ID: 1023079367

View in Genome Browser
Species Human (GRCh38)
Location 7:36513245-36513267
Sequence GAGAGGCTCAGTGCCCGCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 198}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023079360_1023079367 6 Left 1023079360 7:36513216-36513238 CCCTGTGCTCCCCAGGGGTGCAT 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 198
1023079359_1023079367 9 Left 1023079359 7:36513213-36513235 CCTCCCTGTGCTCCCCAGGGGTG 0: 1
1: 0
2: 2
3: 52
4: 472
Right 1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 198
1023079364_1023079367 -5 Left 1023079364 7:36513227-36513249 CCAGGGGTGCATGCTCCTGAGAG 0: 1
1: 0
2: 0
3: 28
4: 178
Right 1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 198
1023079354_1023079367 20 Left 1023079354 7:36513202-36513224 CCAAGCCTCTGCCTCCCTGTGCT 0: 1
1: 1
2: 10
3: 91
4: 759
Right 1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 198
1023079362_1023079367 -3 Left 1023079362 7:36513225-36513247 CCCCAGGGGTGCATGCTCCTGAG 0: 1
1: 0
2: 0
3: 15
4: 193
Right 1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 198
1023079355_1023079367 15 Left 1023079355 7:36513207-36513229 CCTCTGCCTCCCTGTGCTCCCCA 0: 1
1: 1
2: 17
3: 108
4: 1139
Right 1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 198
1023079353_1023079367 21 Left 1023079353 7:36513201-36513223 CCCAAGCCTCTGCCTCCCTGTGC 0: 1
1: 0
2: 3
3: 86
4: 802
Right 1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 198
1023079361_1023079367 5 Left 1023079361 7:36513217-36513239 CCTGTGCTCCCCAGGGGTGCATG 0: 1
1: 0
2: 0
3: 19
4: 199
Right 1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 198
1023079363_1023079367 -4 Left 1023079363 7:36513226-36513248 CCCAGGGGTGCATGCTCCTGAGA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023079367 Original CRISPR GAGAGGCTCAGTGCCCGCCT TGG Exonic
900345394 1:2208108-2208130 GGGAGGCTCAGCCCCTGCCTGGG + Intronic
900555349 1:3277515-3277537 GAGAGGGTCGGGGCCAGCCTGGG - Intronic
900985898 1:6072681-6072703 GCCAGGCTCAGTTCCCGCCAGGG - Intronic
901027483 1:6286270-6286292 GGGCGGATCAGTGCCCACCTAGG + Intronic
901408167 1:9064108-9064130 GTGAGCCACAGTGCCAGCCTGGG + Intronic
901515953 1:9746116-9746138 GACAGCCTCTGTGCCCACCTGGG - Intronic
904130563 1:28272533-28272555 GAGCTGCTCAGTGCCTGCCCTGG - Intronic
904307994 1:29602676-29602698 GAAAGGCTGAGTGCCTGCCGGGG + Intergenic
905468672 1:38175495-38175517 GAGGGGCTCAGAGCCCCACTGGG - Intergenic
905881739 1:41468470-41468492 GACAGGCTCAGGGCACTCCTGGG - Intergenic
909597385 1:77421879-77421901 GAGAGGCTCAGTCACAGCCATGG + Intronic
910117816 1:83751790-83751812 GAAAGGATTAGTGCCCTCCTAGG - Intergenic
910357524 1:86377335-86377357 CAGATACTCAGTGCCAGCCTGGG - Intronic
916791874 1:168132303-168132325 GAGAGCCACAGCGCCCGGCTTGG - Intronic
