ID: 1023085759

View in Genome Browser
Species Human (GRCh38)
Location 7:36568676-36568698
Sequence TTTCTGAAGGGGATTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023085759 Original CRISPR TTTCTGAAGGGGATTGAGGA GGG (reversed) Intronic
900358189 1:2274786-2274808 TTTCTGGGTGGGAGTGAGGAGGG + Intronic
901933983 1:12615722-12615744 TTTGTGAAGGGGACTGAAAAGGG - Intronic
902163546 1:14551730-14551752 TTTCTGCTGGGGTTTGAGCATGG - Intergenic
902562266 1:17284901-17284923 TTTCTGAAAGGGTTTGGGGAGGG + Intergenic
903020863 1:20393160-20393182 TTGCTGAAGGGGTTTTAGGTTGG - Intergenic
904206622 1:28859595-28859617 TTTATGAAGGAGATTATGGATGG + Intronic
904787346 1:32992837-32992859 TTTCTGATGGTGAATGAGGTTGG - Intergenic
905579970 1:39076851-39076873 TTTGGGAAGGGCATTGAGGTTGG + Intergenic
906093267 1:43200900-43200922 TCTCTGAACAGTATTGAGGAAGG + Intronic
910287421 1:85571170-85571192 TTTCAGAAGGGGAAAGAGAAGGG - Intronic
911077042 1:93886563-93886585 TTTCTGAAGGGGATCATGTATGG - Exonic
911714216 1:101111887-101111909 TTTCTGATGGATAATGAGGAAGG + Intergenic
912718378 1:111999298-111999320 TTTCTGCAGGGGTCTGGGGAGGG - Intergenic
913134301 1:115873135-115873157 GGTCTGAAGGGGAAAGAGGAAGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
913998542 1:143672567-143672589 TATCTCAAAGGGATGGAGGAGGG - Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914509033 1:148314975-148314997 TATCTCAAAGGGATGGAGGAAGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
917150564 1:171939603-171939625 TTTCTAAATGGGAATGAGGAAGG - Intronic
917810364 1:178652648-178652670 TTTCTGTAGGGGATTGATTATGG - Intergenic
917901951 1:179551592-179551614 TTTCTGAAGGGTCTTGAGCTGGG + Intronic
918422738 1:184380582-184380604 TTTCTGAAAAGGATGGGGGAAGG + Intergenic
920230853 1:204468817-204468839 TTTCTGAAGGACATGGAGAAAGG + Intronic
920693050 1:208161286-208161308 GGTGAGAAGGGGATTGAGGAAGG - Intronic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921670996 1:217923928-217923950 TTCCTGACTGGGGTTGAGGAGGG + Intergenic
922350823 1:224733527-224733549 TCTCTGAAGGGGAAGGAGGAGGG + Intronic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923881715 1:238110941-238110963 ACTCTGAATGGGATGGAGGAGGG + Intergenic
1063090459 10:2861666-2861688 TTTGAGAAAGGGATTGAGAAAGG - Intergenic
1063725093 10:8628369-8628391 TTTCTGAATGGGACGAAGGATGG + Intergenic
1063777233 10:9277556-9277578 TTTATGTAGGGGAGTGAGGGAGG + Intergenic
1064721283 10:18231841-18231863 TTTCAGCAGGGGAGTGATGAGGG - Intronic
1065030286 10:21579101-21579123 TTTTTGAAGGGCATTGTGGTTGG + Intronic
1065341458 10:24710790-24710812 TTTCTTACTGAGATTGAGGAAGG - Intronic
1065435296 10:25699343-25699365 TTTCTGCAGGGGCAAGAGGATGG - Intergenic
1066033843 10:31459462-31459484 TTTATGGAGTGGATTGAGGAAGG + Intronic
1066287081 10:33978813-33978835 TCTCTGCAGGAGATTGAGGAAGG - Intergenic
1069880158 10:71587584-71587606 TCTAGGAAGGGGATTTAGGAAGG + Intronic
