ID: 1023056926

View in Genome Browser
Species Human (GRCh38)
Location 7:36298268-36298290
Sequence CAACAGGGCTGGAAGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023056914_1023056926 23 Left 1023056914 7:36298222-36298244 CCCCAGGAAGGTGTCTATTGAAG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG No data
1023056917_1023056926 21 Left 1023056917 7:36298224-36298246 CCAGGAAGGTGTCTATTGAAGGA 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG No data
1023056915_1023056926 22 Left 1023056915 7:36298223-36298245 CCCAGGAAGGTGTCTATTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG No data
1023056913_1023056926 24 Left 1023056913 7:36298221-36298243 CCCCCAGGAAGGTGTCTATTGAA 0: 1
1: 0
2: 0
3: 3
4: 116
Right 1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023056926 Original CRISPR CAACAGGGCTGGAAGGAAGT TGG Intronic
No off target data available for this crispr