ID: 1023085203

View in Genome Browser
Species Human (GRCh38)
Location 7:36563282-36563304
Sequence CAGTGACAGCAGAAATAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023085203_1023085211 18 Left 1023085203 7:36563282-36563304 CCCCACTATTTCTGCTGTCACTG 0: 1
1: 0
2: 5
3: 22
4: 235
Right 1023085211 7:36563323-36563345 AGATCTAGAGTGAGAACTAGAGG No data
1023085203_1023085212 19 Left 1023085203 7:36563282-36563304 CCCCACTATTTCTGCTGTCACTG 0: 1
1: 0
2: 5
3: 22
4: 235
Right 1023085212 7:36563324-36563346 GATCTAGAGTGAGAACTAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023085203 Original CRISPR CAGTGACAGCAGAAATAGTG GGG (reversed) Intronic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
902235610 1:15055504-15055526 AAGTGAGACCAGAAATAGAGGGG - Intronic
902306920 1:15547895-15547917 CAGTGACATGAGAGGTAGTGGGG - Intronic
903179579 1:21598412-21598434 CAGTGTCAGCACCACTAGTGGGG - Exonic
904585717 1:31579553-31579575 CAGTGACAGCAGGAATAGCTGGG - Intronic
904588538 1:31594017-31594039 CACTGAGAGCAGAGAGAGTGAGG - Intergenic
904825048 1:33268893-33268915 CAGTGACTGCAGTAATGGAGTGG + Intronic
905680524 1:39867795-39867817 GAGTGGCAGCAGAAATAGCTTGG - Intronic
905807745 1:40889130-40889152 CAGTGACAGCAGAGAATGAGAGG + Intergenic
907810092 1:57860708-57860730 CAATAACAGCATAAATATTGTGG + Intronic
908427345 1:64020094-64020116 CAGGGCCACCAGAAAGAGTGTGG + Intronic
909379754 1:74984985-74985007 CAGTGGCAGTAGGAATGGTGAGG - Intergenic
909593378 1:77377449-77377471 CAGTGGCAGCAGGACTAATGAGG - Intronic
911090308 1:94012230-94012252 CAGTGATTCCAGAAAGAGTGGGG - Intronic
912663547 1:111557826-111557848 CAGTGACAGCATAAAAATTGGGG + Intronic
912947744 1:114098748-114098770 TAGCAACAGCAGAAATAGAGAGG + Intronic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
913311992 1:117508379-117508401 CAGTGAAAGTAGACATACTGTGG - Intronic
915948369 1:160170933-160170955 GCGAGAGAGCAGAAATAGTGGGG - Intronic
917005067 1:170406003-170406025 CAGTGACTGGAGAAATAGAGTGG - Intergenic
917199004 1:172496098-172496120 CAGTAAAAGCAGAAACTGTGAGG - Intergenic
918043385 1:180926743-180926765 CCCTGACAGCAGAGATAATGAGG - Intronic
919799109 1:201341684-201341706 CAATGACAGGAGAAAGAGTCAGG - Intergenic
919994660 1:202737745-202737767 CAGTGACATGAGAAAAAGTGGGG + Intronic
923290998 1:232545972-232545994 CAGTGACACCAGAAAGAGAAGGG - Intronic
923430265 1:233913143-233913165 CATTCACAACAGAAATAGAGGGG + Intronic
923562635 1:235053113-235053135 CAATGACAGCAAAAATACTGAGG - Intergenic
1064885223 10:20104052-20104074 CTGTGAAAGCAGAAATAATCAGG - Intronic
1065467456 10:26040023-26040045 CAGTGACAGCAGTAATGGGAGGG - Intronic
1067266516 10:44750077-44750099 CAGAGAAAGCAGAAAAATTGGGG - Intergenic
1067606307 10:47666498-47666520 CATTGACAGCAGAAATCCTTGGG - Intergenic
1068264959 10:54634849-54634871 CAGTGACAGCAGATATTATAAGG - Intronic
1070525464 10:77292457-77292479 CAGTGCCAGAAAACATAGTGGGG - Intronic
1070920054 10:80178903-80178925 CAGTTACATCAGAATTACTGGGG - Intronic
1071750070 10:88465495-88465517 CAGTGCCAGTAAAAAGAGTGAGG + Intronic
1071837741 10:89436139-89436161 TAGTGACCACAGAGATAGTGGGG - Exonic
1072489270 10:95887849-95887871 CAGTGGCAGAAGAGATGGTGAGG - Intronic
