGTGGATGG + Intronic
1116176592 14:41478802-41478824 CTAAAGAAGAATAAGGTGGAAGG - Intergenic
1116176592 14:41478802-41478824 CTAAAGAAGAATAAGGTGGAAGG - Intergenic
1117229799 14:53705107-53705129 TTAAATAAGAAGGAGGGGGAGGG + Intergenic
1117229799 14:53705107-53705129 TTAAATAAGAAGGAGGGGGAGGG + Intergenic
1117412367 14:55461892-55461914 CTATATAAGAAAGAGAAGGTGGG - Intergenic
1117412367 14:55461892-55461914 CTATATAAGAAAGAGAAGGTGGG - Intergenic
1119654756 14:76409318-76409340 CTAAATGGGAAGGAGTTGGAGGG + Intronic
1119654756 14:76409318-76409340 CTAAATGGGAAGGAGTTGGAGGG + Intronic
1120104506 14:80479228-80479250 ACATGTAAAAAGGAGGTGGAGGG + Intronic
1120104506 14:80479228-80479250 ACATGTAAAAAGGAGGTGGAGGG + Intronic
1121329167 14:93039266-93039288 CTGTAGAACAAGGAGGTGGGGGG - Intronic
1121329167 14:93039266-93039288 CTGTAGAACAAGGAGGTGGGGGG - Intronic
1121736938 14:96225324-96225346 CTCTATAGCAAAGAGGTGGAAGG - Intronic
1121736938 14:96225324-96225346 CTCTATAGCAAAGAGGTGGAAGG - Intronic
1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG + Intergenic
1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG + Intergenic
1122785537 14:104161741-104161763 CTATAGAAGCAGGAGGCGCAGGG + Intronic
1122785537 14:104161741-104161763 CTATAGAAGCAGGAGGCGCAGGG + Intronic
1125749455 15:42018872-42018894 CTATAAAAGTAGGAGTGGGAAGG - Intronic
1125749455 15:42018872-42018894 CTATAAAAGTAGGAGTGGGAAGG - Intronic
1126706546 15:51411219-51411241 CTTTATAAGCTGGAGGTGTAAGG - Intergenic
1126706546 15:51411219-51411241 CTTTATAAGCTGGAGGTGTAAGG - Intergenic
1127887472 15:63214954-63214976 CTCCATAAGAATGAGGTGGAAGG - Intronic
1127887472 15:63214954-63214976 CTCCATAAGAATGAGGTGGAAGG - Intronic
1128452334 15:67812860-67812882 CTTTAGAAGAAGGACCTGGAGGG - Intergenic
1128452334 15:67812860-67812882 CTTTAGAAGAAGGACCTGGAGGG - Intergenic
1128582611 15:68819839-68819861 ATAAATTAGAAGGAGGGGGAGGG - Intronic
1128582611 15:68819839-68819861 ATAAATTAGAAGGAGGGGGAGGG - Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129702934 15:77778239-77778261 CCATATAAGAGGGAGGCAGAGGG - Intronic
1129702934 15:77778239-77778261 CCATATAAGAGGGAGGCAGAGGG - Intronic
1130208614 15:81901933-81901955 CTTTATAAGAAAGAGGAGAAAGG + Intergenic
1130208614 15:81901933-81901955 CTTTATAAGAAAGAGGAGAAAGG + Intergenic
1131510324 15:93046212-93046234 CTTTATAAGAAGGAGGCAGAGGG + Intronic
1131510324 15:93046212-93046234 CTTTATAAGAAGGAGGCAGAGGG + Intronic
1131677271 15:94683314-94683336 CTCTGTAAAAAGGGGGTGGATGG - Intergenic
1131677271 15:94683314-94683336 CTCTGTAAAAAGGGGGTGGATGG - Intergenic
1133609257 16:7417750-7417772 CTATATAAAAAGTATGTGAAAGG + Intronic
1133609257 16:7417750-7417772 CTATATAAAAAGTATGTGAAAGG + Intronic
1135163542 16:20118336-20118358 CTATCAAACAAGGAGGTGGGAGG - Intergenic
1135163542 16:20118336-20118358 CTATCAAACAAGGAGGTGGGAGG - Intergenic
1135408249 16:22213833-22213855 CCTTATAAAAAGGAGGTAGAAGG - Intronic
1135408249 16:22213833-22213855 CCTTATAAAAAGGAGGTAGAAGG - Intronic
1136142938 16:28298842-28298864 CCAGATCAGAAGGAGGAGGATGG - Intronic
1136142938 16:28298842-28298864 CCAGATCAGAAGGAGGAGGATGG - Intronic
1137886937 16:52115263-52115285 CTATATAAAAAAGAGGCAGAGGG - Intergenic
1137886937 16:52115263-52115285 CTATATAAAAAAGAGGCAGAGGG - Intergenic
1138658669 16:58504768-58504790 CTACATAAAGAGGAGGTGGGAGG - Intronic
1138658669 16:58504768-58504790 CTACATAAAGAGGAGGTGGGAGG - Intronic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140106828 16:71968267-71968289 CTAAGTGGGAAGGAGGTGGAAGG - Intronic
1140106828 16:71968267-71968289 CTAAGTGGGAAGGAGGTGGAAGG - Intronic
1140977911 16:80078267-80078289 CTCTATAGGAAGAAAGTGGAGGG - Intergenic
