ID: 1023071633

View in Genome Browser
Species Human (GRCh38)
Location 7:36440527-36440549
Sequence TTGTGCTTGCAGAGGTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023071633 Original CRISPR TTGTGCTTGCAGAGGTATGT AGG Intronic
905999838 1:42414872-42414894 TTGTGCTTGCTGAGGAATCCCGG - Exonic
915231915 1:154452022-154452044 TTGTGCTTTGAGACGTATCTAGG + Intronic
917953314 1:180064193-180064215 TTGGGCTTGCAGTTGTGTGTGGG + Intronic
918246126 1:182660948-182660970 TTTGGCTTGGAGAGGGATGTGGG + Intronic
922473104 1:225888716-225888738 CTGGCCTTGCAGAGGTCTGTGGG - Intronic
923146950 1:231204736-231204758 TTATGATTGCAGTGGTTTGTTGG - Intronic
923484289 1:234414235-234414257 TTGGGCTGGCAGAGTTATATTGG - Intronic
1068110198 10:52671378-52671400 TTTTGCTTGTATAGGCATGTAGG - Intergenic
1070194115 10:74140354-74140376 AAGGGCTTGCAAAGGTATGTAGG - Intronic
1072613511 10:97034780-97034802 CTCTGCTTGCAGAGGGATGGGGG - Intronic
1075675794 10:124294961-124294983 CTGTACTTGCAGAGGCATGATGG - Intergenic
1076684588 10:132192206-132192228 TGGTGAGGGCAGAGGTATGTTGG + Intronic
1078169568 11:8919240-8919262 CTGTCCTTGCAGAGGTGTGATGG - Intronic
1081585397 11:44380517-44380539 TTTACCTTGCACAGGTATGTGGG - Intergenic
1085500447 11:77017623-77017645 TTGTGGTTGCATATGAATGTTGG - Intronic
1086245125 11:84742549-84742571 TTGTGGGGACAGAGGTATGTAGG - Intronic
1088514046 11:110609354-110609376 TTGTCTTTGCAGGGGCATGTTGG - Intronic
1088553394 11:111037367-111037389 TAGTGCTGGGAGAGGTATGGAGG + Intergenic
1088563641 11:111143937-111143959 TTGTGCTTTCAGTGGTATTGTGG + Intergenic
1092862554 12:12731483-12731505 TTGTCATTGCATATGTATGTGGG - Intronic
1093021930 12:14212021-14212043 TTGTGCTGGGAGAGGGGTGTGGG + Intergenic
1093385529 12:18548648-18548670 TTGGCCTGGCAGAGGTATGCAGG - Intronic
1095234620 12:39781878-39781900 CTGTACTTGCAGAGGTGTCTAGG + Intronic
1095323333 12:40857411-40857433 TCTAGCTTGCAGAGGTTTGTGGG + Intronic
1102035176 12:109766853-109766875 TAGTGCATGCAGAGTTCTGTTGG - Intronic
1104435782 12:128755291-128755313 TTGTGGTTGCCAAGGTCTGTGGG - Intergenic
1105558878 13:21472313-21472335 TGATGCTTGCAGATGTTTGTTGG + Intergenic
1110105811 13:71674662-71674684 TTATACTTGCAGAGTTATGGAGG - Intronic
1113359652 13:109618508-109618530 TTGGGGTTACAGAGGAATGTGGG + Intergenic
1117666376 14:58060851-58060873 TTGTGATTGCAGAGGCAGTTTGG - Intronic
1118136075 14:63029489-63029511 TTGTATATGCAGAGGTATCTTGG + Intronic
1118560094 14:67070002-67070024 TTCTACTTGCAAAGGGATGTTGG + Intronic
1118734332 14:68691033-68691055 TTGTGCTTTCAGAGGTCTGGGGG - Intronic
1118793035 14:69113275-69113297 TTGTAATTGCACAGGCATGTGGG - Intronic
1124005686 15:25793839-25793861 TTGGGCTTGCAGAGGTCTGGGGG - Intronic
