ID: 1023056722

View in Genome Browser
Species Human (GRCh38)
Location 7:36296500-36296522
Sequence CAGCACAGGGAAAGGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 341}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023056722 Original CRISPR CAGCACAGGGAAAGGTGGTC AGG (reversed) Intronic
900403066 1:2480556-2480578 CAGCTCTGGGGAAAGTGGTCGGG + Intronic
901061370 1:6473455-6473477 CTGGTCAGGGAAGGGTGGTCAGG + Intronic
901258823 1:7856358-7856380 CAGTACAGGGGCAGGTAGTCAGG + Intergenic
901644708 1:10710211-10710233 CAAGACAGGCAAAGGTGGGCTGG - Intronic
901652707 1:10752259-10752281 GAGCCCAGGGAGAGGTGGGCAGG - Intronic
902268752 1:15288126-15288148 CAGCACAGGCAGTGGTGGACAGG - Intronic
904371206 1:30048556-30048578 CAGCTCAGGGAGAGGTGGACAGG - Intergenic
904440704 1:30527667-30527689 GAGGACAGGGAAATGTGGGCAGG - Intergenic
904537682 1:31210720-31210742 CAGGCCAGGGAAAGGTTGACAGG + Intronic
905517070 1:38569786-38569808 CTGCCCAGGGAAAGGAGGCCAGG - Intergenic
906193827 1:43916394-43916416 CAGCACAAGGTAAGATGGACTGG + Intronic
907413780 1:54300291-54300313 CAGCACAGGAAGAGCTGGCCTGG + Intronic
908002419 1:59693709-59693731 CAGAACTGGGAAAGCTGGCCAGG + Intronic
908417116 1:63923917-63923939 CAGCACATGCAAAGGTCCTCAGG - Intronic
909158378 1:72111931-72111953 TAGCACATGGTAAGGTGCTCAGG - Intronic
909505818 1:76388604-76388626 CAGCAGTGGGAAAGGGAGTCTGG - Intronic
909517979 1:76533663-76533685 GAGGAATGGGAAAGGTGGTCTGG - Intronic
912412962 1:109490585-109490607 CAGGGCATGGAAGGGTGGTCTGG + Intronic
912417131 1:109516992-109517014 AATCACAGGCAAAGGTGCTCCGG + Intergenic
912677718 1:111700713-111700735 CAGGTCAGGGAAAGGTTATCAGG - Intronic
914754550 1:150555287-150555309 CAGCACAAGCTGAGGTGGTCAGG - Intronic
915562782 1:156697144-156697166 AAGCAGAGGGGAAGGTGCTCTGG - Intergenic
915864384 1:159483185-159483207 CAGCACAAGAAAATGTGGACAGG - Intergenic
916608161 1:166363553-166363575 CAGCTCTGGGAGAGGTGGCCAGG - Intergenic
917133724 1:171768007-171768029 CAGCATAGGGAAACTTGGACAGG - Intergenic
917738178 1:177939080-177939102 GAGCAAAGGGAAGGGTGGGCAGG - Intronic
919853042 1:201686566-201686588 CAGCATAAAGAAATGTGGTCAGG - Intronic
920036846 1:203071654-203071676 CAGGAGAGGGAAAGGTGGGAAGG - Intronic
920307752 1:205029974-205029996 CTCCTCAGGGAAAGATGGTCTGG + Intergenic
920375441 1:205505504-205505526 CAGCAGAGGGAAAGGAGGCTGGG + Intronic
921098262 1:211905610-211905632 CAGTATAGGGAAATGTGGTGTGG - Intergenic
922161476 1:223081658-223081680 CAGCACACCGGGAGGTGGTCAGG + Intergenic
922707301 1:227796158-227796180 CAGCTCAGGGACAGGTATTCTGG + Intergenic
924481558 1:244439776-244439798 CAGCACAGGCTAAAGTGCTCTGG - Intronic
924555885 1:245118310-245118332 CAACACAGGGACAGGTGCGCTGG + Intronic
1063411544 10:5840336-5840358 CAGCACGTGGAAAGGCGGGCCGG + Intronic
1064219254 10:13425761-13425783 AAGCACAGAGAAAGATGTTCAGG + Intergenic
1064435096 10:15304422-15304444 CAGGGCAGGGAAGGGTGGCCTGG - Intronic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1065834843 10:29647252-29647274 GTGCACTGGGAAAGTTGGTCAGG + Intronic
1066654510 10:37685851-37685873 CAGGCCAGGGAGAGGTGGACAGG + Intergenic
1067556928 10:47279141-47279163 CAGCACAGGCAAAGAAGGACAGG - Intergenic
1068057995 10:52034787-52034809 CGGCACAGTGTAAGTTGGTCTGG + Intronic