1140977911 16:80078267-80078289 CTCTATAGGAAGAAAGTGGAGGG - Intergenic
1144754497 17:17670914-17670936 GTATATAAGAAAGAGGCAGAGGG + Intergenic
1144754497 17:17670914-17670936 GTATATAAGAAAGAGGCAGAGGG + Intergenic
1145238796 17:21227446-21227468 CTTTATACGAGGGAGGCGGAGGG - Intergenic
1145238796 17:21227446-21227468 CTTTATACGAGGGAGGCGGAGGG - Intergenic
1147987077 17:44312809-44312831 GTATATCAGAAAGAGGTGGCTGG - Intronic
1147987077 17:44312809-44312831 GTATATCAGAAAGAGGTGGCTGG - Intronic
1148481427 17:47961942-47961964 CCTTATAAGAGAGAGGTGGAGGG - Intergenic
1148481427 17:47961942-47961964 CCTTATAAGAGAGAGGTGGAGGG - Intergenic
1148996424 17:51714208-51714230 CTCTTTAAGAAAGAGATGGATGG - Intronic
1148996424 17:51714208-51714230 CTCTTTAAGAAAGAGATGGATGG - Intronic
1151193771 17:72417181-72417203 TCATATAAGAAGGAGGCAGAGGG + Intergenic
1151193771 17:72417181-72417203 TCATATAAGAAGGAGGCAGAGGG + Intergenic
1151225665 17:72646405-72646427 CTATGTAAGAAGGAGTAGGCTGG + Exonic
1151225665 17:72646405-72646427 CTATGTAAGAAGGAGTAGGCTGG + Exonic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1153934196 18:9906115-9906137 CTACAGGAGAAGGAGTTGGAGGG + Intergenic
1153934196 18:9906115-9906137 CTACAGGAGAAGGAGTTGGAGGG + Intergenic
1156844237 18:41645430-41645452 CTATATAATTGGGAGGTGGTTGG + Intergenic
1156844237 18:41645430-41645452 CTATATAATTGGGAGGTGGTTGG + Intergenic
1157385505 18:47256832-47256854 CTATATGGGGAGGAGGTGGGTGG - Intergenic
1157385505 18:47256832-47256854 CTATATGGGGAGGAGGTGGGTGG - Intergenic
1157662603 18:49459450-49459472 CAAGAGAAGAACGAGGTGGAAGG - Intronic
1157662603 18:49459450-49459472 CAAGAGAAGAACGAGGTGGAAGG - Intronic
1158070971 18:53470128-53470150 TTATCTAAGAAGCAGGTGTAGGG - Intronic
1158070971 18:53470128-53470150 TTATCTAAGAAGCAGGTGTAGGG - Intronic
1158905018 18:62003393-62003415 CCTTACAAAAAGGAGGTGGAGGG - Intergenic
1158905018 18:62003393-62003415 CCTTACAAAAAGGAGGTGGAGGG - Intergenic
1159967738 18:74612278-74612300 CTGTATAAGAAGGAAGGTGATGG + Intronic
1159967738 18:74612278-74612300 CTGTATAAGAAGGAAGGTGATGG + Intronic
1160115996 18:76080142-76080164 GTATATAAGAAATAGGTGGCCGG - Intergenic
1160115996 18:76080142-76080164 GTATATAAGAAATAGGTGGCCGG - Intergenic
1161848757 19:6727780-6727802 CTTTATAAGAGGGAGGTGGGAGG - Intronic
1161848757 19:6727780-6727802 CTTTATAAGAGGGAGGTGGGAGG - Intronic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1166788076 19:45381360-45381382 ATGTACAAGAAGGAAGTGGAGGG - Intronic
1166788076 19:45381360-45381382 ATGTACAAGAAGGAAGTGGAGGG - Intronic
1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG + Exonic
1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG + Exonic
925510357 2:4618624-4618646 CTATATAAGAATGGTGTGCAGGG + Intergenic
925510357 2:4618624-4618646 CTATATAAGAATGGTGTGCAGGG + Intergenic
925617089 2:5754034-5754056 CTTTATAAGAAACAGGTGCAAGG - Intergenic
925617089 2:5754034-5754056 CTTTATAAGAAACAGGTGCAAGG - Intergenic
926582458 2:14646083-14646105 TTCTATAAGAAAAAGGTGGAGGG - Intronic
926582458 2:14646083-14646105 TTCTATAAGAAAAAGGTGGAGGG - Intronic
926766989 2:16330541-16330563 CTAAAGCAGAAGGAGGTGGGTGG - Intergenic
926766989 2:16330541-16330563 CTAAAGCAGAAGGAGGTGGGTGG - Intergenic
928005684 2:27559423-27559445 CTAGAGAAAAAGGAAGTGGAGGG - Intronic
928005684 2:27559423-27559445 CTAGAGAAAAAGGAAGTGGAGGG - Intronic
928216074 2:29362418-29362440 GTATATTAGAAGGAGGCAGAGGG + Intronic
928216074 2:29362418-29362440 GTATATTAGAAGGAGGCAGAGGG + Intronic
930386582 2:50703432-50703454 TTATTTCAGAAGGTGGTGGAGGG + Intronic
930386582 2:50703432-50703454 TTATTTCAGAAGGTGGTGGAGGG + Intronic
932009277 2:67959097-67959119 CACTATAACAAGGAGGTGAAGGG + Intergenic
932009277 2:67959097-67959119 CACTATAACAAGGAGGTGAAGGG + Intergenic