1128550413 15:68594745-68594767 GTGTGCTTGCAGAAGGAAGTGGG + Intronic
1131563263 15:93462644-93462666 CTGTGAGTGCAGAGGTGTGTTGG - Intergenic
1131888721 15:96948816-96948838 TTTTGTTTGCAGAATTATGTAGG + Intergenic
1131935802 15:97503180-97503202 TTGTACTCTCAGAGGTATATTGG - Intergenic
1134757127 16:16677318-16677340 GTGGCCTTGCAGATGTATGTGGG + Intergenic
1134988941 16:18681845-18681867 GTGGCCTTGCAGATGTATGTGGG - Intergenic
1137737439 16:50735445-50735467 ATGGGTTTGCAGAGGTAGGTAGG + Intergenic
1138946255 16:61853679-61853701 AGGTGCTCTCAGAGGTATGTGGG + Intronic
1144941724 17:18946850-18946872 TTGTGGTATCATAGGTATGTAGG - Intergenic
1151036447 17:70805694-70805716 TGGTGCTGGCAGAGGTATTACGG + Intergenic
1153305354 18:3625979-3626001 TTGTGCTTGCCTAGGTTTGTGGG + Intronic
1153664296 18:7354500-7354522 TTGTGTTTGAAGTGGGATGTGGG + Intergenic
1153975611 18:10266108-10266130 TGGTGCTGGGAGAGGTTTGTTGG + Intergenic
1154300881 18:13191504-13191526 TTGTACATGCAGATGTTTGTTGG - Intergenic
1155065472 18:22265428-22265450 TTGTGATGGCAGAGTTCTGTGGG + Intergenic
1156872131 18:41957558-41957580 TTGTGCTTTCAGAGGAAGCTTGG + Exonic
1156918966 18:42495770-42495792 GTGTCATTGCAAAGGTATGTGGG - Intergenic
1165205226 19:34178684-34178706 TTGTTCTTGTAGAAGTATCTTGG + Intronic
1165662567 19:37594560-37594582 TTGCGCTTGCGGAGGGGTGTCGG - Intronic
1166859026 19:45798975-45798997 ATTTGCTTTCAGAGGAATGTTGG + Intronic
925179471 2:1807548-1807570 TGGTGCTTGAAGAGGTTTGCAGG + Intronic
928139175 2:28713072-28713094 TTGTTTTTCCAGAGGTATGGAGG + Intergenic
928371686 2:30744553-30744575 GTGGGCATGCAGAGGTGTGTGGG + Intronic
931466924 2:62497680-62497702 TTTTGCTTGCATAGGCAAGTGGG + Intergenic
934909744 2:98240979-98241001 TTGTGCTTGGGTAGGAATGTTGG - Intronic
938942758 2:136183323-136183345 TTGTGTTTGCTGAAGGATGTTGG + Intergenic
941502335 2:166295239-166295261 TTGTGATGGCAGAGGTAGGCAGG + Intronic
942089790 2:172478727-172478749 TTTTGCTTGCAGAGATATCGTGG + Intronic
945859741 2:215107036-215107058 TTGTACTTTTAGAGGTATTTAGG + Intronic
947177037 2:227378248-227378270 ATTTGCTTGCAGTGGTATATGGG + Intronic
1170489875 20:16862142-16862164 TTCTGCTTGCTGTGGAATGTGGG + Intergenic
1172729741 20:37076081-37076103 TTATCTTTGCAGAGGTATTTTGG + Intronic
1172782607 20:37446177-37446199 CTGTGCATGCAGAGGGATGGGGG - Intergenic
1178119569 21:29454812-29454834 ATGTGCTTACTGAGTTATGTTGG - Intronic
1179347058 21:40568456-40568478 CTGTGCCTGCAGTGGTCTGTGGG - Intronic
1179555887 21:42175697-42175719 ATCCGCTTGCAGATGTATGTAGG - Intergenic
1181897850 22:26126455-26126477 TAGTGCTTGAAGAGGGATCTGGG + Intergenic
1182630865 22:31684185-31684207 TTGTGCCTGCAGGAGTCTGTGGG - Exonic
1184978321 22:48078868-48078890 TTGTGCTTGGAGGGTTTTGTGGG + Intergenic