919779676 1:201213820-201213842 GAGAGGCTCAGAGGTCTCCTAGG + Intronic
920061290 1:203228699-203228721 GATGGGCACAGTGCCCTCCTGGG - Intronic
920110371 1:203583112-203583134 TAGAGGCTCAGTCCCCCACTGGG - Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922586012 1:226735971-226735993 AAGAACCTCAGTGCCCTCCTGGG - Exonic
922717980 1:227886882-227886904 GAGAGGCTCAGCGCCGGGGTGGG - Intergenic
922802902 1:228372185-228372207 GCCAGGCTCTGTGCCCACCTGGG - Exonic
924707808 1:246512864-246512886 GAGAGGCTGAGTCCCAGCCAGGG - Intergenic
1066064246 10:31750620-31750642 TGTAGGCCCAGTGCCCGCCTCGG + Intergenic
1067420833 10:46145337-46145359 GTGGGGCTCAGTGCCATCCTTGG - Intergenic
1067473698 10:46553131-46553153 GAGAGGCTCAGTGACCCCCAAGG + Intronic
1067506172 10:46851804-46851826 GTGGGGCTCAGTGCCATCCTTGG - Intergenic
1069831772 10:71286173-71286195 GAGGGGCCCAGTGGCCACCTAGG + Intronic
1070586661 10:77771803-77771825 GTGAGGCTCACTGCCCTCCTAGG + Intergenic
1070887600 10:79918802-79918824 GTGGGGCTCAGTGCCATCCTTGG - Intergenic
1073482861 10:103797984-103798006 GAGAGGGTCAGCGACCGCTTGGG + Intronic
1074165476 10:110871062-110871084 CAGTGGCTAAGTCCCCGCCTGGG + Intergenic
1074525251 10:114257513-114257535 GAGAGGCTAAGTGACTGCCGAGG + Intronic
1075210102 10:120483687-120483709 GAGTAGATCAGTGCCCTCCTTGG + Intronic
1075274433 10:121080581-121080603 GACAGGCTCAGTGACAGGCTGGG - Intergenic
1078436967 11:11333450-11333472 GAGAGGTTCAGTAACCTCCTTGG + Intronic
1080682674 11:34490908-34490930 GAGGGGCTCATTCCCCTCCTAGG + Intronic
1083920616 11:65780069-65780091 GCGAGGCTTTGTCCCCGCCTCGG - Exonic
1084689781 11:70718396-70718418 GGAAGGCACAGTGCACGCCTTGG - Intronic
1088241900 11:107781641-107781663 GTGAGGCACTGTGCCCGGCTGGG + Intergenic
1089300507 11:117495972-117495994 GAGCGCCTCATTGCCTGCCTGGG + Intronic
1089354276 11:117839756-117839778 GAGATGCTCAGTGCCTGGATTGG - Intronic
1092168765 12:6360240-6360262 CAGAGCCTCATTGCTCGCCTGGG - Intronic
1094528966 12:31254336-31254358 GAGAGGCTCAGTGGCAGAATGGG - Intergenic
1096600084 12:52722935-52722957 CAGAGGCTCATTTCCAGCCTTGG - Intergenic
1099371415 12:81835399-81835421 CAGACGCTCAATGCCAGCCTGGG + Intergenic
1099838450 12:87937088-87937110 GGAAGGCCCAGGGCCCGCCTAGG - Intergenic
1102341588 12:112125921-112125943 GCTGGGCTCAGTGCCGGCCTGGG + Exonic
1102942200 12:116953299-116953321 CAGAGGCTCAGGGCCAGGCTGGG + Intronic
1104593287 12:130101718-130101740 GAGAGGCTCTCTGCTCCCCTAGG - Intergenic
1104795422 12:131513843-131513865 GCTAAGCTCAGTGCCTGCCTAGG + Intergenic
1105914672 13:24902067-24902089 GAGAGCCTCAGTGCCAGCCTAGG - Intronic
1113280017 13:108778836-108778858 GAGAGGTTCTATGCCAGCCTTGG - Intronic
1113967304 13:114161299-114161321 GGGCGGCGCCGTGCCCGCCTTGG - Intergenic
1116919680 14:50560165-50560187 GGGAGGCTCCGTGCCCGCGCTGG - Exonic
1119609389 14:76048819-76048841 GGGAGGCTCAGGGCCCACCCTGG - Intronic