932116235 2:69050947-69050969 CAATATAAGAAGCAGAAGGAAGG - Intronic
932116235 2:69050947-69050969 CAATATAAGAAGCAGAAGGAAGG - Intronic
932566385 2:72913801-72913823 CTATGAAAGAATGGGGTGGAGGG + Intergenic
932566385 2:72913801-72913823 CTATGAAAGAATGGGGTGGAGGG + Intergenic
933498808 2:83086200-83086222 CTATAGGAGAAAGAGGTAGAAGG - Intergenic
933498808 2:83086200-83086222 CTATAGGAGAAAGAGGTAGAAGG - Intergenic
933616636 2:84488627-84488649 CTACATAAGAGGGAGGAGGCAGG - Intergenic
933616636 2:84488627-84488649 CTACATAAGAGGGAGGAGGCAGG - Intergenic
935151222 2:100438360-100438382 CAATAAAAGGATGAGGTGGAAGG - Intergenic
935151222 2:100438360-100438382 CAATAAAAGGATGAGGTGGAAGG - Intergenic
937590495 2:123607562-123607584 TTATATAAGAAAGAGCTGGCGGG + Intergenic
937590495 2:123607562-123607584 TTATATAAGAAAGAGCTGGCGGG + Intergenic
938982163 2:136537273-136537295 CTTTTAAAGAAGGAGTTGGAGGG - Intergenic
938982163 2:136537273-136537295 CTTTTAAAGAAGGAGTTGGAGGG - Intergenic
939743554 2:145940202-145940224 CCAAATAAGAAGGAGGAGGGAGG - Intergenic
939743554 2:145940202-145940224 CCAAATAAGAAGGAGGAGGGAGG - Intergenic
940026287 2:149211963-149211985 GTAGATAAGCAGGAGGTGGTGGG + Intronic
940026287 2:149211963-149211985 GTAGATAAGCAGGAGGTGGTGGG + Intronic
940502898 2:154516626-154516648 CTAAATATGAAGAAGGTGGGTGG - Intergenic
940502898 2:154516626-154516648 CTAAATATGAAGAAGGTGGGTGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942075069 2:172350072-172350094 CCATATGGAAAGGAGGTGGAAGG + Intergenic
942075069 2:172350072-172350094 CCATATGGAAAGGAGGTGGAAGG + Intergenic
942562026 2:177229910-177229932 CTATGTTAGAAGGAACTGGACGG - Intronic
942562026 2:177229910-177229932 CTATGTTAGAAGGAACTGGACGG - Intronic
944995922 2:205293455-205293477 GTATACAAGGAGGAGCTGGAAGG + Intronic
944995922 2:205293455-205293477 GTATACAAGGAGGAGCTGGAAGG + Intronic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
945912788 2:215668734-215668756 CGATATAAAAAGAAGTTGGAGGG + Intergenic
945912788 2:215668734-215668756 CGATATAAAAAGAAGTTGGAGGG + Intergenic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1174892570 20:54412489-54412511 CTATTTTAGTAGGAGTTGGAAGG + Intergenic
1174892570 20:54412489-54412511 CTATTTTAGTAGGAGTTGGAAGG + Intergenic
1174947549 20:55004925-55004947 CTACATAAAATAGAGGTGGAAGG + Intergenic
1174947549 20:55004925-55004947 CTACATAAAATAGAGGTGGAAGG + Intergenic
1175181544 20:57151777-57151799 CTATATATGGAGGTGGTGTAAGG + Intergenic
1175181544 20:57151777-57151799 CTATATATGGAGGTGGTGTAAGG + Intergenic
1175829197 20:61952819-61952841 ATATGTAAGAGGGAGATGGAGGG - Intergenic
1175829197 20:61952819-61952841 ATATGTAAGAGGGAGATGGAGGG - Intergenic
1177036930 21:16055824-16055846 AAATAGAAGAGGGAGGTGGAAGG + Intergenic
1177036930 21:16055824-16055846 AAATAGAAGAGGGAGGTGGAAGG + Intergenic
1177600663 21:23308076-23308098 GTGTAAAAGAAGGAGGTGAAAGG + Intergenic
1177600663 21:23308076-23308098 GTGTAAAAGAAGGAGGTGAAAGG + Intergenic
1181714607 22:24715185-24715207 ATCTATAAGAAGGAAGTTGAAGG - Intergenic
1181714607 22:24715185-24715207 ATCTATAAGAAGGAAGTTGAAGG - Intergenic
1181738483 22:24900888-24900910 CTATTTAAGACCCAGGTGGAAGG + Intronic
1181738483 22:24900888-24900910 CTATTTAAGACCCAGGTGGAAGG + Intronic
1181988471 22:26818565-26818587 CTTTATAAGAAGCAGGCAGAGGG + Intergenic
1181988471 22:26818565-26818587 CTTTATAAGAAGCAGGCAGAGGG + Intergenic
1183232968 22:36594324-36594346 CTATATTAGAAGGAGGTATGAGG + Intronic
1183232968 22:36594324-36594346 CTATATTAGAAGGAGGTATGAGG + Intronic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
949824522 3:8151500-8151522 GTATATAACAAGAAGGAGGAAGG + Intergenic
949824522 3:8151500-8151522 GTATATAACAAGAAGGAGGAAGG + Intergenic