1068329893 10:55549530-55549552 CAGCACAGGGAAAGATAATGAGG + Intronic
1068906287 10:62327166-62327188 CTTCACATGGAAAGCTGGTCTGG - Intergenic
1069677612 10:70259941-70259963 CACCCCAGGGAAAGGTGGGCAGG - Intronic
1069694079 10:70374098-70374120 CAGCACTGGGGCAGGTGGTGAGG - Intronic
1070442704 10:76462622-76462644 CAGCACAGGCAAAGATGGTGCGG - Intronic
1070562579 10:77578965-77578987 CAGCACAGAGAAAGGAGGCCTGG - Intronic
1072241336 10:93497821-93497843 AAATACAGGGAAAGGTGGCCGGG + Intronic
1073179170 10:101573724-101573746 CTGCACAGGGCAAGGTGGGCTGG + Intronic
1073583268 10:104686352-104686374 GAGCACAGGGAATGGTGGAAGGG + Intronic
1074132191 10:110589978-110590000 CAGCAACAGGAAAGGTGGGCAGG + Exonic
1075352521 10:121736529-121736551 ATGCACAGGGAGAGCTGGTCAGG + Intergenic
1075716618 10:124559379-124559401 CACCACAGGGGCAGGTGCTCTGG - Intronic
1076202824 10:128571870-128571892 CAGCCCAGGGCAAGCTGGCCAGG - Intergenic
1077226092 11:1439731-1439753 CAGGGCAGGGGAAGGTGGTGGGG - Intronic
1077596287 11:3534551-3534573 CAGCACTGGGCCAGGTGGGCAGG - Intergenic
1078099750 11:8323091-8323113 CAGCACAGGCAAAGGAGGAGAGG + Intergenic
1078543396 11:12229111-12229133 CAGCCCAGGGAAAGGAGGCTGGG - Intronic
1079727252 11:23891764-23891786 GGGCACAGAGAAAGGAGGTCAGG + Intergenic
1082033290 11:47623073-47623095 AAGAGCAGGGAAAGGTGGCCGGG + Intronic
1083098823 11:60281754-60281776 TAGAAGAGGGAAGGGTGGTCTGG + Intronic
1083550929 11:63589811-63589833 CATCTCAGGGACAGGTGGCCAGG + Intronic
1084252195 11:67908528-67908550 CAGCACTGGGCCAGGTGGGCAGG - Intergenic
1084302994 11:68263547-68263569 CCGCACAGGGAAGGGTTGTCAGG - Intronic
1084583843 11:70042342-70042364 CAGCACAGGGAGAGGAACTCAGG + Intergenic
1084736076 11:71106554-71106576 CAGCTCTGGGAAACATGGTCAGG + Intronic
1084820654 11:71687505-71687527 CAGCACTGGGCCAGGTGGGCAGG + Intergenic
1086669063 11:89524826-89524848 TAGCACAGGGAAATGTTGTGTGG - Intergenic
1087799957 11:102492956-102492978 CTGAATAGGGAATGGTGGTCTGG + Intronic
1089011562 11:115136095-115136117 CAGCACAGGGAAGGCTGCTGTGG - Intergenic
1089136374 11:116252508-116252530 CAGCACTGAGAGAGGTAGTCTGG - Intergenic
1089136811 11:116255805-116255827 CAGCAGAGGGGAAGGTTGGCGGG + Intergenic
1089273153 11:117315521-117315543 CCGCAGACGGTAAGGTGGTCAGG - Exonic
1089299148 11:117487986-117488008 CAGGAGAGGGAAAGACGGTCTGG + Intronic
1089808995 11:121116012-121116034 CAGCACAGGGAAAGGGGCAGAGG - Intronic
1091230700 11:133986239-133986261 CAGCGCAGGGCAGGGTGGCCGGG + Intergenic
1091703816 12:2680496-2680518 CAGCACAGTGAAGCGTGGCCAGG - Intronic
1091704350 12:2683819-2683841 CAGCACAGTGAAGCGTGGCCAGG + Intronic
1091816853 12:3445245-3445267 GTGCCCAGGGAAAGGTGGCCGGG + Intronic
1092422462 12:8343322-8343344 CAGCACTGGGCCAGGTGGGCAGG - Intergenic
1096135615 12:49197658-49197680 CACCACAGGGAAATGAGGTTAGG - Intronic
1096466430 12:51849330-51849352 CAGTCCTGGGAAAGGGGGTCTGG - Intergenic
1098238958 12:68446585-68446607 CAGCACTGGGGGAGGTGGGCAGG - Intergenic
1098402074 12:70086533-70086555 CAGCACAGAGATAAGAGGTCAGG - Intergenic
1101195591 12:102378746-102378768 CAGCACTAGGAAATGTGCTCAGG - Intergenic
1101621609 12:106394287-106394309 CAGCACCAGGAAGGGTGGTTTGG + Intronic
1101826532 12:108224774-108224796 AAGGCCAGGGAAAGGTTGTCGGG - Exonic
