ID: 1023079127

View in Genome Browser
Species Human (GRCh38)
Location 7:36511362-36511384
Sequence CCAAGTGTGCCCAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023079119_1023079127 -9 Left 1023079119 7:36511348-36511370 CCCAAGTCCCCTCACCAAGTGTG No data
Right 1023079127 7:36511362-36511384 CCAAGTGTGCCCAGGGAAGAAGG No data
1023079120_1023079127 -10 Left 1023079120 7:36511349-36511371 CCAAGTCCCCTCACCAAGTGTGC No data
Right 1023079127 7:36511362-36511384 CCAAGTGTGCCCAGGGAAGAAGG No data
1023079118_1023079127 -8 Left 1023079118 7:36511347-36511369 CCCCAAGTCCCCTCACCAAGTGT No data
Right 1023079127 7:36511362-36511384 CCAAGTGTGCCCAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023079127 Original CRISPR CCAAGTGTGCCCAGGGAAGA AGG Intergenic
No off target data available for this crispr