ID: 1023081935

View in Genome Browser
Species Human (GRCh38)
Location 7:36534174-36534196
Sequence AGGGTGGGCCTTCATCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023081935_1023081946 29 Left 1023081935 7:36534174-36534196 CCTTGGGGATGAAGGCCCACCCT 0: 1
1: 0
2: 1
3: 18
4: 188
Right 1023081946 7:36534226-36534248 TCCTGCTGTCCTTCTGCTGATGG 0: 1
1: 0
2: 0
3: 24
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023081935 Original CRISPR AGGGTGGGCCTTCATCCCCA AGG (reversed) Intronic
900265670 1:1755895-1755917 AGCGTGGCCCTACAGCCCCAGGG + Intronic
900726270 1:4218367-4218389 AGGGTGGGCCTTAATCCAACAGG - Intergenic
901174555 1:7289419-7289441 AGGGTGCCCCTTCCTCTCCAAGG - Intronic
902790058 1:18761737-18761759 AGTTTGGGCGTTCATTCCCAAGG + Intergenic
905675334 1:39820667-39820689 AGGCTGGGCAGGCATCCCCAGGG + Intergenic
905770432 1:40634552-40634574 AGGGTGGGCCACCTTACCCAAGG - Intronic
905875123 1:41427431-41427453 AGCATGGGCCTCCCTCCCCAGGG + Intergenic
906241580 1:44245422-44245444 AGGGAGCCCCTTCAGCCCCATGG + Intronic
906980125 1:50621017-50621039 AGGGTGTGCCTCCCTCCACAGGG - Intronic
909231680 1:73099781-73099803 AGGGTGTGCCTCCTTCCACAGGG + Intergenic
915948604 1:160172510-160172532 AGGGTGGGCCTTGAACTTCATGG + Intronic
919755743 1:201065055-201065077 AGGAGGGGCCTCCCTCCCCAAGG + Intronic
920682591 1:208084252-208084274 AGGCTGAGCCCACATCCCCAGGG - Intronic
920689537 1:208135325-208135347 GGAGTGGGACCTCATCCCCATGG - Intronic
922031967 1:221810009-221810031 AAGGAGGCCCTTCATTCCCAAGG + Intergenic
922750081 1:228066157-228066179 AGGGTGGGACTGCTTCCCCCAGG - Intergenic
922797116 1:228345657-228345679 GGGGAGGGCCTCCATCCACAGGG - Intronic
1062946665 10:1466665-1466687 AGGGTGGGAATTAGTCCCCACGG - Intronic
1063620159 10:7639645-7639667 TGTGTAGGCCTTCATCCCCTTGG - Intronic
1063898738 10:10709933-10709955 AGGGGGAGCTTTCTTCCCCAGGG + Intergenic
1065366459 10:24942023-24942045 AGGGTGGGACTTCTTTGCCACGG + Intronic
1069923555 10:71832458-71832480 AGCCTGGGCATTCTTCCCCAAGG - Intronic
1070548775 10:77474338-77474360 AGGGTGGGCCTTCATCCAACAGG + Intronic
1072326904 10:94307716-94307738 AGGGTGGGCCTTAATCCAGTGGG - Intronic
1073064554 10:100750414-100750436 AGGCTGGGCTTTCACTCCCACGG + Intronic
1074571310 10:114626799-114626821 AGGGTGGGCCTTAATCCACTGGG + Intronic
1076175786 10:128366888-128366910 AGGGTGGGCATTGACCCCCACGG + Intergenic
1076822167 10:132944822-132944844 AGGGTGGGCCCTAAACCCCATGG - Intergenic
1076982149 11:210293-210315 AGAGTGTGACTTCATCCCTAAGG + Intronic
1077289963 11:1784496-1784518 AGGGTGGGCCCTAATCCCATAGG - Intergenic
1083107151 11:60369252-60369274 AAGGTGAGCTTTCATCTCCATGG - Intronic
1083152834 11:60803802-60803824 AGGTTGGGCTTTCATATCCATGG - Intergenic
1085532675 11:77201227-77201249 AGTGTGGGGCTTCCTCCCAAGGG + Intronic
1088262197 11:107954815-107954837 AGGCTGGAGCTTCATCACCAAGG - Intronic
1089776320 11:120839110-120839132 AGGGAGGGGCTTCATCCAGAGGG + Intronic
1091068719 11:132542749-132542771 AGGGTGAGGCTGCATCCCAAGGG - Intronic