1102150796 12:110688304-110688326 CAGCACTGGTAAAAGTGGTGGGG + Exonic
1102815103 12:115859077-115859099 CAGCACAGGGAGTGTGGGTCGGG + Intergenic
1103714701 12:122937887-122937909 CAGCACAGGGACAGGTGTTATGG + Intronic
1103716154 12:122946555-122946577 CAGCACAGGGTCAGGTGTTGAGG - Intronic
1105008233 12:132736488-132736510 AGCCACAGGGAAACGTGGTCAGG + Intronic
1105024345 12:132838463-132838485 CAGCACACGGAGGGGTGGGCAGG + Intronic
1105206330 13:18228351-18228373 TAGCACAGGAAAAGCTGCTCAGG - Intergenic
1108355265 13:49624312-49624334 GAGCCCAGGGAAAGGAGGGCTGG + Intergenic
1112440408 13:99420876-99420898 GAGCACAGGGAATGGTGTGCCGG + Intergenic
1113350549 13:109525093-109525115 CAGCACCAGGAAAGGTGACCAGG + Intergenic
1113681470 13:112247865-112247887 CAGCACCCGGAGAGGTGGTTTGG + Intergenic
1119548048 14:75487702-75487724 CGGCACAGCGAAGGGTGGGCGGG - Intergenic
1119548079 14:75487882-75487904 CGGCACAGCGAAGGGTGGGCGGG - Intergenic
1119548109 14:75488062-75488084 CGGCACAGCGAAGGGTGGGCGGG - Intergenic
1119574085 14:75702708-75702730 CAGCCCAGGGAGAGGTGGGAGGG - Intronic
1120787166 14:88548479-88548501 CAGCAAAGGGAAGGCTGCTCAGG - Intronic
1121021585 14:90583540-90583562 CAGCACAGTGAAATGGGCTCTGG + Intronic
1121108611 14:91296785-91296807 CAGCACATGGAAGGCTGGTGAGG - Intronic
1121211251 14:92209518-92209540 CAGCACAGGGCCAGAGGGTCTGG + Intergenic
1122271759 14:100571423-100571445 CAGCAGAGGAAAGGGTGGACGGG - Intronic
1124032095 15:26020975-26020997 CAGCACAGGCAAAGGTGCAGAGG + Intergenic
1125918735 15:43511700-43511722 CAGCACTGGGGAAGGAGGTGAGG - Intronic
1125956867 15:43796550-43796572 CAAGACAGGGAAGGATGGTCAGG - Exonic
1126478762 15:49094590-49094612 CAGCACTGGGAAAGGAGGTAGGG - Intergenic
1127622211 15:60744991-60745013 CAGCACAGGGCGCGGTGGCCAGG - Intronic
1127638907 15:60896945-60896967 CTGCTCAGGGAGAGATGGTCAGG + Intronic
1128807202 15:70539907-70539929 CAGCACCAGGAAAGGAGGCCGGG + Intergenic
1130050341 15:80479036-80479058 CTCCACTGGGAAAGGAGGTCAGG - Intronic
1131009266 15:89003825-89003847 CAGCACAGTGAACTGGGGTCCGG + Intergenic
1131078706 15:89515681-89515703 CAGCTCAGGGAGAGGTACTCAGG + Intergenic
1131812383 15:96185864-96185886 AAGCACAGGGCTAGGTGGTGGGG - Intergenic
1132347355 15:101116283-101116305 CAGCACAGGGAAGTCTGGCCCGG + Intergenic
1134090849 16:11390980-11391002 CAGCACAGGGAAGGGGGCTGGGG - Intronic
1136052562 16:27662509-27662531 CAGCACAGGGCAAGCTGAGCAGG + Intronic
1136084648 16:27876229-27876251 CAGCACAGGTGAAGGTGGCAGGG + Intronic
1137553842 16:49457832-49457854 GAGCAGAAGGAAAGGTGGTTTGG + Intergenic
1137848357 16:51713755-51713777 CAGCACAGGCAAAGGTGTGGAGG + Intergenic
1138533255 16:57646394-57646416 CAGCAGAGTGGAAGGTGGCCAGG - Intronic
1139072097 16:63394878-63394900 CAGCATAGGGGAAGGTTTTCAGG + Intergenic
1139957804 16:70701446-70701468 CAGCAGAGGGACTGGGGGTCAGG - Intronic
1141104229 16:81220108-81220130 CAGGACAGGGAATGGTGGATTGG - Intergenic
1142062734 16:88041082-88041104 CAGCACAAGGAAAGGGGCTGGGG - Intronic
1142382793 16:89743191-89743213 GAGCACAGGGCAAGGTAGACAGG - Intronic
1142420484 16:89966683-89966705 GAGCACCAGGAAAGGTGGGCTGG - Exonic
1143800609 17:9376980-9377002 AAGCACAGGGCAGGATGGTCGGG + Intronic
1144131157 17:12249059-12249081 CAGCACAGGGAAAGGAACTCGGG + Intergenic
1144768324 17:17745126-17745148 CAGGACAGGGAATGGGGATCGGG + Intronic