1073157784 10:101361631-101361653 CAAGTACAGCAGAAATATTGTGG - Intronic
1073282987 10:102368374-102368396 AAGAGAGAGCAGCAATAGTGGGG - Exonic
1074121207 10:110495799-110495821 CAGTGACAGCAGCTATGGGGAGG - Intergenic
1074263677 10:111879703-111879725 CAGTGAAAGCTGAGATACTGTGG + Intergenic
1074813481 10:117127107-117127129 AAGTGGCAGCAGAAATGGAGAGG - Intergenic
1078377190 11:10806245-10806267 CAGTGAAAGCAGAAACTGGGTGG - Intronic
1079590808 11:22180326-22180348 CAATGCCAGCAGGAATACTGAGG - Intergenic
1081489179 11:43554181-43554203 CAGTGGCAGCAGCAAAAGGGAGG - Intergenic
1083902832 11:65652028-65652050 CAGTGATAGCAGTGACAGTGGGG + Intergenic
1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG + Intronic
1085815757 11:79735499-79735521 CTGTGACAGCAGCAAGGGTGAGG - Intergenic
1087480196 11:98691022-98691044 CACTGACAGAAGAAAGAGTTAGG - Intergenic
1087746741 11:101956350-101956372 GAGTGACATAAGAAAGAGTGGGG - Intronic
1087831679 11:102825926-102825948 CAGTGAAAGCAGCAAAAATGGGG - Intergenic
1094756971 12:33482338-33482360 CAGGAAGAGCAGAAATAGGGAGG + Intergenic
1095286683 12:40420281-40420303 CAGTGACGGCAGAAAGTGTATGG - Exonic
1096028146 12:48386230-48386252 CAGGAACAGCACAAAGAGTGGGG + Intergenic
1098586656 12:72162421-72162443 CAGTCACATCAGAATTAGTATGG + Intronic
1099048997 12:77760949-77760971 GAGAGACAGCAGAAATAGGGTGG - Intergenic
1099263978 12:80420254-80420276 CAATGTCAGCAGAAATAATTGGG - Intronic
1100213777 12:92426621-92426643 CAGTGAGAGAAGCAAAAGTGGGG + Intronic
1100692958 12:97058471-97058493 CACTGACATCAGAAAAAGGGTGG - Intergenic
1100730370 12:97460629-97460651 CAGAGACACCATAAAGAGTGTGG - Intergenic
1102307323 12:111814956-111814978 AAGTGACTGCAGAGATTGTGAGG - Intergenic
1102499499 12:113341705-113341727 CATTGTGAGCAGAAGTAGTGTGG + Intronic
1104476514 12:129074735-129074757 CAGTGACAGCAGACACACAGGGG - Exonic
1105268308 13:18843804-18843826 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1108286757 13:48916335-48916357 AAGTGACAGCAGAGGTAATGGGG + Intergenic
1109074932 13:57822694-57822716 CAGTTACAGAAGAATGAGTGTGG + Intergenic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1109928432 13:69180084-69180106 CAGGAAAAGCAGAAATCGTGGGG - Intergenic
1111930770 13:94510986-94511008 CAGTGAGGACAGAAACAGTGGGG - Intergenic
1114152187 14:20055058-20055080 CAGTGACAACAGAAAAACTTGGG - Intergenic
1114635345 14:24184019-24184041 CAGTGACAGCAGCATGAGCGTGG + Exonic
1114835444 14:26198037-26198059 CAGGAAAAGCAGACATAGTGAGG + Intergenic
1116032755 14:39592329-39592351 CAGAGACAGCAGAACAGGTGCGG + Intergenic
1117707998 14:58493140-58493162 CAGTTACAGCAGAAATAGAGAGG + Intronic
1119183131 14:72617722-72617744 GAGGGACAGCACAAATACTGCGG + Intergenic
1119929673 14:78532995-78533017 CAGTGGTAGCAGAAATAGAGAGG - Intronic
1119945619 14:78690604-78690626 CAGTGTCAGAAGGAATAGGGTGG + Intronic
1120707229 14:87757315-87757337 GAGTGGCAGTGGAAATAGTGAGG + Intergenic
1120815904 14:88857918-88857940 CAGCCACAGCAGAAATGATGGGG + Intronic
1122157299 14:99757394-99757416 CAGTGACAGCACAGGTTGTGTGG + Intronic
1122926231 14:104903331-104903353 GAATGACAGCACAAAAAGTGGGG - Intergenic