949941663 3:9159383-9159405 AGAGATAAGAAGGAGGTGGGTGG - Intronic
949941663 3:9159383-9159405 AGAGATAAGAAGGAGGTGGGTGG - Intronic
952089730 3:29870176-29870198 CGTTCTAAAAAGGAGGTGGAGGG + Intronic
952089730 3:29870176-29870198 CGTTCTAAAAAGGAGGTGGAGGG + Intronic
953242231 3:41159838-41159860 GAAGATAAGAAGGAAGTGGAAGG + Intergenic
953242231 3:41159838-41159860 GAAGATAAGAAGGAAGTGGAAGG + Intergenic
953693105 3:45136378-45136400 CTAAGGAAGAAGGAGGAGGATGG + Intronic
953693105 3:45136378-45136400 CTAAGGAAGAAGGAGGAGGATGG + Intronic
954740473 3:52745708-52745730 CTTTATAAGAAGGTTTTGGAGGG + Intronic
954740473 3:52745708-52745730 CTTTATAAGAAGGTTTTGGAGGG + Intronic
955542730 3:59994960-59994982 CAGTATAAGAAGGTGGTGGTGGG + Intronic
955542730 3:59994960-59994982 CAGTATAAGAAGGTGGTGGTGGG + Intronic
955690943 3:61590134-61590156 CTATTTCAGAATGAGATGGATGG + Intronic
955690943 3:61590134-61590156 CTATTTCAGAATGAGATGGATGG + Intronic
958186024 3:90120144-90120166 CTTTATAAGAGGGAGGCAGAGGG - Intergenic
958186024 3:90120144-90120166 CTTTATAAGAGGGAGGCAGAGGG - Intergenic
958560753 3:95744798-95744820 CTATCTGGGAAGGAGGTGGGGGG - Intergenic
958560753 3:95744798-95744820 CTATCTGGGAAGGAGGTGGGGGG - Intergenic
959246942 3:103882567-103882589 CAATAGAAGAAGGAGGAGAAAGG + Intergenic
959246942 3:103882567-103882589 CAATAGAAGAAGGAGGAGAAAGG + Intergenic
959686891 3:109157351-109157373 CTTCATGAGATGGAGGTGGAGGG - Intergenic
959686891 3:109157351-109157373 CTTCATGAGATGGAGGTGGAGGG - Intergenic
960180240 3:114567442-114567464 CAATATATGAAGGAGATGGAGGG - Intronic
960180240 3:114567442-114567464 CAATATATGAAGGAGATGGAGGG - Intronic
961225530 3:125241957-125241979 TTATCTCAGCAGGAGGTGGATGG + Intronic
961225530 3:125241957-125241979 TTATCTCAGCAGGAGGTGGATGG + Intronic
962163780 3:133027446-133027468 CTATAATAAAAGGAGGTGGTAGG - Intergenic
962163780 3:133027446-133027468 CTATAATAAAAGGAGGTGGTAGG - Intergenic
962682196 3:137812026-137812048 CTATATTAGGAGGACATGGATGG - Intergenic
962682196 3:137812026-137812048 CTATATTAGGAGGACATGGATGG - Intergenic
963590234 3:147247965-147247987 CTATAAAAAGAGGAGGTGTATGG + Intergenic
963590234 3:147247965-147247987 CTATAAAAAGAGGAGGTGTATGG + Intergenic
963719704 3:148848087-148848109 CAATATAAGAAAAAGTTGGAAGG - Intronic
963719704 3:148848087-148848109 CAATATAAGAAAAAGTTGGAAGG - Intronic
964489123 3:157216224-157216246 TGATAAAAGCAGGAGGTGGAAGG - Intergenic
964489123 3:157216224-157216246 TGATAAAAGCAGGAGGTGGAAGG - Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
965977953 3:174648521-174648543 CTATATAAGGAAGAGTTGTATGG - Intronic
965977953 3:174648521-174648543 CTATATAAGGAAGAGTTGTATGG - Intronic
966333219 3:178839362-178839384 CTAGATAAGAAAGAGGAGAAAGG + Intronic
966333219 3:178839362-178839384 CTAGATAAGAAAGAGGAGAAAGG + Intronic
966401804 3:179555220-179555242 TTTTTTAAGCAGGAGGTGGAGGG - Intergenic
966401804 3:179555220-179555242 TTTTTTAAGCAGGAGGTGGAGGG - Intergenic
966876059 3:184322403-184322425 CTAAATAAGAAGGAGGCTGTTGG + Exonic
966876059 3:184322403-184322425 CTAAATAAGAAGGAGGCTGTTGG + Exonic
967966556 3:194964824-194964846 CTTTACAAGAAAGAGGTAGATGG + Intergenic
967966556 3:194964824-194964846 CTTTACAAGAAAGAGGTAGATGG + Intergenic
968852571 4:3093655-3093677 ATATATAAAAAGGAGGCAGAGGG + Intronic
968852571 4:3093655-3093677 ATATATAAAAAGGAGGCAGAGGG + Intronic
969156948 4:5219319-5219341 CTCTACAGGAAGGAGTTGGAAGG - Intronic
969156948 4:5219319-5219341 CTCTACAGGAAGGAGTTGGAAGG - Intronic
970755535 4:19421572-19421594 TTATATAAATAGGAGTTGGATGG + Intergenic
970755535 4:19421572-19421594 TTATATAAATAGGAGTTGGATGG + Intergenic
970926019 4:21453313-21453335 CTTTATATGAAAGAGGTAGAAGG + Intronic