1144956916 17:19023306-19023328 GATCACATGGAAAGGTGGTGGGG + Intronic
1145095119 17:20018691-20018713 CAGCAAAGGGAAAGGTGCATGGG + Intronic
1146700211 17:34951534-34951556 GAGCACAGGGAGAGGAGGTGAGG - Intronic
1147326927 17:39674057-39674079 GAGGACAGGGAAGGGTGGTGAGG + Intronic
1147991018 17:44333552-44333574 CATGACAGGGAAAGCTGGCCTGG + Intergenic
1148440908 17:47711207-47711229 CAGAACAGGGAAAGGAGGACAGG - Exonic
1149282803 17:55127109-55127131 GAGCACATGGAAAGGTTGTGAGG - Intronic
1149637348 17:58181523-58181545 CAGCATCATGAAAGGTGGTCAGG + Intergenic
1149879261 17:60271777-60271799 CAGTACAGGTAAAAGTGGTGTGG - Intronic
1149993006 17:61393185-61393207 CAGAAGATGGAAGGGTGGTCAGG + Intergenic
1150693673 17:67385767-67385789 GGGCACAGGGAAAGGAGGGCGGG + Intronic
1151635141 17:75342113-75342135 AAGCAGAGGGAAAGGTGACCAGG - Intronic
1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG + Intronic
1152103893 17:78317967-78317989 CAGGCCAGGGGAAGGTGGACAGG + Intergenic
1152231672 17:79117073-79117095 CGGCAGAGGGAAAGGGGCTCCGG + Intronic
1152264758 17:79287792-79287814 CAGCACAGGCCAAGGTGTCCAGG - Intronic
1152271580 17:79328089-79328111 GAGCAGTGGAAAAGGTGGTCAGG + Intronic
1152732008 17:81977208-81977230 GACCACAGGGACAGGTGGGCAGG + Intronic
1153571413 18:6476957-6476979 AAGAGCAGGGAAAGGTGGTGTGG + Intergenic
1156913068 18:42434184-42434206 GAGGACAGGCAAAGGTGGGCAGG + Intergenic
1157724210 18:49951205-49951227 CAGCAAAGGGAGAGGTGGATGGG - Intronic
1159384895 18:67710498-67710520 GGACACAGGAAAAGGTGGTCAGG + Intergenic
1160503589 18:79414816-79414838 CAGCACACGGAAAGGTGCCCTGG - Intronic
1164524569 19:29003926-29003948 GAGCACAGAGAAAGGGGGTGGGG - Intergenic
1164552123 19:29220788-29220810 CAGCACAGGGCCAGGTGGGAAGG - Intergenic
1164904965 19:31959864-31959886 CAGCCCAGGGAAAGGTGGCTGGG + Intergenic
1165326020 19:35115190-35115212 CAGGACAGGAAAAGGGGGTTTGG - Intergenic
1165784149 19:38451334-38451356 CACCTCGTGGAAAGGTGGTCTGG + Intronic
1165994032 19:39832255-39832277 CATCACAGGGAAAGGAGGACAGG + Intronic
1166540028 19:43599069-43599091 CAGGACAAGGGAAGGTGGGCTGG - Exonic
1166817194 19:45553431-45553453 CAGCGCAGGCAAGGGTGGTGCGG + Intronic
1167707900 19:51092551-51092573 CAGCTCTGGAGAAGGTGGTCAGG - Intergenic
1167716198 19:51144226-51144248 CACCACAGGGAAAGGTCATGGGG + Intronic
1168378634 19:55901713-55901735 CAGCAAAGGGAAAGGGGCTTGGG - Intronic
925075813 2:1014774-1014796 GAGCAGAGAGAAGGGTGGTCTGG + Intronic
925859445 2:8160644-8160666 CAGCAGAGGGATGGGTGGTGGGG - Intergenic
926704426 2:15826615-15826637 CAGCCCAGGGAGAGGTGGACAGG + Intergenic
926717156 2:15933824-15933846 CAGCACAGCGCGAGGTGATCTGG + Intergenic
927723933 2:25406195-25406217 TATCACAGGGAAAGGTTCTCTGG + Intronic
929695956 2:44115477-44115499 CAGCACAAAGAAAGGTGTTGGGG - Intergenic
930219553 2:48732608-48732630 TTGCACAGGGAAAGGATGTCTGG - Intronic
931667800 2:64622818-64622840 CAGGATAGGGCAAGGAGGTCAGG + Intergenic
931788932 2:65646213-65646235 CAGCACAGTGGAACGTGGGCAGG + Intergenic
931982397 2:67707946-67707968 CAGCAGAGGGAAAGGGGGAAAGG - Intergenic
932086593 2:68767925-68767947 CAGCTCAGTGAAAGGTGGCATGG + Intronic
932886074 2:75550319-75550341 GAGCAAAGGGAAAGGTAGTTGGG - Intronic
933703689 2:85274095-85274117 CACCTCAGGGAAAGGAGGACTGG + Intronic