1123000866 14:105293421-105293443 CAGTGTCACCAGAACTTGTGGGG - Intronic
1202831004 14_GL000009v2_random:30190-30212 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1125199701 15:37092171-37092193 CTGTGACAGAATAAATACTGCGG - Intronic
1126634538 15:50767902-50767924 CTGTGGCAGAAGAAATAGGGAGG + Intergenic
1126844941 15:52750616-52750638 TAGTGAAAGTAGAAAAAGTGGGG + Intergenic
1127440554 15:59002739-59002761 CAATGACATCAGAAGTAGTCAGG - Intronic
1129929656 15:79399816-79399838 CAGTGACAGCTGAAATCAGGGGG + Intronic
1130028348 15:80289480-80289502 CTGTGACAGCAGAAATGAGGAGG + Intergenic
1130197092 15:81790005-81790027 AAATGGCAGCAGAAGTAGTGGGG + Intergenic
1130827509 15:87564851-87564873 ATGTGACAGCAGACATGGTGAGG - Intergenic
1131475305 15:92733739-92733761 CTGGGACAGAAGAAATAATGGGG - Intronic
1131618442 15:94041653-94041675 CAGAAAGAGCAGAAATATTGAGG + Intergenic
1133124026 16:3633215-3633237 CAGAGAAAGCAGAAAAAGAGTGG - Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1139244820 16:65431436-65431458 CAGTGACAGCAGCTATGGTGGGG - Intergenic
1140297990 16:73727268-73727290 CAGAGACAGCAGGCATACTGGGG + Intergenic
1141980375 16:87546562-87546584 CAGTGGCAGCAGAAATGGTCCGG - Intergenic
1143609027 17:8007028-8007050 CAGTGACAGGAGGTATACTGAGG - Intronic
1150718934 17:67597916-67597938 CAGTGACAGTAGAAATAGAGAGG + Intronic
1150988534 17:70227728-70227750 CAGGGAAAGCAGAAATACAGTGG - Intergenic
1152403581 17:80083638-80083660 CAGTCACAGCTGCAATGGTGTGG - Intronic
1153448841 18:5204253-5204275 AAGAGACAGGAGAAAAAGTGTGG + Intergenic
1153711580 18:7805263-7805285 CAGAGACATCAGAGATAATGAGG - Intronic
1153925897 18:9834499-9834521 GACTGACAGCTGAATTAGTGAGG - Intronic
1153998216 18:10460735-10460757 CAGTGAGAGAAGAAAAAGGGTGG - Intronic
1154419711 18:14216230-14216252 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1156416692 18:36901335-36901357 ATGTGACAGCAGAACTAATGTGG + Intronic
1158074279 18:53510833-53510855 AAGAGACAGCAGTTATAGTGTGG - Intronic
1160083097 18:75749007-75749029 CAGTAACAGCACAAATATGGTGG - Intergenic
1160363489 18:78304365-78304387 CAGGGACAGCTGAGAAAGTGCGG - Intergenic
1162557210 19:11394651-11394673 CAGTGACAGCAGAATGAGCTTGG - Intronic
1165747411 19:38238201-38238223 CATTGACAGGAGAGAGAGTGAGG + Intergenic
927116516 2:19908848-19908870 AATTGACAAGAGAAATAGTGAGG - Intergenic
927569350 2:24144775-24144797 CAGTGGCAGCAGGCATAGGGAGG - Intronic
927805066 2:26139750-26139772 CAGAGACAGCAGGAAGAGTCTGG + Intergenic
928433808 2:31240811-31240833 CAGGGACAGCTGAAATAGAGAGG - Intronic
929998231 2:46842987-46843009 CAGTGGAAGCAGAAATTGCGAGG - Intronic
931187575 2:59968439-59968461 CAGTGACTTGAGAAAAAGTGTGG - Intergenic
932831756 2:74996912-74996934 CAGGGACACCAGGATTAGTGAGG - Intergenic
934497517 2:94821034-94821056 CTGTAGCAGCAGAAATACTGTGG + Intergenic
934860550 2:97760814-97760836 CCGTGACTGCAGCAAAAGTGGGG + Exonic
935745406 2:106186018-106186040 CAGTGAGAGAAGAAAAAGGGAGG + Intronic
936103628 2:109604844-109604866 CAAGGACAGCAGAAAAGGTGAGG + Intronic
936750646 2:115637524-115637546 CAGTGACAGAATAAAGATTGAGG + Intronic
936923954 2:117717837-117717859 CTGTGGCAGCAGAAAATGTGAGG + Intergenic
