ID: 1023056233

View in Genome Browser
Species Human (GRCh38)
Location 7:36292134-36292156
Sequence CGGGGCACTCACATGTAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023056233_1023056235 -7 Left 1023056233 7:36292134-36292156 CCACGCTACATGTGAGTGCCCCG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1023056235 7:36292150-36292172 TGCCCCGTGCCAGGCGCTTCTGG 0: 1
1: 0
2: 1
3: 14
4: 130
1023056233_1023056244 26 Left 1023056233 7:36292134-36292156 CCACGCTACATGTGAGTGCCCCG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1023056244 7:36292183-36292205 AATCCTGACACCAACCTGGGAGG 0: 1
1: 0
2: 3
3: 28
4: 243
1023056233_1023056238 -4 Left 1023056233 7:36292134-36292156 CCACGCTACATGTGAGTGCCCCG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1023056238 7:36292153-36292175 CCCGTGCCAGGCGCTTCTGGCGG 0: 1
1: 0
2: 0
3: 20
4: 101
1023056233_1023056242 22 Left 1023056233 7:36292134-36292156 CCACGCTACATGTGAGTGCCCCG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1023056242 7:36292179-36292201 CTCTAATCCTGACACCAACCTGG No data
1023056233_1023056243 23 Left 1023056233 7:36292134-36292156 CCACGCTACATGTGAGTGCCCCG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1023056243 7:36292180-36292202 TCTAATCCTGACACCAACCTGGG 0: 1
1: 0
2: 5
3: 26
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023056233 Original CRISPR CGGGGCACTCACATGTAGCG TGG (reversed) Intronic
900130347 1:1084717-1084739 CGGGGCACTCACAGGTGCGGGGG + Intronic
905439982 1:37989536-37989558 CTGGGCACTCACATCTTGCATGG + Exonic
912963885 1:114220014-114220036 CGGGGCACTCTCATGCTGCGGGG + Intergenic
918115120 1:181489570-181489592 GGGGGCACTCAAATGTAACAGGG - Intronic
1067548327 10:47213539-47213561 CGGGTCCCTCACATGAAACGTGG - Intergenic
1076218333 10:128713292-128713314 CTGGGCACTCACCTGGACCGGGG + Intergenic
1077262184 11:1628717-1628739 CGGGGCACTCACAGGTATTGTGG + Intergenic
1102931995 12:116869431-116869453 CAAGCCACTCACATGTAGAGGGG + Intronic
1129248041 15:74291911-74291933 CATGGCACTCACATGTGGTGTGG + Intronic
1129966617 15:79741955-79741977 TTGGGCACTCACAGGTAGCATGG + Intergenic
1136248155 16:28986704-28986726 CTGGCCACTCACAGGTAGCCTGG - Exonic
1144622304 17:16825156-16825178 CGGGGCTCCCCCATGTAGGGTGG - Intergenic
1144884120 17:18447557-18447579 CGGGGCTCCCCCATGTAGGGTGG + Intergenic
1145148109 17:20496820-20496842 CGGGGCTCCCCCATGTAGGGTGG - Intergenic
1148911388 17:50944834-50944856 CCCGCCACTCACATGTGGCGGGG - Intergenic
1161315237 19:3614578-3614600 CGCGGCGCTCACCTGCAGCGGGG + Exonic
1168365862 19:55786632-55786654 TGGGACACTCACATGCAGAGAGG - Intronic
1168685701 19:58347834-58347856 GGGGACACTCACGTGTGGCGCGG - Intronic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
932445642 2:71779402-71779424 AGGGCCTCTCACATGTGGCGGGG - Intergenic
1170150543 20:13221904-13221926 CGGCGCACTCACCTGCAGCTGGG - Exonic
1171175381 20:23048220-23048242 CAGGGCACTCACAGCTAGCCTGG + Exonic
1180615191 22:17121619-17121641 GGGGGGACTCCCATGGAGCGCGG + Exonic
1182774083 22:32818320-32818342 AGGGGCACTCACATTTAGAATGG + Intronic
950707436 3:14791796-14791818 CCAGGCACTCGCATGGAGCGTGG - Intergenic
954707045 3:52486716-52486738 CGCAGCCCTCACATGTAGAGTGG - Intronic
968891630 4:3372396-3372418 CTGGGCACTCACTTGCAGTGGGG - Intronic
976396539 4:84561689-84561711 TGGGTCACTCACATGGAGTGGGG + Intergenic
976732342 4:88276722-88276744 CAGGGTAATCACATCTAGCGAGG - Intronic
985938609 5:3115923-3115945 CGGTGCACACACATGTAAAGTGG - Intergenic
999824408 5:155260174-155260196 CGGGGAACTGACATGTTGAGTGG - Intergenic
1000042183 5:157493043-157493065 CGGGGCACCCACGTCTACCGAGG - Exonic
1002352220 5:178590849-178590871 CTGCGCACTCACATTTAGAGAGG + Intergenic
1002504419 5:179669073-179669095 CAGGGTACTCACCTGTAACGGGG + Intergenic
1003783418 6:9455907-9455929 AGAGGCACCCACATGTAGAGAGG + Intergenic
1007304037 6:40890613-40890635 TGGGACCCTGACATGTAGCGGGG - Intergenic
1021870776 7:25004117-25004139 CTGGGAACTCAGATGTAGGGAGG - Intergenic
1023056233 7:36292134-36292156 CGGGGCACTCACATGTAGCGTGG - Intronic
1029513746 7:101013132-101013154 GGGGACACTCACAGGCAGCGGGG - Exonic
1201914967 Y:19172043-19172065 AGGGGCACTCACATGGATTGAGG - Intergenic