933840573 2:86282961-86282983 CAGCACAGGCAAAGGCTTTCTGG - Intronic
935346441 2:102112501-102112523 CAGTCCAGGGAAAGGAGGGCAGG + Intronic
935361985 2:102253071-102253093 CAGGACAGAGAAAGGTGGAGAGG - Intergenic
936462095 2:112721677-112721699 AAGCACAGGGGAAGCAGGTCAGG - Intronic
936523879 2:113229839-113229861 CAGAGCAGGGACAGGTGGTGAGG + Intronic
936955004 2:118014208-118014230 CAGCCCGGGGAGAGGTGGGCTGG + Intergenic
936984644 2:118297277-118297299 CAGCACAGGGACACTTGGTCTGG + Intergenic
937441554 2:121919964-121919986 CAGCCTTGGGACAGGTGGTCAGG + Intergenic
939105714 2:137946213-137946235 CAGAACATGGACAGGTGGTTGGG + Intergenic
939500135 2:142974230-142974252 CAGTAAAGGGAAAAGTGGGCTGG + Intronic
940006393 2:149012649-149012671 CAGCACAGGTAAAAGTTGTGTGG - Intronic
940189867 2:151029221-151029243 CAGGACAAGGAAGTGTGGTCTGG + Intronic
940851428 2:158691055-158691077 GAGCACAGGGAAAGAGGGACAGG + Intergenic
940981715 2:160010967-160010989 CAGCACAGGGCAATCTGGACAGG + Intronic
945243016 2:207693712-207693734 CTGCACAGGAAAAGTTGGTATGG - Intergenic
946310480 2:218880339-218880361 CAACAGAGGGAAAGGTGTTGGGG - Intergenic
946335868 2:219036107-219036129 GTGCAGAGGGAAATGTGGTCTGG - Intronic
946732228 2:222720719-222720741 CAGTACAGGGAAATGTGGGGTGG - Intergenic
946732612 2:222723828-222723850 CAGCACAGGGTCAGATGCTCAGG + Intergenic
946741403 2:222805948-222805970 GAGCACAGGGAAGACTGGTCTGG + Intergenic
948717327 2:239873773-239873795 CAGCACAGGGAAAGGATGGTGGG + Intergenic
948760759 2:240189704-240189726 CATCTCAGGGTATGGTGGTCAGG + Intergenic
1170864196 20:20138348-20138370 CACCACAGGCAAAAGTGCTCTGG - Intronic
1172785593 20:37466314-37466336 CAGGAAAGGGAGAGGAGGTCCGG - Intergenic
1172984720 20:38975250-38975272 CAGCAGAGGAAATGGTGGCCTGG + Intronic
1173339784 20:42142968-42142990 CAGCAGATGCAAAGATGGTCAGG + Intronic
1173407241 20:42777273-42777295 GGGCACAGGAGAAGGTGGTCAGG - Intronic
1173485987 20:43441434-43441456 CACCACAGTGAAAGGTCTTCTGG - Intergenic
1173861233 20:46285004-46285026 CAGCACTGGGTACAGTGGTCAGG - Intronic
1174446116 20:50592497-50592519 CGGGACAGGCCAAGGTGGTCCGG - Exonic
1174534110 20:51237590-51237612 CAGCAGAGGGGAAGATGGCCTGG + Intergenic
1174669834 20:52296785-52296807 CAGGGCAGGAAAAGATGGTCAGG + Intergenic
1175541722 20:59751922-59751944 TAGCACAGAGAAACGTGGGCTGG - Intronic
1175802329 20:61807921-61807943 CAGCACAGTGCTGGGTGGTCTGG + Intronic
1175911318 20:62406788-62406810 CAGCCCAGGACAAGGGGGTCAGG - Intronic
1176025703 20:62984453-62984475 CAGGACAGGGCAGGGAGGTCAGG - Intergenic
1176368192 21:6046108-6046130 CAGCATAAGGCAAGGTGGCCTGG - Intergenic
1176414991 21:6468918-6468940 CAGGGCTGGGAAAGGTGGCCAGG + Intergenic
1177120600 21:17132834-17132856 CAGCAGAGGGAAACTGGGTCAGG + Intergenic
1177886627 21:26754941-26754963 CAGCAAAGAGACAAGTGGTCTGG + Intergenic
1178422494 21:32453337-32453359 CATCACAGGCATAGGTGGTGTGG - Exonic
1179690491 21:43077250-43077272 CAGGGCTGGGAAAGGTGGCCAGG + Intergenic
1179755327 21:43492434-43492456 CAGCATAAGGCAAGGTGGCCTGG + Intergenic
1180045514 21:45303347-45303369 CCGCACATGGAAAGGAGGTGAGG - Intergenic
1180700848 22:17780825-17780847 CAGGACAGGGGAAGGCGGTGGGG - Intergenic
1180739647 22:18044162-18044184 CAGCACAGGCCAAGGTGCTGTGG + Intergenic