1091320632 11:134646860-134646882 AGAGTGAGCCTGCATCTCCAGGG - Intergenic
1096254832 12:50056677-50056699 AGGGAGGGCCCCCCTCCCCAAGG + Intergenic
1096259723 12:50083002-50083024 AGGGTAGACCTCCATCCCCTGGG - Exonic
1097746562 12:63310222-63310244 TGGGTGTGCCTGCAACCCCAGGG + Intergenic
1098790534 12:74816778-74816800 AGCGTGGGCCTTCCACCCCTTGG + Intergenic
1099410781 12:82323883-82323905 AGGGTGGGCCTTAAATCCAATGG + Intronic
1102181949 12:110919472-110919494 AGGTGTGGCCTCCATCCCCAGGG - Intronic
1104906001 12:132213913-132213935 GGGTTGGGCCTGCATCTCCAGGG - Intronic
1105373015 13:19817880-19817902 AGGAAGGGCCATCAGCCCCAGGG + Intergenic
1105429920 13:20326999-20327021 AGAGTGGACCTTGATCCACAGGG - Intergenic
1105995716 13:25669976-25669998 AGGGCAGGCCACCATCCCCATGG + Intronic
1113185517 13:107682342-107682364 AGGGTGGGCCGTGAGTCCCAAGG - Intronic
1113890252 13:113731753-113731775 GGGGTGGAGCTTCATCCCCTGGG + Intronic
1118325367 14:64776989-64777011 AGGCTGGGCCTTCCTCCCTGGGG + Intronic
1119935904 14:78592400-78592422 AGGGTGGCTCTTGCTCCCCAAGG + Intronic
1120082814 14:80235277-80235299 AGTGTGGGCCTAAATCCTCATGG - Intronic
1121160099 14:91730201-91730223 AGGGTGGGCCCTCATCCAATAGG + Intronic
1121926604 14:97932746-97932768 AGGGTGGGTCTTCTTCTCCCAGG + Intronic
1122823134 14:104356997-104357019 TGGGTGGGCCTTAAATCCCACGG + Intergenic
1122907737 14:104809893-104809915 AGGGTAGGCCTTAATCCCATAGG - Intergenic
1123708200 15:22966016-22966038 AGGGTGGGCCCTCATCCAATAGG + Intronic
1124011530 15:25843194-25843216 AGGGTGGGCCTGCGTCTCCTAGG - Intronic
1124962651 15:34410074-34410096 TGGGCGGGCCTGCACCCCCATGG + Intronic
1124979276 15:34556296-34556318 TGGGCGGGCCTGCACCCCCATGG + Intronic
1126209945 15:46090539-46090561 AGGGAGGGCATAAATCCCCAGGG + Intergenic
1128691367 15:69726946-69726968 AGGGTTGGCCTCTAGCCCCAGGG - Intergenic
1128882203 15:71254246-71254268 AGGGTGGGCCTTCAGCGCTCTGG + Intronic
1130093435 15:80839552-80839574 AGGGTGGGCCTTCAGCAACGGGG + Intronic
1131049022 15:89334422-89334444 AGGGTGGGCCGCCGTCCCCCGGG + Intronic
1132864241 16:2085765-2085787 AGGCTGCACCTTCATCCCAAGGG + Intronic
1134374855 16:13662418-13662440 AGGGTGGGTCTTCTTCTCCTGGG - Intergenic
1137554667 16:49463077-49463099 AACATGGGCCTTCACCCCCATGG + Intergenic
1137950452 16:52778793-52778815 AGGGTTGGCATTCAAACCCAAGG - Intergenic
1139340053 16:66262601-66262623 AGGCTGTGCCCTCATCCCCTAGG - Intergenic
1140873176 16:79125593-79125615 AGGAAGGGTCTTCATCCCAAGGG - Intronic
1140896680 16:79330944-79330966 AGGGTTGGCCTTCATGTCCGGGG - Intergenic
1141507191 16:84485553-84485575 AGAGTGGGCCACCATCCCCAGGG - Intronic
1141613573 16:85197667-85197689 AGGGAGGGCCTTGATCCCGGAGG - Intergenic
1142424313 16:89992847-89992869 GGGTTGGGCCTTTATCCCCTTGG + Intergenic
1142441927 16:90103981-90104003 AGAGTGGGCATTCATCAGCAGGG - Intergenic
1142693946 17:1623197-1623219 AGCCTGGGCCTGCTTCCCCAAGG + Intronic
1142693981 17:1623352-1623374 GGGGTCGGCCTTCATGCCCATGG + Intronic
1142770777 17:2095184-2095206 CGGGAGGACTTTCATCCCCAGGG - Intronic