1071416869 10:85449654-85449676 TTACTGAAGGGGCATGAAGAGGG + Intergenic
1071849504 10:89554311-89554333 TATCAGAAGGGAATTGAGGTGGG - Intronic
1072348236 10:94530115-94530137 GTGCTGATGGGGTTTGAGGAAGG - Intronic
1073192155 10:101659212-101659234 TTGCCGAAGGGGAGTGAGGGAGG - Intronic
1074381467 10:112984241-112984263 CTTCTGAAGGGGGCTGGGGAAGG - Intronic
1075830932 10:125410209-125410231 TATTTGAAGGGGATTGAAGAGGG - Intergenic
1077459958 11:2704078-2704100 TCACTGAAGGGGACCGAGGAGGG - Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078357958 11:10646951-10646973 TGACTGAAGGAGAATGAGGAAGG + Intronic
1079014648 11:16858199-16858221 TTTCTGCAGGGGAAGGAGGTGGG + Intronic
1080250670 11:30229534-30229556 TTTCCAAAGGAGACTGAGGAGGG - Intergenic
1080618616 11:33967848-33967870 TCTCTGAAGGGTTTTAAGGAAGG - Intergenic
1080802488 11:35620298-35620320 TTTCGGAAAGGGAATGAGGGGGG - Exonic
1081114795 11:39187203-39187225 TTTGAGAAGGGTAGTGAGGAGGG - Intergenic
1081415538 11:42810806-42810828 TTTTTGGAGGTGAGTGAGGAAGG - Intergenic
1081435255 11:43020828-43020850 TTTATGAATGGCATTGAGGTAGG + Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1083400236 11:62418470-62418492 TTTCTGATGGGAATTCTGGAAGG + Intronic
1083547010 11:63556467-63556489 TGTCGGAAGGGGATTGGGGGTGG - Intronic
1083932171 11:65852071-65852093 TCTCTGAAGGGCCTTGAGCAGGG - Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1086109133 11:83179605-83179627 TTTCTGAAAGTGATTTAGGCTGG + Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087094663 11:94307404-94307426 TCCCTGCAGGGGATGGAGGAGGG - Exonic
1087992066 11:104757636-104757658 TTACTGAGGGGGCTTCAGGATGG + Intergenic
1088247592 11:107834133-107834155 TTGCGGAAGGGGATTGGGTAAGG + Intronic
1090406456 11:126478428-126478450 TCTCAGAAGGGGAGTGGGGATGG + Intronic
1091168834 11:133502861-133502883 CTTCTGGATGGGACTGAGGAGGG + Intronic
1092163695 12:6329815-6329837 CTTCTGAAGGGGGTTGGGGATGG + Exonic
1092568853 12:9699756-9699778 TTTCTGAAAGAGATTGATGTTGG + Intergenic
1094317884 12:29151947-29151969 TTTCAGAAGTAGCTTGAGGAAGG + Intronic
1095085721 12:38056012-38056034 TTTCTGAAGGGGAAAAGGGAAGG - Intergenic
1095515249 12:42998551-42998573 TTTGTGAATAGGTTTGAGGAAGG + Intergenic
1096069427 12:48766706-48766728 TGTCAGAAGGGGCATGAGGAGGG + Exonic
1097933201 12:65213792-65213814 TTTTGAAAGGGGAGTGAGGAAGG + Intronic
1101558792 12:105836021-105836043 TGTCTCATGGGGATAGAGGAAGG + Intergenic
1103496076 12:121363269-121363291 TTTCTGAAGGGTATGAATGAAGG + Intronic
1103839392 12:123850346-123850368 TTTCTTGAGGGGTTTGAGGTGGG + Intronic
1104307153 12:127619979-127620001 TTTCAGCCAGGGATTGAGGAAGG - Intergenic
1104640126 12:130461862-130461884 TTTATGAAGGTGATTTATGAAGG - Intronic
1105841717 13:24259391-24259413 TTTCTGCACAGGATTGAGGCTGG + Intronic
1106154205 13:27137334-27137356 TTTATAAAGCGGATTGAAGATGG - Intronic
1106654737 13:31731189-31731211 GATCTGAAAGGGATTGAGGAAGG - Intergenic
