ID: 1023072979

View in Genome Browser
Species Human (GRCh38)
Location 7:36456099-36456121
Sequence GAGTGTAAGTATGTGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023072979_1023072981 22 Left 1023072979 7:36456099-36456121 CCAGAATCCACATACTTACACTC No data
Right 1023072981 7:36456144-36456166 GAAAATTTAACCTAAAGAAGAGG No data
1023072979_1023072983 24 Left 1023072979 7:36456099-36456121 CCAGAATCCACATACTTACACTC No data
Right 1023072983 7:36456146-36456168 AAATTTAACCTAAAGAAGAGGGG No data
1023072979_1023072982 23 Left 1023072979 7:36456099-36456121 CCAGAATCCACATACTTACACTC No data
Right 1023072982 7:36456145-36456167 AAAATTTAACCTAAAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023072979 Original CRISPR GAGTGTAAGTATGTGGATTC TGG (reversed) Intergenic
No off target data available for this crispr