ID: 1023059909

View in Genome Browser
Species Human (GRCh38)
Location 7:36316897-36316919
Sequence ACGTGTGAGGACCACTGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023059909_1023059917 19 Left 1023059909 7:36316897-36316919 CCGGGGCAGTGGTCCTCACACGT No data
Right 1023059917 7:36316939-36316961 CCGTGGGACTTCCTGACCTGTGG No data
1023059909_1023059913 3 Left 1023059909 7:36316897-36316919 CCGGGGCAGTGGTCCTCACACGT No data
Right 1023059913 7:36316923-36316945 TACCTGGAAGAATCACCCGTGGG No data
1023059909_1023059912 2 Left 1023059909 7:36316897-36316919 CCGGGGCAGTGGTCCTCACACGT No data
Right 1023059912 7:36316922-36316944 ATACCTGGAAGAATCACCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023059909 Original CRISPR ACGTGTGAGGACCACTGCCC CGG (reversed) Intergenic
No off target data available for this crispr