1180759620 22:18190353-18190375 TAGCACAGGAAAAGCTGCTCAGG + Intergenic
1180769933 22:18374654-18374676 TAGCACAGGAAAAGCTGCTCAGG + Intergenic
1180776395 22:18488012-18488034 TAGCACAGGAAAAGCTGCTCAGG - Intronic
1180809123 22:18745381-18745403 TAGCACAGGAAAAGCTGCTCAGG - Intergenic
1180827873 22:18877609-18877631 TAGCACAGGAAAAGCTGCTCAGG + Intergenic
1180834071 22:18921092-18921114 CACCACAAGGAGAGGGGGTCTGG - Intronic
1181065750 22:20305147-20305169 CACCACAAGGAGAGGGGGTCTGG + Intergenic
1181072044 22:20350359-20350381 TAGCACAGGAAAAGCTGCTCAGG - Intergenic
1181195119 22:21179304-21179326 TAGCACAGGAAAAGCTGCTCAGG - Intergenic
1181214327 22:21313470-21313492 TAGCACAGGAAAAGCTGCTCAGG + Intergenic
1181567885 22:23750920-23750942 CACCGGAGGGACAGGTGGTCAGG + Exonic
1182016055 22:27040690-27040712 TATCACAGGGAAAGGTGCTCTGG + Intergenic
1203231763 22_KI270731v1_random:115838-115860 TAGCACAGGAAAAGCTGCTCAGG + Intergenic
1203277971 22_KI270734v1_random:103607-103629 TAGCACAGGAAAAGCTGCTCAGG + Intergenic
1203284159 22_KI270734v1_random:146390-146412 CACCACAAGGAGAGGGGGTCTGG - Intergenic
950007627 3:9701694-9701716 AAGCACAAGGACAGGTGGTATGG + Intronic
951825761 3:26866363-26866385 GAGAACAGAGAAAGGTTGTCAGG + Intergenic
953391416 3:42536066-42536088 TAGGAGAGGGGAAGGTGGTCAGG - Intronic
953616726 3:44497156-44497178 CTGCAGAAGGAAAGGTGGTCTGG + Intergenic
955356160 3:58234918-58234940 CAGCACATGGAAATGTGTGCAGG - Intergenic
955381780 3:58444628-58444650 CAGCACATGGAAAGATGATCGGG - Intergenic
956148760 3:66219559-66219581 CAGCTTAGGGAAAGGTATTCTGG + Intronic
956599754 3:71008206-71008228 AAAAACAGGGAAATGTGGTCAGG + Intronic
957822293 3:85393283-85393305 GTCCAAAGGGAAAGGTGGTCCGG + Intronic
960011845 3:112842137-112842159 CATCAGAGGGAAAACTGGTCAGG + Intronic
961017664 3:123480142-123480164 CAGCACGGGGCACCGTGGTCTGG + Intergenic
961271875 3:125695625-125695647 CAGCAAAGAGAAGGGAGGTCAGG + Intergenic
961768392 3:129229810-129229832 CAGCACAGGAAAACGTGTTTAGG - Intergenic
962235565 3:133704268-133704290 CATAGCAGGGAAATGTGGTCTGG + Intergenic
966797621 3:183730604-183730626 CTTGGCAGGGAAAGGTGGTCTGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966916177 3:184585167-184585189 GAGCACAGGGAGAGGTGCCCAGG + Intronic
967464983 3:189794527-189794549 CAGCAAAGGGAAGGGGGGTGAGG + Intronic
968638437 4:1696115-1696137 CACCACTGGGACAGGAGGTCTGG - Intronic
968942876 4:3648245-3648267 CAGGAACGGGAAAGGTGGCCTGG + Intergenic
968992480 4:3924220-3924242 CATCACAGGCATAGGTGGTGTGG + Intergenic
969010866 4:4060995-4061017 CAGCACTGGGCCAGGTGGGCAGG - Intergenic
969058666 4:4417957-4417979 CAGCACAGGGAGGGGTGGGGGGG - Exonic
969788670 4:9477080-9477102 CAGCAAAGAGAATGGAGGTCAGG + Intergenic
969822870 4:9733402-9733424 CATCACAGGCATAGGTGGTGTGG - Intergenic
972457307 4:39267213-39267235 AAGCAAAGGGGAAGGAGGTCTGG - Intronic
972761252 4:42106589-42106611 CAGCACAGTCACAGGTGGTACGG - Intergenic
973616650 4:52685562-52685584 CATCACATGGCAAGGTGGGCGGG + Intergenic
979725385 4:123954894-123954916 AAGAACAGAGAAAGGTGGTTTGG - Intergenic
981321987 4:143402677-143402699 TAGAACAGGGAAAGGTGAACAGG - Intronic
983792460 4:171814008-171814030 GAGCACAGGAAAAGATGTTCAGG + Intronic
983944291 4:173568572-173568594 CACCACAGGAAAAGGTGGTGTGG + Intergenic
