ID: 1023084825

View in Genome Browser
Species Human (GRCh38)
Location 7:36559966-36559988
Sequence CCCACATCATTTATTGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5747
Summary {0: 1, 1: 3, 2: 65, 3: 712, 4: 4966}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023084821_1023084825 -3 Left 1023084821 7:36559946-36559968 CCTATGGCTTGTCAGCTATCCCC 0: 1
1: 0
2: 1
3: 17
4: 150
Right 1023084825 7:36559966-36559988 CCCACATCATTTATTGAACAGGG 0: 1
1: 3
2: 65
3: 712
4: 4966
1023084819_1023084825 14 Left 1023084819 7:36559929-36559951 CCAATTTTATTCTTCTGCCTATG 0: 1
1: 23
2: 268
3: 1408
4: 3929
Right 1023084825 7:36559966-36559988 CCCACATCATTTATTGAACAGGG 0: 1
1: 3
2: 65
3: 712
4: 4966

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023084825 Original CRISPR CCCACATCATTTATTGAACA GGG Intronic
Too many off-targets to display for this crispr