970926019 4:21453313-21453335 CTTTATATGAAAGAGGTAGAAGG + Intronic
971590686 4:28465306-28465328 TAATATAAGAAGTAGATGGAGGG + Intergenic
971590686 4:28465306-28465328 TAATATAAGAAGTAGATGGAGGG + Intergenic
972279322 4:37587191-37587213 GCTTATGAGAAGGAGGTGGAGGG - Intronic
972279322 4:37587191-37587213 GCTTATGAGAAGGAGGTGGAGGG - Intronic
972571339 4:40312914-40312936 GTAGATAAGGAGGAGGTGGGGGG + Intergenic
972571339 4:40312914-40312936 GTAGATAAGGAGGAGGTGGGGGG + Intergenic
973116575 4:46467572-46467594 CCCTATAAGAGGGAGGTAGAAGG + Intronic
973116575 4:46467572-46467594 CCCTATAAGAGGGAGGTAGAAGG + Intronic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973804603 4:54513708-54513730 CTGGATAAGATGGAGGTGCATGG + Intergenic
973804603 4:54513708-54513730 CTGGATAAGATGGAGGTGCATGG + Intergenic
974751100 4:66142365-66142387 ATAGATAAGAAAGAGGAGGAAGG - Intergenic
974751100 4:66142365-66142387 ATAGATAAGAAAGAGGAGGAAGG - Intergenic
974769349 4:66390473-66390495 CTATAGAATATAGAGGTGGATGG + Intergenic
974769349 4:66390473-66390495 CTATAGAATATAGAGGTGGATGG + Intergenic
975032151 4:69634319-69634341 ACATATAAGAAGGAATTGGAAGG + Intronic
975032151 4:69634319-69634341 ACATATAAGAAGGAATTGGAAGG + Intronic
975330251 4:73104738-73104760 CTATTTAAGCGGGAGGTGGGGGG + Intronic
975330251 4:73104738-73104760 CTATTTAAGCGGGAGGTGGGGGG + Intronic
975446454 4:74471317-74471339 CTATATAAGAGAGAGGTGAAGGG + Intergenic
975446454 4:74471317-74471339 CTATATAAGAGAGAGGTGAAGGG + Intergenic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977668800 4:99671531-99671553 CTATATGTGTAGGAGGTGGTTGG - Intergenic
977668800 4:99671531-99671553 CTATATGTGTAGGAGGTGGTTGG - Intergenic
979230621 4:118345324-118345346 ATTTGTAAGAAGGAGGAGGAGGG + Intronic
979230621 4:118345324-118345346 ATTTGTAAGAAGGAGGAGGAGGG + Intronic
979483802 4:121247970-121247992 CTATGTGAGGAGGAGGTTGAAGG + Intergenic
979483802 4:121247970-121247992 CTATGTGAGGAGGAGGTTGAAGG + Intergenic
980169570 4:129272899-129272921 AAATATAAGAAGGAAGTTGAGGG - Intergenic
980169570 4:129272899-129272921 AAATATAAGAAGGAAGTTGAGGG - Intergenic
982365201 4:154570448-154570470 CTAAAGAAGACGGTGGTGGATGG + Exonic
982365201 4:154570448-154570470 CTAAAGAAGACGGTGGTGGATGG + Exonic
982718103 4:158830104-158830126 TTATAAATGAAGGAGGTGGGTGG + Intronic
982718103 4:158830104-158830126 TTATAAATGAAGGAGGTGGGTGG + Intronic
982786306 4:159540791-159540813 CTATGTGAGCAGGTGGTGGAAGG + Intergenic
982786306 4:159540791-159540813 CTATGTGAGCAGGTGGTGGAAGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
985256959 4:188079831-188079853 CTATATTGGAATGAGGTGGCAGG - Intergenic
985256959 4:188079831-188079853 CTATATTGGAATGAGGTGGCAGG - Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986938830 5:12924413-12924435 ATATATAAGAAGGAGGTATGTGG + Intergenic
986938830 5:12924413-12924435 ATATATAAGAAGGAGGTATGTGG + Intergenic
987798623 5:22664336-22664358 CTATCTAGGAAGAAGGTGAAGGG + Intronic
987798623 5:22664336-22664358 CTATCTAGGAAGAAGGTGAAGGG + Intronic
988645155 5:33086823-33086845 CTATATAGGAAAGAGGTGGAGGG + Intergenic
988645155 5:33086823-33086845 CTATATAGGAAAGAGGTGGAGGG + Intergenic
988727383 5:33938244-33938266 CCATTTAAGAAGTAGGTGGGAGG + Intergenic
988727383 5:33938244-33938266 CCATTTAAGAAGTAGGTGGGAGG + Intergenic
988787551 5:34578745-34578767 CTTTATAAGAGGGAGGCAGATGG - Intergenic
988787551 5:34578745-34578767 CTTTATAAGAGGGAGGCAGATGG - Intergenic
991037681 5:62144388-62144410 CCATCTGGGAAGGAGGTGGAAGG + Intergenic
991037681 5:62144388-62144410 CCATCTGGGAAGGAGGTGGAAGG + Intergenic
991959127 5:72024240-72024262 CTATACAAGGAGGTGGTGGTAGG - Intergenic
991959127 5:72024240-72024262 CTATACAAGGAGGTGGTGGTAGG - Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992544409 5:77797429-77797451 CTCTAGAAGAAGAAGGTGAAAGG + Intronic