1107562025 13:41565793-41565815 TTTGTGAAGGGGAAGGATGATGG - Intergenic
1108085960 13:46794140-46794162 TTTTTGGAGGGGAAGGAGGAAGG - Intronic
1109752880 13:66719419-66719441 ATTATGAAAGAGATTGAGGAGGG + Intronic
1110324130 13:74194529-74194551 TTTATGAAAGGGTTTGAAGAAGG - Intergenic
1110789332 13:79569853-79569875 TTACTGCTGGGCATTGAGGAAGG - Intergenic
1112105162 13:96232022-96232044 GTTCTGAAGGGGAGTGTGGTAGG + Intronic
1113169623 13:107485844-107485866 CTTCTGCAGGGTATAGAGGATGG + Intronic
1113447655 13:110381733-110381755 TTTCTGAAAGGGAGTGAAAAAGG - Intronic
1115261794 14:31461897-31461919 ATTCTGAAGGGGTAAGAGGAAGG + Intergenic
1117291403 14:54337239-54337261 TTGCTGGAGGGCAATGAGGAAGG + Intergenic
1118364276 14:65081139-65081161 TTTCAGCAGAGGATGGAGGAAGG - Intronic
1118580002 14:67286318-67286340 TGTCTGTATGGGATTGGGGAAGG + Intronic
1121466035 14:94116078-94116100 TCTCTGAGGGAGATGGAGGAGGG + Intronic
1121663735 14:95655794-95655816 TCTCTGGAGGGGATAGAGGAAGG - Intergenic
1123892230 15:24793422-24793444 GCTCTGCAGTGGATTGAGGATGG + Intergenic
1123912207 15:24978838-24978860 TATCTGAAGGGAAGTGGGGATGG + Intergenic
1124593968 15:31078481-31078503 TTTTTGAAGGCTACTGAGGAAGG - Intronic
1125390948 15:39192230-39192252 TGACTTAAGGGGATTGATGATGG - Intergenic
1125521489 15:40350303-40350325 TGTCTGCAGGGGACTAAGGAAGG + Intergenic
1126307270 15:47274251-47274273 TTTCAGTAGGGGGGTGAGGATGG - Intronic
1126767268 15:52021261-52021283 TTGCTGAAGGGGATGGGGGTCGG + Intronic
1126872677 15:53006689-53006711 TTTGTGAAGGGGAGTGAATATGG + Intergenic
1127464999 15:59235255-59235277 TTTCTAAAGGGTATACAGGAAGG + Intronic
1127790537 15:62394673-62394695 TTTCTCCAGGTTATTGAGGAGGG - Intronic
1127859909 15:62985278-62985300 TTTGTGAAGGGTAATGAGGTGGG - Intergenic
1128994101 15:72284290-72284312 TTTCTGAAGGAGATTAAGAAGGG - Intronic
1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG + Intergenic
1130960947 15:88658312-88658334 ATTCTGATGAGGTTTGAGGATGG + Intergenic
1131460726 15:92615877-92615899 TTTCTGAAGAGGGGAGAGGAGGG - Intergenic
1132099251 15:99011738-99011760 TATTTGAAGGGCATTGTGGATGG - Intergenic
1132607263 16:798801-798823 CTGCTGAAGTGGATCGAGGACGG - Exonic
1137275887 16:46933209-46933231 TTTCAGAGAGGGATAGAGGAGGG + Intergenic
1143434894 17:6916069-6916091 ATTCAGAAGGAGATTCAGGAGGG + Intronic
1144247972 17:13386556-13386578 TTTAGGAAGGGGAAAGAGGAGGG - Intergenic
1144361544 17:14499544-14499566 TTTAGGAAGGGGATTGAGTTGGG - Intergenic
1144457104 17:15427907-15427929 TTTCTGATGGGTATTCAGGCTGG - Intergenic
1145386740 17:22419235-22419257 TTGCTGGAGGGGAAAGAGGAAGG - Intergenic
1146525203 17:33561468-33561490 TTTGTGAAGGGTCTTCAGGAAGG + Intronic
1146673883 17:34759805-34759827 TTTCTGGAGGGCAATGAGGAAGG - Intergenic
1146876671 17:36418938-36418960 TTTTTGAAGGGCATTGTGGTTGG + Intronic
1147062713 17:37893923-37893945 TTTTTGAAGGGCATTGTGGTTGG - Intergenic
