ID: 1023068126

View in Genome Browser
Species Human (GRCh38)
Location 7:36400298-36400320
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023068121_1023068126 8 Left 1023068121 7:36400267-36400289 CCTTAAATATGACTTTGTGGGAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1023068126 7:36400298-36400320 CCTATAAGGTTTCTTAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type