937253256 2:120537279-120537301 CAGAGACAGGAGAAATGTTGGGG + Intergenic
938693743 2:133816029-133816051 CAGTGACAGCAGCCATAGGCAGG - Intergenic
940627888 2:156198790-156198812 CAGTGACAGCAGAATCACTTTGG - Intergenic
941258951 2:163272262-163272284 CAGAGACAGGAGAAAAAGTGTGG - Intergenic
943897072 2:193377991-193378013 CAGTGTCAGTAGAAATCATGTGG - Intergenic
943920667 2:193703395-193703417 CAGTGACAGAAGAAAACTTGAGG + Intergenic
945400773 2:209379858-209379880 CATTGACAGCAGATAGAGTTGGG + Intergenic
946137380 2:217658455-217658477 CAGGGAAAGCAGAGATAGAGAGG - Intronic
947114149 2:226751076-226751098 CTTTGACTGCAGAAATAGTTTGG + Intronic
947170584 2:227306888-227306910 CAGTGGCAGCAGAAATGGATGGG + Intronic
1170982912 20:21231583-21231605 CAGTGACAGCAAACATAGGCAGG - Intronic
1171107219 20:22445786-22445808 TAGTCCAAGCAGAAATAGTGAGG + Intergenic
1173132500 20:40408049-40408071 CAGTGACAGCACAATTTGGGAGG - Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1176610192 21:8875029-8875051 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1176853584 21:13943067-13943089 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1177425180 21:20914002-20914024 AAGTGACAGAAGAAATCATGAGG + Intergenic
1178893286 21:36538325-36538347 GAGTGACAGCAGCAAAACTGTGG - Intronic
1180606363 22:17061840-17061862 CAGTTACAGCAGAATGTGTGGGG - Intergenic
1181288502 22:21772454-21772476 CAGGGACAGCACACAGAGTGGGG - Intronic
949628238 3:5892224-5892246 CTGTGACTCCAGAAATACTGTGG - Intergenic
950231756 3:11282156-11282178 CAGTGACAGCTGAGAAAATGTGG - Intronic
951074642 3:18375123-18375145 TATTGACAGTAGAAACAGTGAGG - Intronic
952706369 3:36381366-36381388 CAGTGACAGGAGAACTGCTGCGG - Intronic
953046544 3:39298226-39298248 CAGTGGCAGCAGCCATAGTCAGG - Intergenic
954963979 3:54594225-54594247 TAGTTACAGCAGAAATTGTATGG - Intronic
955136455 3:56223579-56223601 AAGTGTCAGCAGAAATAGTGTGG - Intronic
956004596 3:64764866-64764888 GAGTGACAGCAGTTAGAGTGCGG + Intergenic
956127110 3:66021085-66021107 CAGTGCCTCCACAAATAGTGAGG - Intronic
959588107 3:108045112-108045134 CAATGCCACCAGAGATAGTGGGG - Intronic
960201027 3:114836710-114836732 TCGTGATAGCAGAGATAGTGAGG - Intronic
960552696 3:118994354-118994376 CAAAGACAAAAGAAATAGTGGGG + Intronic
961653398 3:128428692-128428714 GAGTGAAAGCAGACTTAGTGGGG - Intergenic
964574770 3:158153440-158153462 TAGTTACAGCAGAAACATTGTGG - Intronic
965806647 3:172548932-172548954 CAGTGAATACAGAAAAAGTGGGG + Intergenic
966402294 3:179560715-179560737 CAGTGACAGCTATAATAATGGGG + Intergenic
966402862 3:179564235-179564257 CAGTAACAACAGCAATAGTCTGG - Intronic
967556645 3:190866355-190866377 AAGTGAAAGCAGAAATGCTGTGG - Intronic
967696048 3:192531761-192531783 CAGTGACAGCATCAAGCGTGTGG - Intronic
968351718 3:198061794-198061816 CTGTAACAGCAGAAATACTGTGG + Intergenic
1202736873 3_GL000221v1_random:9816-9838 CTGTAGCAGCAGAAATACTGTGG - Intergenic
969985625 4:11207583-11207605 TAGTGACACCAGTAATAGAGGGG - Intergenic
970187050 4:13467697-13467719 CAGAGAAAGCAGAAAAAGAGGGG + Intronic
970907445 4:21232877-21232899 CAGGGACAGCAGAGAGAATGAGG + Intronic
971119172 4:23684981-23685003 CAGGGACAGCATGAACAGTGGGG - Intergenic