1147203679 17:38821604-38821626 TGTTTGAAGGGAATTCAGGAAGG - Intronic
1148065198 17:44864135-44864157 TTTCTCAAGGGGAGTCAGGTTGG - Intronic
1150304166 17:64070272-64070294 ATTCTGTAGGGAATTCAGGAAGG - Intronic
1150962258 17:69926899-69926921 TTTCTGATGGTGACTTAGGATGG + Intergenic
1151849832 17:76683737-76683759 GTTATGAAGGCGATGGAGGAGGG + Intronic
1152809687 17:82375590-82375612 TTCCAGAAGGGGACGGAGGAGGG - Intergenic
1155486519 18:26349258-26349280 TTTCGGAAGGGGAAAGAAGAAGG - Intronic
1156014465 18:32532472-32532494 GTGCTTGAGGGGATTGAGGAAGG + Intergenic
1156504127 18:37578138-37578160 TCCCTGAAGGGGATGTAGGAAGG - Intergenic
1157430414 18:47619906-47619928 ATTCAGCAGGGGAATGAGGATGG + Intergenic
1157992137 18:52510102-52510124 TTTTTGAAGGGGATGCAGGGGGG - Intronic
1158899543 18:61949939-61949961 TTTCCGAAGGGGAATGGTGAGGG - Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1159467061 18:68797423-68797445 GTTCTGATGGGGGTTGAGGGGGG - Intronic
1160630799 18:80246000-80246022 TGTCTGCAGAGGATTGAGGCGGG - Intronic
1162050005 19:8027409-8027431 GTGCTGAATGGGAATGAGGATGG - Intronic
1164162216 19:22634608-22634630 TGGCTGAAGGGGACTGAGGCTGG - Intronic
1164463405 19:28467345-28467367 TTTCTGGAGGTGACTAAGGATGG - Intergenic
1164759250 19:30716419-30716441 TTTCTGAAGGGGATGGACGTGGG - Intergenic
1164826463 19:31288160-31288182 TAGCCGAAGGGGATGGAGGAAGG + Intronic
1166400221 19:42473267-42473289 TATCTGAAGGTTTTTGAGGAGGG + Intergenic
1167612375 19:50513724-50513746 TTTAGGAAGGGGTTTGGGGAAGG + Intronic
1168150762 19:54446882-54446904 ATTCTGAAGTGGATTAAGGGAGG + Intergenic
1168432294 19:56290992-56291014 TCTCTGAAGGGGTTTCAGGGTGG + Intronic
1168516696 19:57015199-57015221 TGTCTGAAGAGGAGTGAGCAAGG - Intergenic
925636322 2:5944662-5944684 TCTCTGAAGGTGACTCAGGAAGG + Intergenic
925967463 2:9079258-9079280 GTTCAGAAGGGAATTGAGGCTGG + Intergenic
926796629 2:16625141-16625163 TTTCTGATGGGGGTGGGGGATGG + Intronic
928624202 2:33122687-33122709 TTTCTGAAGGGGAGTAGGGATGG + Intronic
928810463 2:35218530-35218552 TTACTGAAGGGGTTTCAGGAGGG - Intergenic
928889509 2:36186950-36186972 ATTCTCAACTGGATTGAGGAAGG + Intergenic
929455189 2:42060276-42060298 TGGCTGAAGGGGATGGTGGACGG + Intergenic
929539185 2:42806795-42806817 GTTCTGAAAGGCATTCAGGAAGG + Intergenic
930722981 2:54655711-54655733 TTCCAGAAGGGGCTGGAGGAAGG - Intronic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
935740002 2:106138930-106138952 ATTCTGAAGGGGAGAGAAGAGGG + Intronic
937268258 2:120630805-120630827 TTTGTGAAGGAGACTGAGGGTGG - Intergenic
939399346 2:141670510-141670532 TGACTGTAGGGGTTTGAGGAGGG + Intronic
940889881 2:159025005-159025027 TTAATGATGGGGATAGAGGATGG - Intronic
943649785 2:190444793-190444815 TTTCTGAATGAAATGGAGGATGG - Intronic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
944419989 2:199519331-199519353 TTTGTGAATGGGAATGAAGAAGG + Intergenic
