ID: 1023083320

View in Genome Browser
Species Human (GRCh38)
Location 7:36545791-36545813
Sequence CAGCATCCCTGAAACGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023083320_1023083325 8 Left 1023083320 7:36545791-36545813 CCATGTTCGTTTCAGGGATGCTG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1023083325 7:36545822-36545844 TGTTGGCAAAGGATTGTCACTGG 0: 1
1: 0
2: 1
3: 16
4: 113
1023083320_1023083323 -9 Left 1023083320 7:36545791-36545813 CCATGTTCGTTTCAGGGATGCTG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1023083323 7:36545805-36545827 GGGATGCTGCGCTGGGATGTTGG No data
1023083320_1023083324 -3 Left 1023083320 7:36545791-36545813 CCATGTTCGTTTCAGGGATGCTG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1023083324 7:36545811-36545833 CTGCGCTGGGATGTTGGCAAAGG No data
1023083320_1023083326 21 Left 1023083320 7:36545791-36545813 CCATGTTCGTTTCAGGGATGCTG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1023083326 7:36545835-36545857 TTGTCACTGGCCTTTATGATTGG 0: 1
1: 0
2: 0
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023083320 Original CRISPR CAGCATCCCTGAAACGAACA TGG (reversed) Intronic
900584095 1:3424207-3424229 AATCATGCCTGAAACGAAGAGGG - Intronic
901803734 1:11724686-11724708 CAGCATACCTGAAACCTGCAAGG + Exonic
904878863 1:33679082-33679104 CAGAATCCCTGACACCTACAGGG - Intronic
905651685 1:39661040-39661062 CAGAACCCCTGAGAGGAACAAGG - Intronic
909051377 1:70772628-70772650 TGGCATCCCTGAAAGGGACAGGG - Intergenic
910466996 1:87510662-87510684 CAGCTTCCCTGTCACTAACATGG - Intergenic
913150219 1:116034474-116034496 CACCGTTCCTGAAACAAACAGGG - Intronic
917595588 1:176526130-176526152 CAACAACCCTGAAAAGAAAATGG + Intronic
919403612 1:197149097-197149119 CAGCATCCATGAAAAGACCTGGG + Intergenic
920320967 1:205122041-205122063 CAGCCCACCTGAAACGAACAAGG - Intergenic
920440257 1:205976004-205976026 CACCATCCCTGTAAAGAAGAGGG - Intergenic
920967372 1:210712180-210712202 CAGAATCCATAAAAGGAACATGG + Intronic
922935626 1:229420104-229420126 CAGCATCTCTGAAATTATCATGG - Intergenic
923344397 1:233036952-233036974 CAGCTTCCCTGAAACCATCAGGG + Intronic
923601645 1:235408780-235408802 AAACATTCCTGAAACAAACAGGG + Intronic
1064423554 10:15210653-15210675 CAGCTCCCCTGAAAAGAATAAGG - Intergenic
1070036726 10:72732886-72732908 GAGCATCCATGAGACGAAAATGG + Intronic
1071876639 10:89850295-89850317 CTGGGTCCCTGAAACGTACAGGG + Intergenic
1074451475 10:113563328-113563350 CCGGATCCCTGAAACTAACCTGG - Intronic
1075712091 10:124536235-124536257 CAGCATCCCTGAAAGCCACAAGG - Intronic
1077423702 11:2464700-2464722 CAGCATCCCAGAGTCCAACACGG - Intronic
1079210508 11:18456460-18456482 CAGCATCCATGAAGCGGACCAGG - Exonic
1080046366 11:27812624-27812646 CAGCATCCCTGAAAAAGTCATGG + Intergenic
1081300023 11:41439790-41439812 AAGCATCTCTGAAAGGAATAGGG + Intronic
1081973441 11:47215502-47215524 CAAGAACCCTGATACGAACAAGG - Intronic
1089531207 11:119131013-119131035 AGGCATCCCTGAAAGGGACAAGG - Intronic
1093528598 12:20134839-20134861 TGGCATCCCTGAAAGGGACAGGG - Intergenic
1094057631 12:26283001-26283023 CACCATCCCTGAGAGGAGCAAGG + Intronic
1095773403 12:45987270-45987292 AAGGACCCCTGAAATGAACATGG + Intronic
1096996478 12:55841344-55841366 CAGAATCCCTGAAGCTGACAGGG + Intronic
1098730322 12:74028318-74028340 TATCATCTCTGAAAAGAACAAGG + Intergenic
1098874375 12:75851698-75851720 CAGCAACCCTGAAATGATCCAGG + Intergenic
1099634855 12:85200640-85200662 CAACATCCCTTCAACGAACTAGG - Intronic