1121465903 14:94115489-94115511 CAGAGCCTCAGTGTCTGCCTTGG - Intronic
1122018860 14:98819964-98819986 GAGGGGCACAGTGACCACCTGGG - Intergenic
1122230809 14:100305707-100305729 GAGTGGTTCAGTGCCCTCCAAGG + Intronic
1123051602 14:105546826-105546848 GACAGGGTCAGCGCCGGCCTCGG + Intergenic
1123077014 14:105672529-105672551 GACAGGGTCAGCGCCGGCCTCGG + Intergenic
1123175269 14:106410722-106410744 GAGAGTCTCAGGGACCCCCTAGG + Intergenic
1123189701 14:106557176-106557198 GAGAGTCTCAGGGACCGCCCTGG + Intergenic
1124558313 15:30747838-30747860 GAGAGGCACAGTGCATGCTTGGG + Intronic
1124629571 15:31328623-31328645 TGGAGGCTCAGCGCCCGCCCTGG - Intronic
1124672946 15:31657808-31657830 GAGAGGCACAGTGCATGCTTGGG - Intronic
1128452095 15:67811595-67811617 GAGAGCCACAGTGCCCGGCCAGG - Intergenic
1129185723 15:73905106-73905128 GAGAGGCTCAGGGCCCACTTAGG + Intergenic
1130528259 15:84725384-84725406 GAAGGGCTCAGTGGCTGCCTGGG - Intergenic
1130882425 15:88066743-88066765 GACAGGAACAGTGCCAGCCTGGG + Intronic
1132071662 15:98783040-98783062 GAGAAGCTCTCTGCCTGCCTAGG + Intronic
1132251697 15:100340183-100340205 GAGAAGCTGAGTGCTCGTCTGGG + Intronic
1132519018 16:378940-378962 GAGAGCCTGAGTCCTCGCCTGGG - Intronic
1133233244 16:4376235-4376257 AGGAGGCTCAGGGCCCGGCTGGG - Intronic
1133272718 16:4618315-4618337 CCGAGGCTAAGTGCCTGCCTGGG - Intronic
1133771093 16:8867650-8867672 AAGAGGCGCAGAGCCCGGCTGGG - Intronic
1134529016 16:14967954-14967976 GCGAGCCACAGTGCCCCCCTTGG - Intergenic
1136179814 16:28543433-28543455 GAGAGGTTAGGTGCCCTCCTGGG - Intergenic
1136538941 16:30917678-30917700 GAGAAGCTCAGGGTCAGCCTTGG - Intergenic
1138315337 16:56064795-56064817 GATAGGCTCAGTGACCACCAAGG + Intergenic
1138420320 16:56894740-56894762 GACAATCTCAGTGCCCACCTGGG - Intronic
1139867348 16:70073024-70073046 GCGAGCCACAGTGCCCCCCTTGG + Intergenic
1140069983 16:71640806-71640828 GAGAGGCTCTATGCCCGCAAGGG + Exonic
1141461117 16:84179386-84179408 GACAAGCTCAGTGAGCGCCTGGG - Exonic
1141531137 16:84648149-84648171 GAGAGGCGCGGTGCCCGTCCCGG + Intergenic
1141699072 16:85634176-85634198 GGGAGGCTGAGTCCCGGCCTCGG - Intronic
1141861305 16:86718316-86718338 GAGAGTCTCAGGCCCCGCCCTGG + Intergenic
1142133527 16:88441580-88441602 GGGAGGCCCAGCGCCCACCTGGG - Intergenic
1142572727 17:885635-885657 GAGAGGCGCCATGCCCACCTGGG + Intronic
1143303424 17:5927795-5927817 CAGAAGCTCAGTGCCTGCCTAGG + Intronic
1143323886 17:6086017-6086039 AAGAGGCTCAGAGCCTGGCTGGG + Intronic
1144703747 17:17354249-17354271 GAGGGGCTCAGAGCACCCCTGGG + Intergenic
1144959953 17:19039335-19039357 GAGAGGTTGAGTGCCCCCCCAGG - Intronic
1144975207 17:19135189-19135211 GAGAGGTTGAGTGCCCCCCCAGG + Intronic
1146503154 17:33381569-33381591 GAGAGTTTCAGTGCCCCCCCGGG - Intronic
1146520469 17:33521920-33521942 GAGGGCCTCCCTGCCCGCCTAGG - Intronic