944950525 2:204743839-204743861 TTTCAGAAGGGAAGTGTGGATGG + Intronic
946105280 2:217363748-217363770 TTTCTGAGGGAGATTGAAAAAGG + Intronic
946987298 2:225287093-225287115 TCTCTTAAGGGGTTTGAGCATGG + Intergenic
947298938 2:228666470-228666492 TCTCTGGAGGGGATTGAGGTTGG - Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG + Intergenic
1170815175 20:19708038-19708060 TCACTGAAGGAGACTGAGGAAGG + Intronic
1173372771 20:42452615-42452637 TATCTGACGGAAATTGAGGAGGG + Intronic
1173550641 20:43930984-43931006 CTAGTGAAGGGGATAGAGGAGGG - Intronic
1173608695 20:44350920-44350942 TTTAAGAAGGGGATCTAGGAGGG - Exonic
1173933851 20:46844536-46844558 TTTCTGCAGGGAATTGCAGACGG - Intergenic
1174039496 20:47688835-47688857 TTACAGGAGGGGCTTGAGGAGGG + Intronic
1174123766 20:48287799-48287821 TTTCTGAAAGGCATTGGAGAAGG + Intergenic
1176016395 20:62935929-62935951 TTTCTAGAGAGGATTAAGGAGGG + Intronic
1176049674 20:63111349-63111371 TTTGTGAAGGCCACTGAGGATGG - Intergenic
1177322180 21:19536896-19536918 TTTCTCTAAGGGACTGAGGAGGG + Intergenic
1177508545 21:22051255-22051277 TTTTTGAAGTTGATTGAAGATGG + Intergenic
1178607752 21:34054526-34054548 GATCTGAAGGGGGATGAGGAAGG + Intergenic
1180013564 21:45068063-45068085 GTTCTGGAGGGGATGGAGGCTGG - Intergenic
1182555925 22:31128241-31128263 ATTCTGAAGGGCTTTCAGGAGGG + Exonic
1183987487 22:41577514-41577536 GTTCTGAAGGGGCAGGAGGAGGG - Intronic
1184128157 22:42501835-42501857 GGTCTGCAGGGGAATGAGGAGGG + Intergenic
1184136947 22:42555148-42555170 GGTCTGCAGGGGAATGAGGAGGG + Intronic
1184448679 22:44569979-44570001 TTTCTGGAGGGGAGTGAAGGAGG - Intergenic
949265797 3:2154996-2155018 TATCTGAAGGAGATGGATGATGG - Intronic
950053599 3:10009394-10009416 TTTGTGAAGGGGTATGAGGCGGG + Intronic
950305245 3:11911682-11911704 TTTGTGAAGGGGTATGAGGCGGG + Intergenic
951806093 3:26645791-26645813 TGTCAGAAAGTGATTGAGGATGG + Intronic
952439008 3:33304264-33304286 TTTATGGTGGGGAATGAGGAGGG - Intronic
953026760 3:39149804-39149826 TTTCTGAAAGGGAATAAGGCTGG - Intronic
953814710 3:46145317-46145339 TTACTGAAGGGGAATGTGAAAGG + Intergenic
954996724 3:54888473-54888495 TTTCTGAAGTGGAGGGTGGAGGG + Intronic
955017426 3:55085897-55085919 TTCCTGAATGGGGTTTAGGAAGG - Intergenic
955041235 3:55319692-55319714 TTTCCCAAGGGGATTGAGTGAGG - Intergenic
955973874 3:64462490-64462512 TTTTTGGCGGTGATTGAGGAAGG - Intergenic
958914304 3:100031396-100031418 TTTGGGAAGTGGAGTGAGGAAGG + Intronic
959337664 3:105086662-105086684 TTTCTGATGTGGATGGATGAAGG - Intergenic
960192230 3:114720570-114720592 TTTTTGGAGAGGATTAAGGAGGG + Intronic
961088300 3:124089263-124089285 TTCCTGGAGGGGATGGAGAAGGG + Intronic
962837648 3:139203425-139203447 ATTCTGAAGGGGTTAGAGAAAGG - Intronic
963120045 3:141768722-141768744 TGACTGGAGAGGATTGAGGAGGG - Intergenic
963489727 3:145984467-145984489 TTTCTGAAGGAGAAAGAGAACGG + Intergenic
964723159 3:159787943-159787965 TTTATGTAGGGGAATGATGAAGG + Intronic