984888273 4:184470153-184470175 CTGCACAGGGGTAGGAGGTCAGG - Intronic
986305298 5:6509715-6509737 CAGGGCAGGGCAAGGGGGTCCGG - Intergenic
987110620 5:14682875-14682897 CAGCAGATGGAAATGTGGCCAGG + Intronic
992202734 5:74400235-74400257 CAGCAAAGGGAAAGGTGCCAGGG + Intergenic
994711885 5:103275955-103275977 CAGGGAAGGGCAAGGTGGTCAGG - Exonic
995290264 5:110443619-110443641 AAGCAGAGGGAAAGGTGATGAGG - Intronic
997286008 5:132679069-132679091 CAGATCAGGGAAAGGTGTCCTGG - Intronic
997669152 5:135656265-135656287 CAGCACACGGGAAGGTGTTCTGG + Intergenic
999471139 5:151856474-151856496 CAGGATAGGGAAAGAAGGTCAGG + Intronic
1000731511 5:164839733-164839755 CAGCCCAGGAAGAAGTGGTCAGG - Intergenic
1001111244 5:168897931-168897953 CAGAACAGGGGAAGGTCGGCTGG + Intronic
1001229520 5:169973983-169974005 CAGCAGGGGGAGAGGTGGTGAGG + Intronic
1001452365 5:171836539-171836561 CAGCAGAGAGGAAGGTGGCCAGG - Intergenic
1001617527 5:173055377-173055399 AAGCACAGGGAAAGGAAGACGGG - Intergenic
1001806394 5:174590395-174590417 CTGGAAAGGGAAAGGTGGTGGGG + Intergenic
1001889097 5:175324254-175324276 CAGCCCAGGGAAACATGTTCTGG + Intergenic
1002704164 5:181148987-181149009 GAGCAGAAGGAAAGGAGGTCTGG + Intergenic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1003734835 6:8866905-8866927 CAGCCCTGGGAAGGTTGGTCAGG + Intergenic
1004278225 6:14256888-14256910 CAGCACAGGGAGAGGTGTGCGGG + Intergenic
1007001738 6:38319918-38319940 CATCACAGGGCAAAGTGCTCTGG - Intronic
1007309570 6:40934731-40934753 CAGCACAGACACAGGTGGGCGGG + Intergenic
1007748024 6:44055115-44055137 AAGCCCAGGGAAGGGTGGGCAGG + Intergenic
1008239010 6:49085156-49085178 CAGCACAGGGAAAGATATTCTGG + Intergenic
1008280684 6:49592250-49592272 GACCACAGGGAAGAGTGGTCTGG + Intergenic
1008751266 6:54736802-54736824 CAGAAGAGGGAAAGCTGGGCTGG + Intergenic
1013012633 6:106134197-106134219 CAGCACAGGGTGAGCTGCTCTGG + Intergenic
1013820777 6:114151355-114151377 CAGCAAAGGGGAAGGTGAGCTGG + Intronic
1014038040 6:116790883-116790905 GAGCTCAGGGGATGGTGGTCAGG - Intergenic
1017128736 6:151090292-151090314 CAGCACAGGGAAAGGGAGACTGG - Intronic
1017664244 6:156703789-156703811 CAGCACAGGGAATGCTGCTGGGG + Intergenic
1017717679 6:157223742-157223764 CTGCGCAGCGAACGGTGGTCCGG + Intergenic
1018216598 6:161534117-161534139 CAGGACAGGGAAAGGGAGTCTGG - Intronic
1018255314 6:161912570-161912592 CAGCACGTGGAGAGGTGGTATGG + Intronic
1019269032 7:135572-135594 CAACCCAGGGAAAGGCGCTCAGG - Intergenic
1020097210 7:5375905-5375927 CAGCAGAGGGGCAGGTGGTCAGG - Intronic
1022638696 7:32161272-32161294 CAGCACACGGATAGGAGGTTGGG + Intronic
1023056722 7:36296500-36296522 CAGCACAGGGAAAGGTGGTCAGG - Intronic
1024056083 7:45660589-45660611 CTGCCCAGAGAAAAGTGGTCTGG + Intronic
1026948330 7:74330611-74330633 CAGCACAGGGCATGGTGGCCTGG - Intronic
1028869768 7:95756799-95756821 CAGAAAAGGGACAGGTAGTCAGG - Intergenic
1029891425 7:103933973-103933995 CATCTCATGGAAAGGTGGGCAGG - Intronic
1030055820 7:105583108-105583130 CTGCGCAGGGAGCGGTGGTCCGG - Intronic
1030732109 7:113002614-113002636 CAGAAGAGGGAAACTTGGTCAGG - Intergenic
1031717626 7:125128040-125128062 GGGCAGAGGGAAAGGTGGTTTGG - Intergenic
1034356202 7:150452171-150452193 GAGCAGAGGGAAATGTGGGCTGG + Intronic
1035075504 7:156174899-156174921 CACCTCAGGGAAATGTGCTCTGG - Intergenic