1101026089 12:100608486-100608508 CAGCATCTCTGGACCCAACAGGG - Intronic
1102539888 12:113610932-113610954 CAGCATTCCTGAAAGGGGCAGGG + Intergenic
1103052734 12:117795231-117795253 CATCATCCCTGAAGTGTACAGGG - Intronic
1103334288 12:120177621-120177643 CAGCATCCCAGAATTGAAAATGG + Intronic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1109659968 13:65444561-65444583 CATCATCGCTGAAAGGTACATGG - Intergenic
1118718855 14:68579760-68579782 CAGCCTCCTTGGAAAGAACATGG - Intronic
1118744262 14:68762626-68762648 CAGCCTCCCTGAAACAAATTGGG - Intergenic
1118810719 14:69271238-69271260 CAGCATCCCTGAACCACACCGGG + Intronic
1127372125 15:58351019-58351041 CAGCTTCCCTGAGACTACCATGG + Intronic
1132304624 15:100802368-100802390 CAGCCTGCCTGAAACAAGCATGG + Intergenic
1132384608 15:101391116-101391138 CAGCCCCACTGAAACGAACAAGG - Intronic
1132549998 16:550399-550421 CACCATGCCTGAAGCGCACAGGG - Intronic
1132837263 16:1960178-1960200 CAGCATCTCTGGAACGAACCGGG + Intronic
1141249726 16:82344323-82344345 AGGCATCCCTGAATTGAACACGG - Intergenic
1141797514 16:86285247-86285269 CAGGAACCCTGAAACGAAACAGG - Intergenic
1146136813 17:30329261-30329283 CAGCACCACCGAAACGGACACGG + Exonic
1157479559 18:48044712-48044734 CAGGACCCATGAAACGAACTGGG + Intronic
1158440457 18:57470449-57470471 CAACATCTCTGAAAGGAAGATGG - Intronic
1159800869 18:72898022-72898044 CAGCAACCCTGAAAACAGCATGG + Intergenic
1167443069 19:49520992-49521014 CACCCTCCCTGAAAGGAACTTGG + Intronic
926594191 2:14772204-14772226 CAGCATCCATGAAGCCAAGAGGG - Intergenic
934656383 2:96118571-96118593 CAGCATCCCTTGAAGGAAGATGG - Intergenic
934780713 2:96968173-96968195 CGGCATCCCTGACACGTGCATGG + Intronic
935561151 2:104561452-104561474 CATCAGCCCTGAAGCAAACATGG + Intergenic
938322942 2:130377434-130377456 GAGCTTCCCTGATACTAACATGG + Intergenic
939683475 2:145168467-145168489 CAGCATCCAAGAAACTAAAAAGG - Intergenic
940447056 2:153787965-153787987 TAGCATCCCTGAAAGTGACAGGG + Intergenic
943514035 2:188862571-188862593 CAGCCTCCCTGAATTCAACAGGG - Intergenic
945439770 2:209864699-209864721 CAGCTTCCCTGGCACCAACAGGG + Intronic
945806411 2:214495355-214495377 CATAATCCCTGACACCAACAAGG - Intronic
946515876 2:220411142-220411164 TAGCATCCCTGAAAGAGACAAGG - Intergenic
1169953136 20:11070443-11070465 AAGCATCACTGAAACGTGCAGGG - Intergenic
1173083992 20:39897767-39897789 AAACATCCCTGAAATGACCAGGG - Intergenic
1175762197 20:61568810-61568832 CAGCCTCCCAGGAAGGAACATGG - Intronic
1177364565 21:20117405-20117427 CAGCATCCATGCAACCAAGAAGG + Intergenic
1177958897 21:27637021-27637043 GAGAATCCCTGAAACATACAGGG + Intergenic
1178886238 21:36486950-36486972 CAGCAACCCTGAGAACAACATGG - Intronic
1184123889 22:42472973-42472995 CAGCATCTCAGAAAGGAGCAGGG + Intergenic
1184400736 22:44272520-44272542 CTGCATCCATGCAACAAACACGG + Intronic
952698669 3:36302325-36302347 CAGCATCCCAGCAAAGAGCATGG + Intergenic
954937073 3:54336226-54336248 CAGGGTCCCTGACACGGACAAGG + Intronic
955308807 3:57863142-57863164 CAGCATCCCTGAAAGCTAAAAGG - Intronic
956981004 3:74637251-74637273 CAGCATCCTTGAAAAGTACAGGG + Intergenic
959132713 3:102377594-102377616 CAGCACCCCTGAAAAGATCTGGG - Intronic
965930637 3:174038842-174038864 AAGCTTCCCTGAAAAGAAGAAGG - Intronic
966359378 3:179118811-179118833 CAACATCCCTGAAACCAACCTGG + Intergenic
967149116 3:186632098-186632120 CAGCCTCCCTGATGAGAACATGG - Intergenic
967869211 3:194215932-194215954 CACCATCAGTGAAACCAACAAGG + Intergenic
973094277 4:46177503-46177525 TAGAATACCTGAAACCAACAGGG + Intergenic