966752163 3:183332671-183332693 TTTCTGAAGGGGAGTCACGAAGG + Intronic
967098236 3:186194472-186194494 TTTCTGAAGGGCCTTAGGGAAGG + Intronic
967167690 3:186797362-186797384 TTTCTTCAGGGGAGTGAGGGAGG + Intronic
968728034 4:2257196-2257218 TTTCTGGAGGGGACTGTGGGGGG + Intronic
968951404 4:3695710-3695732 TTTCTGAAGGAGCTTGTGGGGGG + Intergenic
969778808 4:9380537-9380559 TTTCTGAAGAGAATTCCGGAGGG - Intergenic
971004913 4:22362516-22362538 TTTTTGAAAGGGAGGGAGGAGGG - Intronic
972477229 4:39462004-39462026 TTTCTAAAGTGGTTTGAGCAAGG + Intronic
975145886 4:70966741-70966763 TTACTCAAGGAGATTGAGGTGGG + Intronic
977926888 4:102710863-102710885 TTATTGAAGAGGATTGAAGAGGG - Intronic
978896570 4:113895659-113895681 TTTCTGAAAGACATAGAGGATGG + Intergenic
980071130 4:128243667-128243689 TTCCTGGAGGGGAGTGAGCAGGG - Intergenic
980175289 4:129337186-129337208 TTTATGAAAGGGATTGAGAAGGG - Intergenic
980232376 4:130061334-130061356 TTTATAAAATGGATTGAGGATGG - Intergenic
981102453 4:140844343-140844365 TTTGTGATGGGAATTCAGGAAGG - Intergenic
981488485 4:145314022-145314044 TTACTGAAAGGGAGGGAGGAAGG + Intergenic
981765348 4:148242288-148242310 TTGCTGGTGGGGATGGAGGAAGG + Intronic
986347993 5:6852402-6852424 TTTTTGGTGGGGGTTGAGGAGGG - Intergenic
986348224 5:6854026-6854048 TTTTTGGTGGGGGTTGAGGAGGG - Intergenic
986678622 5:10213075-10213097 TGTGTGAAGGGGAATGATGAAGG - Intergenic
987340895 5:16937660-16937682 TTTCTAAAGGGAAGTGAGGTGGG - Intergenic
988515467 5:31900426-31900448 TACCTGAAGGGGATAGGGGAGGG + Intronic
988984402 5:36602780-36602802 TTTCAGAAGAGGACTGAGCAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990121656 5:52461881-52461903 GTTCTGTAGGGAATGGAGGAAGG - Intergenic
990698911 5:58454228-58454250 TTCCTGAAGGGGAGGGAGAAGGG - Exonic
990734987 5:58850437-58850459 TTTCTGAAGGAGGTTGAAGCAGG + Intronic
990774939 5:59295774-59295796 TTTCTGAGGGGGCCTGAGGTAGG - Intronic
990820228 5:59831080-59831102 TTTCTGAAATGGAATGAGAAAGG + Intronic
992173268 5:74124691-74124713 TTTCTGATGGGGAAAGAGAATGG + Intergenic
994268539 5:97747292-97747314 TTTCTAAAGGGTATAAAGGAAGG - Intergenic
996362507 5:122665665-122665687 TTTCTGAAGAGAAGGGAGGAGGG + Intergenic
996850226 5:127943324-127943346 TTTCTGAAGTGGATTCTGTAGGG - Intergenic
997415669 5:133726479-133726501 CTTCTGGAGGAGAGTGAGGATGG - Intergenic
997857998 5:137390693-137390715 TTTCTGAAGGCAATTGAGACAGG - Intronic
998677236 5:144423467-144423489 TTTCTGAAAGGGCTGGGGGATGG - Intronic
1000282350 5:159793107-159793129 TTTCTGAAAGGGATTTCAGAAGG - Intergenic
1000297431 5:159924341-159924363 TTTCTGAAAGGGATTGACATAGG - Intronic
1000570856 5:162912212-162912234 TATCTGATGGGGATTGAGGGAGG - Intergenic
1000632245 5:163604055-163604077 AATATGAAGGGGATTGAGGAGGG + Intergenic
1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG + Intronic
1001916835 5:175568967-175568989 CTTGGGATGGGGATTGAGGAAGG + Intergenic