1035643642 8:1201718-1201740 CCTCACAGGGAAATGTGCTCTGG - Intergenic
1035768427 8:2127127-2127149 GAGCAGAGGGAAGGGGGGTCGGG + Intronic
1036248410 8:7140682-7140704 CAGCACTGGGCCAGGTGGGCGGG + Intergenic
1036893450 8:12611361-12611383 CAGCACTGGGCCAGGTGGGCAGG - Intergenic
1039469953 8:37807176-37807198 CAGCCCAGGGAAGGGTGGCAGGG + Intronic
1039846577 8:41329904-41329926 CAGCAAGGGGAAAGGTGGGAAGG - Intergenic
1041856569 8:62462585-62462607 CAGCCCAGGGAAAGGTATGCAGG - Intronic
1045265692 8:100617031-100617053 CAGCAGATGGAAAAGGGGTCTGG + Intronic
1046969075 8:120200964-120200986 AAGCACTGGGATAGGTGATCAGG - Intronic
1049097428 8:140557273-140557295 CAGCGCAGGGGAAGGGGCTCCGG - Intronic
1049378533 8:142300935-142300957 CAGCAGAGGGGAGGGTGGGCAGG + Intronic
1049594199 8:143475961-143475983 CAGCACACAGCCAGGTGGTCAGG - Intronic
1052319204 9:27149835-27149857 GAGCCCAGAAAAAGGTGGTCTGG + Intronic
1052609662 9:30757404-30757426 CAGCAAAGGCAAAGTTGCTCAGG - Intergenic
1054875031 9:70087101-70087123 CAGGACAGTAGAAGGTGGTCAGG - Intronic
1055305067 9:74920912-74920934 CAGGACAGGGAATGGAGGCCTGG + Intergenic
1055834176 9:80419396-80419418 CACCTCATGGAAAAGTGGTCAGG - Intergenic
1056195503 9:84224774-84224796 TAGAACAAAGAAAGGTGGTCAGG + Intergenic
1056865431 9:90224409-90224431 CAGCAAAGAGAATGGAGGTCAGG + Intergenic
1056913391 9:90724468-90724490 CAGTACTGGGAAAGGCGGTTAGG - Intergenic
1057098905 9:92339109-92339131 CAGAACAGGGAAGGGCTGTCAGG + Intronic
1057167550 9:92940752-92940774 CAGCACAGGGAACTGTGGTGGGG + Intergenic
1058912541 9:109534212-109534234 CGGCACAGGAAACGGTGGCCCGG - Intergenic
1059411769 9:114136999-114137021 CAGCAGAGGGATAGGTTGTGGGG - Intergenic
1060293445 9:122325773-122325795 ATGCACAGAGAAAGGAGGTCTGG - Intergenic
1060588173 9:124799680-124799702 CAGCACAGGGAATGGGGGATAGG + Intronic
1060795569 9:126510551-126510573 GAGCAGAGTGAAAGGTGGTTGGG + Intergenic
1060848098 9:126853134-126853156 CAGCAGAGAGGAAGATGGTCAGG + Intergenic
1061096138 9:128457468-128457490 GAGGGCAGGGAAAGGTGGCCAGG + Intronic
1061277730 9:129579075-129579097 CTCCACAGGGAAAAGGGGTCTGG + Intergenic
1061622584 9:131821195-131821217 CAGCAAAGGGAAAGGTGCATTGG - Intergenic
1062178407 9:135176994-135177016 GAGCACAGGGACACGTGTTCTGG - Intergenic
1186456976 X:9717393-9717415 CAGCCTCAGGAAAGGTGGTCAGG + Exonic
1189021389 X:37345418-37345440 CAGAACTGGGAAGGGTGGACTGG + Intergenic
1189893317 X:45628286-45628308 CAGAACATAGAATGGTGGTCAGG + Intergenic
1190713884 X:53088243-53088265 CAGCACAGGGAGAGGGGCTGGGG - Exonic
1190752599 X:53375253-53375275 CAGGACAGGCAGAGGTGGTCAGG - Exonic
1192631272 X:72779705-72779727 CTGCACAGGGACAGGAGGCCAGG - Intronic
1192650437 X:72941096-72941118 CTGCACAGGGACAGGAGGCCAGG + Intronic
1194956404 X:100186209-100186231 CAGCACAGTGAAACATGGTATGG - Intergenic
1196456711 X:115896061-115896083 AAGCACAGGGAAAGATGCACGGG + Intergenic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1197089905 X:122523831-122523853 CAGCCCTGGGAGAAGTGGTCAGG - Intergenic
1197618681 X:128722253-128722275 CAGGGCAGGGCAAAGTGGTCAGG + Intergenic
1199317412 X:146396378-146396400 CAGCACAGGATAAAGTGCTCTGG - Intergenic
1200084470 X:153596831-153596853 CAGCACATTGAAAAGTGGGCTGG + Intronic
1201668732 Y:16491028-16491050 AATCACAGGGCAAGGTGATCTGG + Intergenic