949612868 3:5720836-5720858 CTGTGCTTGCAGAGGTAAAATGG - Intergenic
957124372 3:76139508-76139530 TTGAGCTTGCAGAGCTTGGTGGG + Intronic
958854561 3:99368868-99368890 ATGTGTCTGCAGAGGTATGTTGG + Intergenic
959875494 3:111377685-111377707 TTTTCCTTGTAGAGGTCTGTTGG - Intronic
961025533 3:123552396-123552418 TTTTGCTTGAAGAGGTCGGTGGG - Intronic
962146686 3:132847029-132847051 ATGTCCTTGTAGAGGTATGATGG - Intergenic
965208580 3:165754247-165754269 TTCTGCTTGAAGATGTATCTAGG + Intergenic
965873499 3:173288490-173288512 TTGTGTTTGTAGAGTTATTTGGG - Intergenic
966476684 3:180356686-180356708 ATGTGCAGGCAGTGGTATGTTGG - Intergenic
969846830 4:9925990-9926012 ATCTGCTTGCAGTCGTATGTGGG - Intronic
970433107 4:16007173-16007195 TTGTGGTTGCAGAAATATTTGGG + Intronic
972420038 4:38878395-38878417 CTGTTCTTGCAGGGGTATTTCGG - Exonic
972632357 4:40853372-40853394 TTGTGCTGGAAGAGGTGGGTGGG - Intronic
975477274 4:74837788-74837810 AAGTGCTAGCAAAGGTATGTAGG - Intergenic
978701445 4:111651374-111651396 TTGTGTTTGCAGAACTATCTGGG - Intergenic
980512464 4:133812330-133812352 TTGGGCTTGTGGAGGTCTGTGGG - Intergenic
981806034 4:148716176-148716198 ATGTGCATGCAAAGGTGTGTGGG - Intergenic
982144807 4:152374594-152374616 TTATGCTTCCAGAGATATGCAGG - Intronic
982402854 4:154987417-154987439 TTATGCTTGCAAAAATATGTAGG + Intergenic
982619666 4:157688500-157688522 TTATGCCTGCAGAAGTATTTAGG + Intergenic
983632720 4:169865794-169865816 TTGGGCTTACAGAGTGATGTGGG + Intergenic
984086908 4:175324984-175325006 TTGTTCTATCAGAAGTATGTAGG + Intergenic
985648819 5:1098140-1098162 CTGGGCTTGCAGAGGGTTGTGGG - Intronic
985648864 5:1098274-1098296 CTGGGCTTGCAGAGGGTTGTGGG - Intronic
986194339 5:5524363-5524385 ATGTGCTTGTAGACGTGTGTGGG - Intergenic
987160806 5:15140195-15140217 TTGATCTTGCAGAGGTGTGCTGG - Intergenic
990020717 5:51124101-51124123 TTGTCCTAGAAAAGGTATGTAGG - Intergenic
993060595 5:83034361-83034383 TTGTGCTTAAAAAGGAATGTTGG + Intergenic
993240271 5:85374856-85374878 TTGTGGTATCAGAGTTATGTTGG - Intergenic
995806996 5:116064162-116064184 TTGTGATAGAAGAGATATGTGGG + Intergenic
998052349 5:139046422-139046444 ATGAGATTGGAGAGGTATGTGGG - Intronic
998699156 5:144677942-144677964 TTATGTTTGCTGAGGTATTTAGG - Intergenic
998731403 5:145081556-145081578 TTATGCTTCCAGAGGTGTGGAGG + Intergenic
999624638 5:153507308-153507330 TCATTCTTGCAGGGGTATGTGGG - Intronic
1000684089 5:164225100-164225122 CTGTGGTTGCATAGGCATGTTGG - Intergenic
1001526717 5:172434338-172434360 GGGGGCTTGCAGAGGTATCTTGG - Intronic
1002669325 5:180853170-180853192 CTGTGCTTGGAGATTTATGTAGG - Intronic
1003447239 6:6195788-6195810 TTGTTTTTGCAGAGGTAAGCAGG - Exonic