1143364884 17:6400577-6400599 AGGGTGGGTCTTCCTCTCCCAGG - Intronic
1143977981 17:10844416-10844438 AGGGAGGGGCTCCAGCCCCAGGG + Intergenic
1144669477 17:17124915-17124937 CAGGTGGGCCTTCCTGCCCAAGG - Intronic
1147052195 17:37803659-37803681 AGAGTGGGGATTCAACCCCAGGG + Intergenic
1147427375 17:40352292-40352314 AGTGAGGGCCTTCTTCTCCATGG - Intronic
1147436590 17:40420259-40420281 ATGGTGGGCATGCTTCCCCAAGG + Intergenic
1150227006 17:63529723-63529745 AGGCTGGGCATTCTACCCCATGG - Intronic
1152038711 17:77889576-77889598 AGGGTGGGACTTCAGTCCAAAGG + Intergenic
1152434750 17:80269187-80269209 AGGGTGGGTCTTCCTCTCCCAGG + Intronic
1153254410 18:3156165-3156187 AATGTGGGCCTCCACCCCCAGGG - Intronic
1154321224 18:13354868-13354890 AGGGTGGACCTTGTGCCCCAGGG + Intronic
1155045815 18:22102055-22102077 AGGGAGGGCCAGCATCCCCATGG + Intergenic
1155162769 18:23208972-23208994 AGAGTGGGCCTTCAATCCAATGG - Intronic
1155620432 18:27772102-27772124 AGGGTGGGCCACCATCCCTTTGG - Intergenic
1156507543 18:37607891-37607913 ACAGTGGAGCTTCATCCCCAGGG - Intergenic
1157064469 18:44331589-44331611 AGGGTGGGTCTTCCTCTCCCAGG - Intergenic
1160287644 18:77559758-77559780 AGGGTGGGCCTTAAATCCAATGG - Intergenic
1161808039 19:6456368-6456390 AGGCTGTGCCCTCTTCCCCAGGG - Intronic
1162015856 19:7846202-7846224 AGCCTTGGCCTTCATGCCCAGGG + Intronic
1162087477 19:8257264-8257286 AGGGTGGGGCTTCATCACCCAGG - Intronic
1162561942 19:11422190-11422212 AGGGTGGGACTTCTTTCCCTTGG + Intronic
1163232741 19:16015432-16015454 ACGCTGGGCCTTCATCTGCATGG + Intergenic
1163384984 19:16994227-16994249 AGGGTAGACCTTCATGCCCTTGG + Intronic
1163483996 19:17575832-17575854 AGGGTGGGCCCTAATCCACATGG - Intronic
1165150311 19:33756485-33756507 AGGTTGGGTCTTCTCCCCCAAGG + Intronic
1166999832 19:46739215-46739237 AGGGTGGGCATTCACCGCCCTGG + Intronic
1167041803 19:47027190-47027212 AGGCTGGGGCTTCATCACCCAGG - Intronic
1167765257 19:51478502-51478524 AGGGCGGCCTTTCCTCCCCAGGG - Intergenic
925302143 2:2824865-2824887 AGGGTGGGCCCTGATCCCATAGG - Intergenic
928524775 2:32128959-32128981 AGGGTGGGTCCTAATCCACAGGG - Intronic
932841362 2:75085765-75085787 AGGGTGGGAATTTAACCCCAGGG - Intronic
932987868 2:76748632-76748654 AGGGAGGGCCTTCATCTTAAAGG - Exonic
937973087 2:127565183-127565205 AGGGGTGGCCTCCATCCCCATGG - Intronic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
944300554 2:198119900-198119922 AAGGTGTGCATCCATCCCCACGG - Intronic
948021211 2:234734922-234734944 AGGGTGTGCCTTCTGCACCAGGG - Intergenic
948816540 2:240513183-240513205 AGGGTGGGCCTTCCTACCTGTGG - Intronic
1171149540 20:22815099-22815121 AATGTGGCCCTTCATCACCAAGG + Intergenic
1171412841 20:24958278-24958300 AGGGAGGGCCTGCATCACCCAGG - Intronic
1172319724 20:33986892-33986914 AGAGTGGGCCTTCACCTGCAAGG + Intergenic
1174944873 20:54974057-54974079 AGGGTGGGTCTTCTTCTCCCAGG + Intergenic
1178053832 21:28776903-28776925 AGGGTGGGCCTGCCTCTCCCAGG + Intergenic
1180203236 21:46239928-46239950 ACCCTGGGCCTTCATCCCCATGG + Intronic