978514433 4:109556426-109556448 GTGCATCCCAGAAAAGAACAGGG - Intergenic
981739117 4:147984409-147984431 CCACAGCCCTGGAACGAACATGG - Intronic
981844712 4:149154403-149154425 CAGCAGCCCTTAAAGGGACAGGG + Intergenic
987949983 5:24662356-24662378 CAGCATCCATGAAATGGGCAAGG - Intergenic
991599992 5:68342585-68342607 CGGCATCCCAGAAAAGAAAAGGG - Intergenic
994652163 5:102542570-102542592 CTGCATACCTGAAACAAATAGGG + Intergenic
997660917 5:135588995-135589017 CAGCATCACTGAAGAGAAAAAGG + Intergenic
998953627 5:147416010-147416032 CAGCATTCTTGAAACTATCAGGG - Intronic
999823397 5:155250862-155250884 CTGCATCCCTGAGCCAAACAGGG - Intergenic
1000662041 5:163949364-163949386 GAGTATCCCTGAAACCCACAAGG + Intergenic
1001053374 5:168430122-168430144 CATCATACCTGAAATGAAAAGGG - Exonic
1001097149 5:168784467-168784489 CAGCTTCACTGAAACAAACCTGG + Intronic
1001945661 5:175775414-175775436 CAGCCTCCCTGAAACTTTCAAGG + Intergenic
1004810584 6:19256644-19256666 CAGCATCCCAGAAACTACCCTGG - Intergenic
1005803109 6:29446724-29446746 CAGCATGCCTGAAAAAAACATGG + Intronic
1007665793 6:43512308-43512330 CAGGATCCCTGGAAGGAAGATGG + Exonic
1011759440 6:90545509-90545531 CAACATCCCTGAAGTGAAAAGGG + Intronic
1013821939 6:114165044-114165066 CAGCATCCCTGAAACACCCCAGG - Intronic
1017994364 6:159519681-159519703 CGGCATCCCTGAAAGGGACAGGG - Intergenic
1018818746 6:167356322-167356344 CAGCATCCCTGAGCCAAGCAGGG + Intronic
1018942503 6:168319056-168319078 CTGTAACCCTGTAACGAACAGGG + Intronic
1020399337 7:7757706-7757728 TAGCTTCTCTGAAATGAACATGG + Intronic
1023083320 7:36545791-36545813 CAGCATCCCTGAAACGAACATGG - Intronic
1023844050 7:44111328-44111350 CAGCATCCCTGGAACCAGTAGGG - Intronic
1024165583 7:46726056-46726078 TGGCATCCCTGAAAGGGACAGGG + Intronic
1030854981 7:114544263-114544285 CAGAATCCCTGAACCAAACTAGG - Intronic
1032775489 7:135108797-135108819 TTGCATCCCTGAAAGGGACAGGG - Intronic
1040296284 8:46150790-46150812 CAGCCCCCCTGAAACAAACCTGG + Intergenic
1041120280 8:54579644-54579666 CAGCATCTTTGAAACCACCATGG + Intergenic
1046545813 8:115648575-115648597 CAGAATCCGTGAAAAGAAAATGG + Intronic
1046735677 8:117774413-117774435 TGGAATCCCTGAAAGGAACAGGG + Intergenic
1048005864 8:130419018-130419040 CAGCAGGCCTGAGCCGAACATGG + Intronic
1048136733 8:131753351-131753373 CTGGATCCCAGAAACGAACAAGG - Intergenic
1051847147 9:21464744-21464766 TGGCATCCCTGAAAGAAACAGGG - Intergenic
1053361900 9:37494007-37494029 AAGCTTCCCTGCAACGCACAAGG - Intronic
1055968588 9:81889207-81889229 CAGCATCCCTGAACCACACAGGG - Intergenic
1056058832 9:82861115-82861137 CAGCAAACCTGAAAGGAAAAAGG + Intergenic
1057555386 9:96083691-96083713 CAGCATCCTTGGAACGGCCAAGG - Intergenic
1060568678 9:124617677-124617699 CAGCATCCCCCAGACCAACAAGG + Intronic
1186422853 X:9440073-9440095 CAGAATCCCACAAAAGAACAGGG + Intergenic
1186558082 X:10582000-10582022 CAGCATTCATGAAACGAAACTGG - Intronic
1186844858 X:13520650-13520672 CATCAACCCTGAAAGGATCAAGG + Intergenic
1188331280 X:28874648-28874670 CAGCATCCTTATAATGAACATGG + Intronic
1188828550 X:34867702-34867724 TGGCATCCCTGAAAGAAACAGGG + Intergenic
1189403719 X:40697604-40697626 CAGCTTACCTGAAAGGAACGTGG - Intronic
1190828919 X:54043532-54043554 CTGCATCCCTGAAACTCAAAAGG + Intronic
1194489670 X:94530690-94530712 CAGCATCCCTGGCTCCAACAGGG - Intergenic
1194948208 X:100093127-100093149 TTGCATCCCTGAAAAGGACAGGG + Intergenic
1198805550 X:140490819-140490841 CAGGTTCCCTGAAACAAACCAGG - Intergenic