992544409 5:77797429-77797451 CTCTAGAAGAAGAAGGTGAAAGG + Intronic
993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG + Intergenic
993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG + Intergenic
993473600 5:88336202-88336224 CTTTGGAAGAATGAGGTGGAAGG - Intergenic
993473600 5:88336202-88336224 CTTTGGAAGAATGAGGTGGAAGG - Intergenic
994195544 5:96918882-96918904 CCTTAAAAGAAGGAGGTGGGGGG - Exonic
994195544 5:96918882-96918904 CCTTAAAAGAAGGAGGTGGGGGG - Exonic
994337555 5:98585951-98585973 CTACCTACGAAGGGGGTGGAAGG + Intergenic
994337555 5:98585951-98585973 CTACCTACGAAGGGGGTGGAAGG + Intergenic
994367777 5:98934845-98934867 CTGTATAAGAATTAGGTGGAAGG + Intergenic
994367777 5:98934845-98934867 CTGTATAAGAATTAGGTGGAAGG + Intergenic
995739132 5:115336136-115336158 CTATATTTAAAGGAGGTGGGGGG - Intergenic
995739132 5:115336136-115336158 CTATATTTAAAGGAGGTGGGGGG - Intergenic
998638715 5:143985748-143985770 CTATATAAAAATGAAGTGGTAGG - Intergenic
998638715 5:143985748-143985770 CTATATAAAAATGAAGTGGTAGG - Intergenic
998893185 5:146768533-146768555 CAAAATAAGCAGGAGGTGAATGG - Intronic
998893185 5:146768533-146768555 CAAAATAAGCAGGAGGTGAATGG - Intronic
1000201957 5:159020023-159020045 CCACCTAAGAATGAGGTGGATGG + Intronic
1000201957 5:159020023-159020045 CCACCTAAGAATGAGGTGGATGG + Intronic
1000444593 5:161304313-161304335 CTATATTAAATGGAAGTGGAAGG - Intronic
1000444593 5:161304313-161304335 CTATATTAAATGGAAGTGGAAGG - Intronic
1000977834 5:167783964-167783986 CTAAATAAGAGGGAGATTGAGGG + Intronic
1000977834 5:167783964-167783986 CTAAATAAGAGGGAGATTGAGGG + Intronic
1001200239 5:169709336-169709358 CCATATGAGAAGGACCTGGAGGG - Intronic
1001200239 5:169709336-169709358 CCATATGAGAAGGACCTGGAGGG - Intronic
1001933336 5:175688125-175688147 CTTTCTAACAAGGAGGTAGAGGG - Intergenic
1001933336 5:175688125-175688147 CTTTCTAACAAGGAGGTAGAGGG - Intergenic
1002988751 6:2217855-2217877 CTTTAAAAGAAGGATGTGTAGGG - Intronic
1002988751 6:2217855-2217877 CTTTAAAAGAAGGATGTGTAGGG - Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1007143771 6:39606124-39606146 ATATAGGAGAAGGAGGAGGAGGG - Intronic
1007143771 6:39606124-39606146 ATATAGGAGAAGGAGGAGGAGGG - Intronic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1010508450 6:76688491-76688513 CTGTATAAAAAGGAGGCAGATGG + Intergenic
1010508450 6:76688491-76688513 CTGTATAAAAAGGAGGCAGATGG + Intergenic
1011083812 6:83516820-83516842 TCATATAAGAAGGAGGCAGACGG - Intronic
1011083812 6:83516820-83516842 TCATATAAGAAGGAGGCAGACGG - Intronic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1012829259 6:104185733-104185755 CTATATGAGAAGGAGTTGACAGG + Intergenic
1012829259 6:104185733-104185755 CTATATGAGAAGGAGTTGACAGG + Intergenic
1013793767 6:113860946-113860968 CCATATATGAAGGAGATGGGTGG + Exonic
1013793767 6:113860946-113860968 CCATATATGAAGGAGATGGGTGG + Exonic
1017179153 6:151533710-151533732 CTTCAGATGAAGGAGGTGGAAGG - Intronic
1017179153 6:151533710-151533732 CTTCAGATGAAGGAGGTGGAAGG - Intronic
1017395123 6:153990006-153990028 CTATATAGGCAGAAGGTTGAAGG - Intergenic
1017395123 6:153990006-153990028 CTATATAGGCAGAAGGTTGAAGG - Intergenic
1017478441 6:154824326-154824348 CTCTTAAAAAAGGAGGTGGAGGG - Exonic
1017478441 6:154824326-154824348 CTCTTAAAAAAGGAGGTGGAGGG - Exonic
1019007887 6:168817832-168817854 CTATATAAGAAGGAAGTTACTGG + Intergenic
1019007887 6:168817832-168817854 CTATATAAGAAGGAAGTTACTGG + Intergenic
1019064864 6:169288291-169288313 CTTTATGAGAGGCAGGTGGAAGG - Intergenic
1019064864 6:169288291-169288313 CTTTATGAGAGGCAGGTGGAAGG - Intergenic
1019287315 7:230173-230195 CCTCATAAGAGGGAGGTGGAGGG + Intronic