1180901636 22:19377249-19377271 TGGGTGGGTCCTCATCCTCAGGG - Intronic
1181465648 22:23109316-23109338 AGGGTGGGCCTGCCCTCCCATGG + Intronic
1181838073 22:25627342-25627364 AGGGTTGGCCTTCAGCCACCAGG - Intronic
1183128671 22:35811355-35811377 AGGGTGGGCCTTAATCCAATTGG + Intronic
1183276203 22:36899824-36899846 AGAGTGGGGGTTCATCCTCATGG + Intergenic
1183634322 22:39051973-39051995 AGGGCGGGCCTGGAGCCCCAGGG - Intronic
1183637009 22:39070292-39070314 AGAGTGGGCCTGGAGCCCCAGGG - Intronic
1185184730 22:49392176-49392198 GGGGTGGGCCCGCATCCCCTGGG - Intergenic
950037519 3:9897802-9897824 TTGGTGGGCCTTCCTGCCCAGGG + Intergenic
954791841 3:53139183-53139205 AGGGTAGGCCTTCATGCCCCAGG - Intergenic
956495855 3:69824928-69824950 AGGGAGAGCCTTTATCCCCAGGG - Intronic
956726675 3:72162330-72162352 AGGGTGGGGCTTCATCCTCAGGG - Intergenic
960062885 3:113341224-113341246 GGGCTGGGGCTCCATCCCCACGG - Intronic
961644503 3:128385393-128385415 AATGTGGGCCTGCATTCCCAGGG - Intronic
961835557 3:129655583-129655605 AGAGGGGTCCATCATCCCCATGG + Intronic
964540064 3:157769685-157769707 AGGGTAGGCCTTTTTCCCTAGGG + Intergenic
965543211 3:169890761-169890783 TGGGTGGCCCTTCCTTCCCAAGG + Intergenic
966560738 3:181317417-181317439 AGGGTGGGCCTTGATCACAGAGG + Intergenic
968362194 3:198154948-198154970 AGAGTGGGCGTTCATCAGCAGGG - Intergenic
968643641 4:1727786-1727808 AGGCTGGGCTTGCATCCCCCAGG - Exonic
969421247 4:7097713-7097735 AGGGTGGGCCTTAATCCAGTAGG + Intergenic
971142463 4:23939016-23939038 AGGCTGGGCAGTCATCACCATGG - Intergenic
971157020 4:24094022-24094044 AGGGTGGGTATTAATTCCCAGGG + Intergenic
972581061 4:40396051-40396073 ACATTTGGCCTTCATCCCCAGGG + Intergenic
973020454 4:45199234-45199256 AGCATGGACCTTCATCCTCATGG + Intergenic
973637914 4:52877012-52877034 AGGGTACGTCTCCATCCCCATGG + Intronic
974115851 4:57578497-57578519 AGGGAGGGCCTTCCTCTCCCAGG - Intergenic
978190287 4:105903377-105903399 GGGGTGGGCCTTCATCACAGGGG + Intronic
982229439 4:153195099-153195121 AGGGTGGGCCTTAAATCCAATGG + Intronic
983219542 4:165031449-165031471 AGGGTGGGGCCTAATCTCCAGGG + Intergenic
985714370 5:1446972-1446994 GGGGTGGGACTTCATCGCCAGGG + Intergenic
985774446 5:1833589-1833611 AGGGTGGGCCCTGATCCACTAGG + Intergenic
990057680 5:51604532-51604554 AGGGTGGGCCTTAATCCAATAGG + Intergenic
992488887 5:77221941-77221963 AGGATGTGCCTCCACCCCCAGGG - Intronic
994511424 5:100708996-100709018 AGGGTGTGCCTCCCTCCACACGG - Intergenic
997631718 5:135373796-135373818 AGGGTGGGCCCTCAGCCCTGTGG + Intronic
998577041 5:143327779-143327801 GGGGTGGGCTTTCATACCCTTGG + Intronic
999135478 5:149316041-149316063 AGGATGGGCCTGCAGCTCCAGGG - Intronic
1001006306 5:168053491-168053513 ATGTTGGCCCTTCATACCCACGG + Intronic
1002188684 5:177467902-177467924 AGGGTGGGCTTCCCTCTCCACGG + Intronic
1003450031 6:6222319-6222341 AGGGTGGTCATTCAACCCCATGG + Intronic
1003676177 6:8206556-8206578 AGGATGGTCCTTTGTCCCCAAGG + Intergenic
1004418577 6:15447467-15447489 AGGATGGGCCTTCCTGCCCTGGG - Intronic
