ID: 1023068121

View in Genome Browser
Species Human (GRCh38)
Location 7:36400267-36400289
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023068121_1023068126 8 Left 1023068121 7:36400267-36400289 CCTTAAATATGACTTTGTGGGAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1023068126 7:36400298-36400320 CCTATAAGGTTTCTTAAGGCAGG No data
1023068121_1023068122 -6 Left 1023068121 7:36400267-36400289 CCTTAAATATGACTTTGTGGGAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1023068122 7:36400284-36400306 TGGGAGCCGATAAACCTATAAGG 0: 1
1: 0
2: 0
3: 1
4: 40
1023068121_1023068124 4 Left 1023068121 7:36400267-36400289 CCTTAAATATGACTTTGTGGGAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1023068124 7:36400294-36400316 TAAACCTATAAGGTTTCTTAAGG No data
1023068121_1023068127 20 Left 1023068121 7:36400267-36400289 CCTTAAATATGACTTTGTGGGAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1023068127 7:36400310-36400332 CTTAAGGCAGGCAGATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023068121 Original CRISPR CTCCCACAAAGTCATATTTA AGG (reversed) Intronic