ID: 1023069444

View in Genome Browser
Species Human (GRCh38)
Location 7:36414428-36414450
Sequence CTGTGTGACGAAAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023069439_1023069444 16 Left 1023069439 7:36414389-36414411 CCGCACAGTGAAGGGAACAGAAC 0: 1
1: 0
2: 1
3: 30
4: 248
Right 1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023069444 Original CRISPR CTGTGTGACGAAAAGGAAGG AGG Intronic
No off target data available for this crispr