1005562091 6:27050632-27050654 AGCTTGGGCCTCCAACCCCACGG - Intergenic
1006996641 6:38267426-38267448 AGTGTGGGCCTTCATCCAACAGG + Intronic
1009967807 6:70595209-70595231 AGGTTGGGCCTTCAGCTCCCAGG + Intergenic
1015320929 6:131873353-131873375 TGGGTGATCCTTCCTCCCCATGG - Intronic
1019253486 7:33759-33781 AGAGTGGGCGTTCATCAGCAGGG + Intergenic
1020071292 7:5228512-5228534 AGGCCAGGCCTTCCTCCCCAGGG + Intronic
1022569014 7:31433252-31433274 ATGGTTGGGCCTCATCCCCAGGG + Intergenic
1023081935 7:36534174-36534196 AGGGTGGGCCTTCATCCCCAAGG - Intronic
1023792925 7:43768241-43768263 ATGGTTGGACTTCATCTCCAAGG - Intronic
1025662338 7:63563572-63563594 AGGGTGGGCAGTCCTCCCCCTGG - Intergenic
1026837260 7:73647383-73647405 AGGGAGGGCCTTCCTCCCTCTGG - Intergenic
1027246477 7:76371046-76371068 AGGTTTGGCCTCCAGCCCCAGGG + Intergenic
1031103682 7:117513170-117513192 AGGGTAGGTCTTCATCCTGAAGG - Intronic
1032598388 7:133266257-133266279 AGGGTGGGCCTTAATCCAAAAGG - Intronic
1034472929 7:151265220-151265242 AGGGTGGGCCCTCATCCAATAGG + Intronic
1034564721 7:151904078-151904100 AGGGTGGGTCTTCACCCACTGGG + Intergenic
1035359696 7:158302583-158302605 AGGGTGGTCCTACATGCCCTAGG - Intronic
1035837565 8:2770810-2770832 ATGTTGGGACTTCAACCCCACGG - Intergenic
1037825854 8:22160200-22160222 CTGGAGGGCCTTCAGCCCCAAGG - Intronic
1038708817 8:29921796-29921818 AGGGTGGGGCTGCATCATCAGGG - Intergenic
1039884871 8:41649141-41649163 AGAGGAGGCCTTCACCCCCAGGG + Intronic
1039919767 8:41884982-41885004 AGGGTCTGACTTCATCCTCAAGG + Intronic
1040870761 8:52098333-52098355 AGGGTGGGCCCTAATCCCATAGG + Intergenic
1041447342 8:57966812-57966834 AGGGTGTCACTTCATCCCCCAGG - Intergenic
1042640871 8:70932771-70932793 AGGGTGGGCCCTAATCCAAAGGG - Intergenic
1048377369 8:133834269-133834291 ACGCTGGGCCTTCACTCCCAGGG - Intergenic
1049462075 8:142734909-142734931 AGGATGGCACTTCATCCCCCAGG - Intronic
1050026676 9:1341686-1341708 AGGGTGGGCCTCTATCCTGAAGG + Intergenic
1050575932 9:6995399-6995421 AAGGTAGGCTTTCATCTCCATGG - Intronic
1050888474 9:10794278-10794300 AGGGTGGGTCTTCCTCTCCCAGG + Intergenic
1053527740 9:38846844-38846866 AGGCAGGCCCTTCATCCCCCGGG + Intergenic
1058193376 9:101945086-101945108 AGGGAGGGGCTTCCTCCCCAGGG - Intergenic
1060109582 9:120896990-120897012 AGCCTGGGCCTTCTTCCCAAAGG - Intergenic
1060136451 9:121159780-121159802 AGGCTAGGCCTTCATGCCCTAGG - Intronic
1061118246 9:128628029-128628051 GGGATGGGCCTTCCTGCCCAGGG + Intronic
1061430392 9:130527077-130527099 AGGGTGGACCTGCCTCCCCTGGG - Intergenic
1061487599 9:130928322-130928344 AGGGTGGGCCTTCATGAACTGGG + Intronic
1062171503 9:135137376-135137398 AGTGGGGGCCTCAATCCCCATGG - Intergenic
1062746884 9:138218610-138218632 AGAGTGGGCGTTCATCAGCAGGG - Intergenic
1194726633 X:97405975-97405997 AGGGTGGCCCTGGATGCCCAGGG - Intronic
1195475159 X:105277072-105277094 AGGCGGGTGCTTCATCCCCAGGG - Intronic
1197524963 X:127549346-127549368 AGGCAGGGCCTCCATTCCCAAGG - Intergenic
1199903953 X:152206197-152206219 AGGGTGGGCCTTCAGCCTCTAGG + Intronic