980535505 4:134115672-134115694 GAGTGAAGACAGAAATAGTGAGG + Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981018210 4:139997454-139997476 CAGTAACAGCACAAAGAGGGTGG - Intronic
981309019 4:143277889-143277911 CAGTGTCAGCAGACACATTGGGG - Intergenic
981602063 4:146501034-146501056 CAGAGAAAGCAGCAATAATGAGG - Intronic
981852663 4:149249545-149249567 TAGTGACAGCAGAACTAGAGAGG - Intergenic
982694425 4:158583104-158583126 CAGTGACAGGAAAAATACTTTGG - Intronic
982997998 4:162375627-162375649 CATGGACAGCAGAAATAAAGGGG + Intergenic
991051233 5:62274418-62274440 CTGTGACAGTAGAAATAAAGAGG - Intergenic
992035874 5:72775548-72775570 CAGTGACATCAGCAAGATTGTGG + Intergenic
993418687 5:87671765-87671787 TAGTGACAACAGAAATATGGTGG - Intergenic
994296992 5:98102425-98102447 ATGTCACAGCAGAAATAGAGGGG - Intergenic
994998937 5:107102677-107102699 CAGTTCCAGCAGAAGTATTGGGG - Intergenic
997574789 5:134966352-134966374 CAGGGACAGCAGAGATGGTGGGG + Exonic
998882396 5:146656864-146656886 CAGAGACAGAAGGAATGGTGAGG - Intronic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1000265630 5:159633570-159633592 CAGTGACACGAGAGATACTGTGG - Intergenic
1001901440 5:175433818-175433840 CTGTTTCAGCAGAATTAGTGTGG + Intergenic
1002759755 6:192302-192324 CAGTGACAGCAGAGCAAGCGTGG + Intergenic
1003439558 6:6126648-6126670 CAGTAACAGCCGACTTAGTGGGG + Intergenic
1004333885 6:14746376-14746398 CAATGATAGCAAAAATAGTGTGG - Intergenic
1005885528 6:30094771-30094793 CAGGGACAGTGGGAATAGTGAGG - Intergenic
1009516909 6:64631474-64631496 CAGTATCAGCAACAATAGTGAGG - Intronic
1012313910 6:97761522-97761544 AAGTCACAGAAGAAATATTGAGG + Intergenic
1013052099 6:106546192-106546214 CAGGGACATCAGAAAGAGTGGGG + Intronic
1013168659 6:107616738-107616760 CTTTGACTGCAGAAACAGTGGGG + Intronic
1013846833 6:114463409-114463431 CAGGGACAACAGAAATTCTGAGG + Intergenic
1016359945 6:143256604-143256626 CCGTTACAGCTGAAATAGGGTGG + Intronic
1016746036 6:147581438-147581460 CAGGGACAGCGGGAAGAGTGAGG + Intronic
1018337516 6:162810046-162810068 CACTGACATCATAAACAGTGTGG - Intronic
1018799817 6:167213335-167213357 CAGCCACAGAAGAAATAATGTGG + Intergenic
1021673846 7:23060757-23060779 CAGGGACAGCTGAAATAATTTGG + Intergenic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1023786251 7:43711107-43711129 CAGTGACAGCAGAAATCTTGTGG + Intronic
1023949805 7:44834432-44834454 CTGGGACAGAAGAAATAATGGGG - Exonic
1024610760 7:51062217-51062239 CCCTGACAGCAGATACAGTGTGG + Intronic
1030390607 7:108922889-108922911 CAGTGACAGCAGTATTAGAAGGG - Intergenic
1032688235 7:134257283-134257305 CAATGACAGCAAATATGGTGGGG + Intronic
1033473192 7:141667219-141667241 TAGTGACAGAAGGAAGAGTGGGG - Intronic
1033608002 7:142941485-142941507 CAGGGACAGCAGACAAAGAGGGG + Intronic
1035538510 8:412356-412378 CAGAGACTGCAGAAATATTTAGG - Intronic
1037761145 8:21742582-21742604 GAGTGAAAGCAGAAATACTCAGG + Intronic
1039844313 8:41315275-41315297 CAAGGACAGCAAACATAGTGTGG + Intergenic
1040677826 8:49771992-49772014 CAGTCACAGATGAGATAGTGTGG - Intergenic
1040745877 8:50641827-50641849 CTGGGACAGCAGACATTGTGTGG - Intronic