1147536532 17:41325886-41325908 GAGAGGCTGAGTCCCAGCCAGGG + Intergenic
1151756624 17:76078994-76079016 GAGACGCTCAATGCCTGCCCAGG - Intronic
1151890284 17:76947441-76947463 GAGAGCCTCACAGCCAGCCTGGG + Intronic
1152023300 17:77793138-77793160 CAGAGACCCAGTGCCAGCCTGGG + Intergenic
1152035561 17:77870149-77870171 GTGAGGCTGGGTGTCCGCCTCGG + Intergenic
1152120332 17:78414513-78414535 GAGAGGCTCAGTGGGCAGCTGGG + Intronic
1152660690 17:81540599-81540621 GCCAGGTTCAGAGCCCGCCTCGG + Exonic
1160681031 19:411670-411692 GAGAGGCTCTGCCCCCACCTGGG - Intergenic
1162019301 19:7861454-7861476 AACAGGCTGAGTGCCAGCCTTGG - Intronic
1164750553 19:30651302-30651324 AAGAGGCACAGTGCCCAACTGGG - Intronic
1168270475 19:55247181-55247203 CAGGGGCTGAGTGCCCACCTTGG + Intronic
925618066 2:5762707-5762729 CAGAGGCTCAGGGCCCACCTAGG - Intergenic
926196315 2:10765613-10765635 GAGAGGCTCAGGCCCCTGCTGGG + Intronic
927448892 2:23189467-23189489 GAGAGACTCAGTGCCTTGCTGGG - Intergenic
927466885 2:23343529-23343551 ATGGGGCTCAGTGCCTGCCTGGG + Intergenic
927864228 2:26578507-26578529 GTGAGGCTCATTGATCGCCTGGG + Intronic
929547089 2:42862839-42862861 GCGAACCTCAGGGCCCGCCTCGG - Intergenic
930478194 2:51912229-51912251 GTGATGCTCAGTGCCCATCTTGG + Intergenic
932936952 2:76114204-76114226 GTGAGCCACAGTGCCCGACTGGG + Intergenic
933843755 2:86308705-86308727 GAGAGGCTGAGTGACTGCCCAGG - Intronic
935292319 2:101621069-101621091 GGGAGCCACAGTGCCCGGCTGGG + Intergenic
936146287 2:109982341-109982363 CAGAGGCTCAGTTTCCCCCTGGG - Intergenic
936198404 2:110389138-110389160 CAGAGGCTCAGTTTCCCCCTGGG + Intergenic
937670930 2:124536549-124536571 GAGAGGTTCAGTGACTGCCAAGG + Intronic
938255618 2:129857964-129857986 GAGAGGCACAGTGGCCACCCGGG - Intergenic
938312161 2:130300520-130300542 GAGCTGCTCAGTGCCTGGCTTGG - Intergenic
938812550 2:134867043-134867065 CAGAGGCTCAGTGCTGGGCTGGG - Intronic
945971769 2:216237915-216237937 GAGAGGCCCAGTGCCCCACATGG + Intergenic
947612460 2:231532494-231532516 GAGAGGCTCAGTGGCCACAATGG + Intergenic
948149971 2:235737511-235737533 AGAAGGCTCAGTGCCCTCCTAGG + Intronic
948281367 2:236750116-236750138 GAGAGGCTGAGTCCCCACATTGG + Intergenic
948637872 2:239351721-239351743 GAGAGGCTCAGGGTCTGTCTGGG - Intronic
948865030 2:240770885-240770907 GAGAGGCACCCTGCCCTCCTGGG - Intronic
948939975 2:241190730-241190752 GAGAGGCCCTGTGCCCTCCCTGG - Intronic
1171421894 20:25023118-25023140 GAGAGGCTGAGTGCCCTCGGTGG - Intronic
1172313031 20:33932754-33932776 GAGGGGTTCAGTGCCAGCCCAGG + Intergenic
1172650024 20:36496257-36496279 GAGAGACTCAGTGCTCCCCCTGG - Intronic
1174538589 20:51271935-51271957 CAGAGGCTCAGTGCCCCCTTGGG - Intergenic
1175217474 20:57399154-57399176 GGGAGGCTCAGGGCCCGACAGGG + Intronic
1175968485 20:62671915-62671937 GAAATGCTGAGTGCCCGCCGTGG - Exonic
1175970213 20:62682514-62682536 GAGAGCCTCAGTCCCCTCCGTGG - Intronic