1019287315 7:230173-230195 CCTCATAAGAGGGAGGTGGAGGG + Intronic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1020865154 7:13551060-13551082 GTAGATAAGAAGGAAGTAGATGG - Intergenic
1020865154 7:13551060-13551082 GTAGATAAGAAGGAAGTAGATGG - Intergenic
1022320413 7:29282941-29282963 CAATATCAGCAGGTGGTGGATGG + Intronic
1022320413 7:29282941-29282963 CAATATCAGCAGGTGGTGGATGG + Intronic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1024818792 7:53303192-53303214 TACTATAAGAAGGAGGTGGGAGG + Intergenic
1024818792 7:53303192-53303214 TACTATAAGAAGGAGGTGGGAGG + Intergenic
1026793170 7:73348417-73348439 CTATACAGGGAGGATGTGGACGG - Intronic
1026793170 7:73348417-73348439 CTATACAGGGAGGATGTGGACGG - Intronic
1027157066 7:75775953-75775975 CTTTATAAGAAGGCCATGGAGGG - Intronic
1027157066 7:75775953-75775975 CTTTATAAGAAGGCCATGGAGGG - Intronic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030658088 7:112190446-112190468 GTAAAGAAGCAGGAGGTGGATGG + Intronic
1030658088 7:112190446-112190468 GTAAAGAAGCAGGAGGTGGATGG + Intronic
1034322942 7:150202015-150202037 CTAGAAAAGAAGGAGGTCGGGGG - Intergenic
1034322942 7:150202015-150202037 CTAGAAAAGAAGGAGGTCGGGGG - Intergenic
1034746018 7:153524512-153524534 CTCTCCAAGGAGGAGGTGGAGGG + Intergenic
1034746018 7:153524512-153524534 CTCTCCAAGGAGGAGGTGGAGGG + Intergenic
1034988485 7:155532669-155532691 CTATTTTAGGAGGAGGTGGTAGG - Intronic
1034988485 7:155532669-155532691 CTATTTTAGGAGGAGGTGGTAGG - Intronic
1035188778 7:157146982-157147004 CTAAAGAAGAAGGAAGTCGAAGG - Intronic
1035188778 7:157146982-157147004 CTAAAGAAGAAGGAAGTCGAAGG - Intronic
1036227430 8:6971525-6971547 CACTATGAGAAGGAGGAGGAGGG - Intergenic
1036227430 8:6971525-6971547 CACTATGAGAAGGAGGAGGAGGG - Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036614045 8:10374599-10374621 CTATATTAGCAGGAGGTAGGTGG + Intronic
1036614045 8:10374599-10374621 CTATATTAGCAGGAGGTAGGTGG + Intronic
1036900217 8:12664792-12664814 ACGTAAAAGAAGGAGGTGGAAGG + Intergenic
1036900217 8:12664792-12664814 ACGTAAAAGAAGGAGGTGGAAGG + Intergenic
1037402877 8:18510547-18510569 CAAAATAAGAAAGAGGTGAAGGG + Intergenic
1037402877 8:18510547-18510569 CAAAATAAGAAAGAGGTGAAGGG + Intergenic
1038499346 8:28030502-28030524 TCATATAAGGTGGAGGTGGAGGG - Intronic
1038499346 8:28030502-28030524 TCATATAAGGTGGAGGTGGAGGG - Intronic
1040048579 8:42989119-42989141 CAATATTAGAAGAGGGTGGAGGG + Intronic
1040048579 8:42989119-42989141 CAATATTAGAAGAGGGTGGAGGG + Intronic
1043889077 8:85636297-85636319 CTATAAAGGAAGGAGGTTAATGG - Intergenic
1043889077 8:85636297-85636319 CTATAAAGGAAGGAGGTTAATGG - Intergenic
1047676271 8:127206513-127206535 CTATTTATGAAAGAGGCGGATGG - Intergenic
1047676271 8:127206513-127206535 CTATTTATGAAAGAGGCGGATGG - Intergenic
1048395030 8:134006268-134006290 CATTGTAAAAAGGAGGTGGAGGG + Intergenic
1048395030 8:134006268-134006290 CATTGTAAAAAGGAGGTGGAGGG + Intergenic
1048903245 8:139060598-139060620 CCACATAAGATGGAGGTAGAGGG - Intergenic
1048903245 8:139060598-139060620 CCACATAAGATGGAGGTAGAGGG - Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1051412723 9:16807536-16807558 GAAAATGAGAAGGAGGTGGAGGG + Intronic
1051412723 9:16807536-16807558 GAAAATGAGAAGGAGGTGGAGGG + Intronic
1052472923 9:28922933-28922955 CTTTATAAAAGGGAGGTGGAAGG + Intergenic
1052472923 9:28922933-28922955 CTTTATAAAAGGGAGGTGGAAGG + Intergenic
1052685756 9:31753523-31753545 CTCAAGAAGAAGGAGGGGGAGGG - Intergenic
1052685756 9:31753523-31753545 CTCAAGAAGAAGGAGGGGGAGGG - Intergenic
1053206125 9:36188094-36188116 CTATATGTGAAGGAGGTAGAGGG - Intergenic
1053206125 9:36188094-36188116 CTATATGTGAAGGAGGTAGAGGG - Intergenic
1054908015 9:70427672-70427694 TTTTATAAGAAGGAGGCGGGAGG + Intergenic