1040915738 8:52565203-52565225 CAGCGCCAGCAGGAAGAGTGCGG + Exonic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1043928310 8:86062600-86062622 CGGTGACAGGAGAAAAAGAGAGG - Intronic
1044941704 8:97350049-97350071 TAGTGAAAGTGGAAATAGTGGGG - Intergenic
1045685265 8:104704963-104704985 CAGTGACACAAGAAATAGGAGGG - Intronic
1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG + Intronic
1047365090 8:124204076-124204098 AAGTGACATCAGAAATAGGGGGG + Intergenic
1047371591 8:124260488-124260510 CAATGACATCAGAAATTCTGGGG + Intergenic
1048513174 8:135080621-135080643 CAGTGTCAGCAGAAGGGGTGGGG - Intergenic
1052266341 9:26577918-26577940 CAGGGATAGTAGAAATAGAGAGG - Intergenic
1053065803 9:35068147-35068169 CAGTGACTGCAGATAGAGTGGGG - Intronic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1053659628 9:40259437-40259459 CTGTAGCAGCAGAAATACTGTGG - Intronic
1053909999 9:42888789-42888811 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054360640 9:64112188-64112210 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054371756 9:64405736-64405758 CTGTAGCAGCAGAAATACTGTGG - Intronic
1054524970 9:66116779-66116801 CTGTAGCAGCAGAAATACTGTGG + Intronic
1054679375 9:67895453-67895475 CTGTAGCAGCAGAAATACTGTGG - Intronic
1055203584 9:73698074-73698096 TAGTAGCAGAAGAAATAGTGAGG - Intergenic
1055459062 9:76499746-76499768 TAATAACAGCAGAAACAGTGAGG - Intronic
1056296053 9:85194030-85194052 CAATCTCAGCAGAAAGAGTGTGG - Intergenic
1058314356 9:103546038-103546060 AAGTGAGAGAAGAAATAGAGAGG + Intergenic
1058351899 9:104035000-104035022 CAGTGAGAGCAGAAAACATGGGG - Intergenic
1058770225 9:108223876-108223898 CAGTGACAGTAGACAGGGTGGGG - Intergenic
1059712942 9:116886246-116886268 CAGTGGGAAAAGAAATAGTGTGG + Intronic
1059840809 9:118213597-118213619 CCGGGAGAGCAGAAATAATGTGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG + Intergenic
1203705598 Un_KI270742v1:40260-40282 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1185918324 X:4061402-4061424 CAGTGAGACCAGAAAAAATGGGG + Intergenic
1186912263 X:14181272-14181294 CATGGAAAACAGAAATAGTGTGG + Intergenic
1187290566 X:17949483-17949505 CAGTGCCTGGAGAAAAAGTGAGG + Intergenic
1187595621 X:20769246-20769268 CAGTGTTAGCAGAAATAAAGAGG + Intergenic
1188913960 X:35887410-35887432 CAGTGTCAGCAGAGATTGAGTGG - Intergenic
1189623405 X:42868873-42868895 CTATTACATCAGAAATAGTGGGG - Intergenic
1190233418 X:48599177-48599199 CAGGAACAGCAGAACTCGTGAGG + Intronic
1190418141 X:50201057-50201079 CAGTGACAGCACAAAGATGGAGG + Intergenic
1190460026 X:50663400-50663422 CAGTGACAGTAGGAATAGACAGG - Intronic
1190969140 X:55332058-55332080 AAGTGAGAGAAGAAAGAGTGAGG - Intergenic
1192822076 X:74656466-74656488 CAGTGACAGCAGGGCTAGAGAGG + Intergenic
1194126243 X:90020495-90020517 CAGTGACAGAGGAAATAGCCTGG - Intergenic
1195965959 X:110430571-110430593 TAGTGACAGAAGCAATAGAGTGG + Intronic
1196895510 X:120331779-120331801 TTTTTACAGCAGAAATAGTGTGG + Intergenic
1197309286 X:124884064-124884086 CAGTGGCAGCAGCAATTGTCAGG + Intronic
1197793312 X:130277086-130277108 CAGTGACAGGAGAAAAGGTAAGG + Intergenic
1198581386 X:138068636-138068658 CAATAACAGCAGAAAGAATGGGG - Intergenic
1199595977 X:149505981-149506003 CAGAGAGAGCAGCAATTGTGGGG + Intronic