1178884769 21:36476373-36476395 GGGAGGCTCAGTGCCCACAGTGG - Intronic
1180053882 21:45347173-45347195 GAGGGGCTCAGAGCCAGCCTGGG - Intergenic
1180875210 22:19171919-19171941 GAGAGGCGCTGTGCCCGCCAGGG - Intergenic
1181017742 22:20080691-20080713 GACAGGGCCAGTGCTCGCCTGGG + Intronic
1181095265 22:20500778-20500800 CAGTGGCTCAGTGCCCAGCTGGG + Intronic
1182647812 22:31824683-31824705 GTGAGCCACAGTGCCCGGCTAGG - Intronic
1183450604 22:37892763-37892785 GAGTGGCCCAGTGCCAGCCAGGG + Intergenic
1183637912 22:39076236-39076258 GTGAGCCACTGTGCCCGCCTGGG + Intronic
1184572083 22:45331765-45331787 GAGAGGCTCAGTCTCAGCCCAGG - Intronic
1184872042 22:47246985-47247007 GTGAGGCTGAGTGCCTGCTTAGG + Intergenic
1185026451 22:48416817-48416839 GAGAGGATGGGTGCCCGGCTCGG - Intergenic
1185163129 22:49241476-49241498 GAGAAGCTCAGTGACCTCCTGGG - Intergenic
1185163148 22:49241594-49241616 GTGAAGCTCAGTGACCTCCTGGG - Intergenic
1185322657 22:50209084-50209106 GAGATGCTGAGTGCCCACCTGGG + Intronic
959057715 3:101584419-101584441 GTGAGGCACTGTGCCTGCCTGGG + Intronic
961245429 3:125448415-125448437 GTGAGCCACAGTGCCCGGCTCGG + Intronic
961870600 3:129985024-129985046 GAGAGACTCAGTTCCTGCTTGGG + Intergenic
963359053 3:144247053-144247075 GAGAGGATCAGTGCATGCTTGGG - Intergenic
966901384 3:184488789-184488811 GAGAGGGTGAGTGCCTGCGTCGG - Intronic
968228253 3:196989378-196989400 CAGAGGGTCAGGGCACGCCTCGG + Intronic
968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG + Intronic
968657458 4:1784881-1784903 GAGAGGGTGGGTGCCCCCCTGGG + Intergenic
968745558 4:2358040-2358062 CAGAGGCTCAGTCCCCTCTTTGG - Intronic
968809820 4:2794754-2794776 GACAGGCTCTGGGCCTGCCTTGG + Intronic
971029260 4:22619522-22619544 CAGAAGCTCAATACCCGCCTGGG - Intergenic
978835974 4:113150065-113150087 GAGGGGATCAGTGCAGGCCTCGG + Intronic
984484442 4:180349923-180349945 GAGAGGATCAGTGTCCTCATTGG + Intergenic
985543250 5:496458-496480 GAAAGGATCAGTGCCCGGCAGGG - Intronic
988527736 5:32001320-32001342 GAGAGGCTCAGGGGCCGCCGAGG + Intronic
989206152 5:38810562-38810584 GTGAGGCACAGTGCCCGGCCGGG - Intergenic
994806832 5:104458837-104458859 GTGAGCCTCTGTGCCCGCCCTGG + Intergenic
995831640 5:116361368-116361390 GAGAGCCTCAGCGCCTGCCGCGG - Intronic
995858128 5:116615044-116615066 GAGAGCTTCAGTGCCAGGCTGGG + Intergenic
996783690 5:127215570-127215592 GAGTGGCTCAGTGTCCTTCTGGG + Intergenic
997022566 5:130018809-130018831 GAATGGCTCAGTGCCCTTCTAGG + Intronic
997869928 5:137498329-137498351 GAGAGGCTCCGCGCCCCCCAGGG + Intronic
997984491 5:138492038-138492060 GCGAGGCTCGGTGCCCGCAGAGG + Intergenic
998040414 5:138947850-138947872 GGGAGGCTAAGTGCCAGCCATGG - Intronic
998114278 5:139524453-139524475 GAAAGGCTCAGTGGCCCCCTGGG + Intergenic
1003323403 6:5073139-5073161 GATCGGCCCACTGCCCGCCTCGG - Intergenic
1006418249 6:33918038-33918060 GAGGGGCTCATTGTCCTCCTGGG - Intergenic