1054908015 9:70427672-70427694 TTTTATAAGAAGGAGGCGGGAGG + Intergenic
1055488240 9:76777971-76777993 CTATAGCAGTGGGAGGTGGAAGG + Intronic
1055488240 9:76777971-76777993 CTATAGCAGTGGGAGGTGGAAGG + Intronic
1056247953 9:84717007-84717029 AGATATGACAAGGAGGTGGAAGG + Intronic
1056247953 9:84717007-84717029 AGATATGACAAGGAGGTGGAAGG + Intronic
1056422832 9:86446407-86446429 CTATATATGACAGAGGTTGATGG + Intergenic
1056422832 9:86446407-86446429 CTATATATGACAGAGGTTGATGG + Intergenic
1056471379 9:86907311-86907333 TGATATAAGGAGGAGGTGGAGGG + Intergenic
1056471379 9:86907311-86907333 TGATATAAGGAGGAGGTGGAGGG + Intergenic
1058477078 9:105347138-105347160 CCATATGAGAAGGAACTGGAAGG - Intronic
1058477078 9:105347138-105347160 CCATATGAGAAGGAACTGGAAGG - Intronic
1058969147 9:110064205-110064227 CTACCTAAGGAGGAGGAGGAAGG + Intronic
1058969147 9:110064205-110064227 CTACCTAAGGAGGAGGAGGAAGG + Intronic
1059414605 9:114155350-114155372 CTATACAAGGAGGAGGGGGGCGG + Intergenic
1059414605 9:114155350-114155372 CTATACAAGGAGGAGGGGGGCGG + Intergenic
1059610950 9:115893864-115893886 ATATATAAGAAGGAAGTTAAAGG + Intergenic
1059610950 9:115893864-115893886 ATATATAAGAAGGAAGTTAAAGG + Intergenic
1062432814 9:136533517-136533539 CTATCTGGGAAGGAGGTGGGCGG - Intronic
1062432814 9:136533517-136533539 CTATCTGGGAAGGAGGTGGGCGG - Intronic
1185687392 X:1940574-1940596 CTTTCTAAGAAGGAGGCAGAGGG - Intergenic
1185687392 X:1940574-1940596 CTTTCTAAGAAGGAGGCAGAGGG - Intergenic
1186024175 X:5290701-5290723 CTTTATAAGAGGGAGGTAAAAGG - Intergenic
1186024175 X:5290701-5290723 CTTTATAAGAGGGAGGTAAAAGG - Intergenic
1187025805 X:15434227-15434249 AGATAGAAGAAGGAGGAGGAAGG + Intronic
1187025805 X:15434227-15434249 AGATAGAAGAAGGAGGAGGAAGG + Intronic
1187298293 X:18024003-18024025 TTATTTAACAAGGAGGTGGGTGG - Intergenic
1187298293 X:18024003-18024025 TTATTTAACAAGGAGGTGGGTGG - Intergenic
1188969034 X:36590349-36590371 CTATATAGAATTGAGGTGGAAGG - Intergenic
1188969034 X:36590349-36590371 CTATATAGAATTGAGGTGGAAGG - Intergenic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189977348 X:46475718-46475740 ATATATAAGAAGGATATGGCTGG + Intronic
1189977348 X:46475718-46475740 ATATATAAGAAGGATATGGCTGG + Intronic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1193150151 X:78116455-78116477 CTATGTATCAAGGAGGTGAAGGG - Intronic
1193150151 X:78116455-78116477 CTATGTATCAAGGAGGTGAAGGG - Intronic
1193847022 X:86484998-86485020 CTATCTAAGAATAAAGTGGACGG - Intronic
1193847022 X:86484998-86485020 CTATCTAAGAATAAAGTGGACGG - Intronic
1195644011 X:107207963-107207985 CTATCTAAAAAGAAGTTGGAGGG - Intronic
1195644011 X:107207963-107207985 CTATCTAAAAAGAAGTTGGAGGG - Intronic
1196240320 X:113336450-113336472 ATAGATAGGAAGGGGGTGGAGGG + Intergenic
1196240320 X:113336450-113336472 ATAGATAGGAAGGGGGTGGAGGG + Intergenic
1197685561 X:129436096-129436118 CTATATAAAAAGAAGATGGGAGG + Intergenic
1197685561 X:129436096-129436118 CTATATAAAAAGAAGATGGGAGG + Intergenic
1198039416 X:132835345-132835367 ATATAACAGAAGGAGGAGGACGG + Intronic
1198039416 X:132835345-132835367 ATATAACAGAAGGAGGAGGACGG + Intronic
1198304213 X:135364729-135364751 CTATAAAAGAAGCAGGGGGCTGG - Intergenic
1198304213 X:135364729-135364751 CTATAAAAGAAGCAGGGGGCTGG - Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199788529 X:151127978-151128000 GTACATAAGATGGGGGTGGAGGG - Intergenic
1199788529 X:151127978-151128000 GTACATAAGATGGGGGTGGAGGG - Intergenic
1199879289 X:151960405-151960427 CTCAATAAGAATGAGGTTGAAGG + Intronic
1199879289 X:151960405-151960427 CTCAATAAGAATGAGGTTGAAGG + Intronic
1201478292 Y:14408815-14408837 CTATTTAAGAAAGAGGTGGCCGG + Intergenic
1201478292 Y:14408815-14408837 CTATTTAAGAAAGAGGTGGCCGG + Intergenic