1004711903 6:18179378-18179400 TTCTGCTTTCAGAGTTATGCTGG + Intronic
1007624346 6:43234826-43234848 TTGTGGGGGCAGAGGTGTGTGGG + Intergenic
1007767509 6:44169728-44169750 TTGTGATAGCAGAGGTTGGTGGG - Intronic
1012003747 6:93686008-93686030 TGTTGCTTGCAGATGTTTGTTGG - Intergenic
1014036227 6:116769588-116769610 TTGAGCTTGGAGAGGTAGGCAGG - Intergenic
1014811971 6:125896940-125896962 TTGTGTTTGCACACGTATTTAGG + Intronic
1018270908 6:162076330-162076352 TTGTCCTTGGACAAGTATGTTGG + Intronic
1020544568 7:9508912-9508934 TTGTGCATGCAGAGATATATTGG + Intergenic
1021775969 7:24055811-24055833 ATGTGCTGGCAGAGGGAAGTTGG + Intergenic
1022047282 7:26631921-26631943 TTGTGGTTGCAGGGGCAGGTGGG + Intergenic
1023071633 7:36440527-36440549 TTGTGCTTGCAGAGGTATGTAGG + Intronic
1025717610 7:63976652-63976674 CTGGGTTTGCAGTGGTATGTGGG - Intergenic
1025957396 7:66193422-66193444 TTTTGCTGGCAGAGTTATGCTGG + Intergenic
1029697556 7:102224126-102224148 CTGTGCATGCAGATGTCTGTTGG + Intronic
1030726166 7:112926989-112927011 TTAAGCTTTCAGAGGTATTTTGG - Intronic
1031905977 7:127459667-127459689 TGGTGCTTGCGGATGTTTGTTGG - Intergenic
1033907405 7:146222572-146222594 GTGTGCGTGCACATGTATGTAGG + Intronic
1034165836 7:149024425-149024447 TTTTGCTTGCAGGGATGTGTGGG - Intronic
1040308809 8:46226051-46226073 TTTTGCTTGTGGAGGTCTGTGGG - Intergenic
1044104907 8:88192352-88192374 TTGTTCTTGCTCAGGTATTTAGG - Intronic
1045423814 8:102043029-102043051 TTCTGGTTGGAGTGGTATGTTGG - Intronic
1046101979 8:109625148-109625170 TTATGCATGCTGAGGTATGTTGG + Intronic
1046207878 8:111026273-111026295 GTGTGCATGCATATGTATGTAGG + Intergenic
1050067222 9:1772530-1772552 TTCTGCTTGCACAAGTATCTAGG + Intergenic
1050328153 9:4517625-4517647 GTTTGCTTGCAGAGGTATGTGGG + Intronic
1050755900 9:9002888-9002910 TTTTACTTTCAGTGGTATGTTGG + Intronic
1050777359 9:9282317-9282339 GTGTGCATGCAGAGGTTTGGGGG + Intronic
1051916607 9:22216560-22216582 GTGTCCTTGCGGAGGTAGGTTGG - Intergenic
1053038783 9:34851205-34851227 TGGTGCCTGCAGAGGCATGCAGG + Intergenic
1056004074 9:82248415-82248437 ATGTGTTTTCAGAGGTATATTGG - Intergenic
1056768287 9:89458618-89458640 GTGTGCTTACATGGGTATGTGGG - Intronic
1057157492 9:92856091-92856113 CTGTGTTTTCTGAGGTATGTGGG - Intronic
1058806371 9:108595939-108595961 TAGTTTTTGCAGAGGTATGTTGG + Intergenic
1062679699 9:137772207-137772229 TTGTGCTTGGAGAGGTGTGCTGG - Intronic
1187274356 X:17805243-17805265 ATGTGCCTGCAGAGGCATGCAGG + Intronic
1187979124 X:24736128-24736150 TTGTTTTTTCAGAGGAATGTAGG + Intronic
1191593097 X:62911251-62911273 TCGTACTTGCAGATGTTTGTTGG + Intergenic
1193359575 X:80564453-80564475 TAGTGCTTTCAGTGCTATGTCGG - Intergenic
1200204396 X:154305408-154305430 TTGTCCTCGCAAAGGTATGCCGG + Exonic