1006730056 6:36230078-36230100 GCGAGGCTCAGAGCCCTCCAGGG + Intronic
1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG + Intergenic
1007309683 6:40935390-40935412 GAGGTGCTCACTGCCAGCCTGGG - Intergenic
1007356355 6:41320648-41320670 GAGAGGCTCATCGCCTGGCTTGG - Intergenic
1012946302 6:105469496-105469518 AAGAGGCACAGTGCTGGCCTGGG + Intergenic
1017947189 6:159105160-159105182 GAGAGGCTCAGTGCCTTCATGGG + Intergenic
1019716686 7:2542479-2542501 GAGAGGGGCAGTGCCCGCTCAGG + Intronic
1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG + Exonic
1024747091 7:52420590-52420612 GAGAGACTCAGAGCCCGGTTGGG - Intergenic
1029695585 7:102211111-102211133 GAGAGGCTGATTGCACCCCTGGG + Intronic
1030627585 7:111860645-111860667 GAGAGGCTCAGGGCCAGCGTAGG - Intronic
1031375181 7:121015806-121015828 GAAAGGCTCAATGCTGGCCTAGG + Exonic
1034489789 7:151387104-151387126 GAGAGGCTCTGTGACTGTCTGGG - Intronic
1035289381 7:157827849-157827871 CAGAGTCTCAGTGCCTTCCTCGG + Intronic
1035690741 8:1557817-1557839 GACAGGATCAGTGCCCACCCTGG + Intronic
1037813338 8:22099171-22099193 GAGAGGGTCCCGGCCCGCCTGGG - Intronic
1042006209 8:64182913-64182935 GAGAGGCTCTGTGCCTGCTAAGG - Intergenic
1042692865 8:71522816-71522838 TAGAAGCTCAGGGCCAGCCTGGG - Intronic
1043984955 8:86682984-86683006 AGGAGGTTCAGTGCCTGCCTGGG + Intronic
1046670296 8:117049639-117049661 GAAGGGCACAGTGCCCACCTGGG - Intronic
1046946891 8:119982641-119982663 GGGAGTCTCAGTGTCAGCCTGGG - Intronic
1049418199 8:142505134-142505156 CAGAGGCACAGTGCCCGCACAGG - Intronic
1051544414 9:18258444-18258466 GAGAGCCTCAGAGCCTGCCAGGG + Intergenic
1053284158 9:36839648-36839670 GAGAGCCTCAGGCCCCTCCTTGG + Exonic
1056265249 9:84890335-84890357 GACAGGCTCAGAGCCAGACTGGG + Intronic
1059735662 9:117097112-117097134 AGGAGGCTCAGTGACCACCTAGG + Intronic
1061282310 9:129604428-129604450 GTGAGGGGCAGTGCCCACCTGGG + Intergenic
1061288564 9:129638121-129638143 GAGAGGCTCTGTTCCCACCCAGG - Exonic
1062056675 9:134472594-134472616 CTGAGTCTCAGTGCCTGCCTTGG + Intergenic
1062101596 9:134731407-134731429 GATAGCCACAGTGCCCGCCCAGG + Intronic
1062119545 9:134826962-134826984 GGGAGACTCAGTCCTCGCCTGGG - Intronic
1203435221 Un_GL000195v1:131370-131392 GAGATGCTCAAGGCCCACCTCGG - Intergenic
1188487546 X:30699644-30699666 AGGAGGCACAGTGCCCGGCTGGG + Intronic
1193056765 X:77160289-77160311 GAGAGGCTCTGTGCCTACCAGGG - Intergenic
1194346686 X:92773764-92773786 GGGATGCTCTGTGCCCGCCAAGG - Intergenic
1195329560 X:103786079-103786101 GAGAGGCTTAGTGCCTCCCTTGG - Intronic
1197912183 X:131494988-131495010 GAGTAGATCAGTGCCCTCCTTGG + Intergenic
1200085677 X:153603478-153603500 GAGGGGCTCAGGGGCTGCCTAGG - Intergenic
1200345654 X:155444774-155444796 CAGGAGCTCAGTGCCAGCCTGGG - Intergenic
1200655019 Y:5890408-5890430 GGGATGCTCTGTGCCCGCCAAGG - Intergenic