1002513003 5:179735233-179735255 ATTCTGAAAGGGATGGAGGAGGG - Intronic
1003568473 6:7240314-7240336 TTTCTTGAAGGGATGGAGGAGGG + Intronic
1004058049 6:12161173-12161195 TCTCAGAAGGGGAATGAGGCAGG - Intronic
1004193563 6:13485764-13485786 TTCCTGAAGGCGATTAGGGAGGG + Intronic
1004460381 6:15829681-15829703 ATGTTGAAGGGGGTTGAGGAAGG + Intergenic
1005572084 6:27155383-27155405 TTTCTAAATGGGGTTGGGGAAGG + Intergenic
1006088854 6:31616035-31616057 TTTCAGCAGGGGACTGAGGAAGG - Intronic
1010508841 6:76692243-76692265 TTTCTGAAGGGGAATTTGGGTGG + Intergenic
1010747844 6:79584459-79584481 GTTCTGAAAGGCATTCAGGAAGG - Intergenic
1010925549 6:81741895-81741917 TTTCTGAAGGGGATCCTGAAGGG + Intronic
1011217413 6:85019612-85019634 GTTCTGAGGGGGATGAAGGATGG - Intergenic
1011609366 6:89135080-89135102 TTGCTGAAGGGAATCGGGGAAGG + Intergenic
1012350794 6:98248030-98248052 TTTCTGGAGTGGACTGTGGAGGG - Intergenic
1013778790 6:113707627-113707649 TTTTTGAGGGGGAATGAAGATGG + Intergenic
1015265923 6:131292465-131292487 CTTCTCAAAGGGACTGAGGAAGG - Intergenic
1015617417 6:135092110-135092132 CTACTGATGTGGATTGAGGAGGG - Intronic
1016707154 6:147122298-147122320 TTTCAGAAGGGGATTGAATAGGG - Intergenic
1018654710 6:166024362-166024384 TTCCTGCAAGGGATTGAGCACGG - Intergenic
1019446574 7:1074362-1074384 TCTCTGCAGGGGAGGGAGGAAGG - Intronic
1019710892 7:2517754-2517776 TGGCTGCAGGGGATTGAGGAGGG + Intronic
1019754926 7:2762071-2762093 TTTCTGGAGGGGCTGGAGGTAGG - Intronic
1020814030 7:12882280-12882302 TTTGGGAAGGAGGTTGAGGAAGG + Intergenic
1022465789 7:30652621-30652643 TTTCTGAAGGGGAGACTGGAGGG + Intronic
1022653332 7:32297015-32297037 TTTCTGATGGGGATGGAGAGTGG + Intronic
1022998999 7:35788161-35788183 TATGTGAAGGTAATTGAGGATGG - Intergenic
1023085759 7:36568676-36568698 TTTCTGAAGGGGATTGAGGAGGG - Intronic
1024519675 7:50294078-50294100 TTTCAGAAGGGGAGGGAAGAGGG - Intergenic
1024940940 7:54762687-54762709 TTTCAAAAAGGGTTTGAGGAGGG - Intergenic
1024967161 7:55033886-55033908 TTTCTGAAGTGAAATGAAGAGGG - Intronic
1025047047 7:55700936-55700958 TCTCTGAGGGGTATTGAGAAGGG - Intergenic
1025640043 7:63358030-63358052 TTTCTGGAGGAGATTGTAGAGGG + Intergenic
1025642656 7:63390062-63390084 TTTCTGGAGGAGATTGTAGAGGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026653693 7:72237749-72237771 TTTGTGAAGGGGCTAGAAGAAGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1028203189 7:87986487-87986509 TTTCTGAAGGGGTATTTGGAAGG + Intronic
1029154885 7:98509661-98509683 TTTCTGTATGGGAGTGGGGAGGG + Intergenic
1030639285 7:111985841-111985863 TTTCAGAAGGGAATGGAGAATGG - Intronic
1030913702 7:115285404-115285426 TTTTTGAAGGGGAGAAAGGAAGG + Intergenic
1032466094 7:132146244-132146266 TTTCAGAAGGGCATGGAGAAGGG + Intronic
1032699724 7:134368845-134368867 TTTTTGAAGTGGATCCAGGATGG + Intergenic
1033659508 7:143393842-143393864 GTTATGAAGAGCATTGAGGATGG - Exonic
1033708150 7:143908451-143908473 TTCCTAAATGGGATTGAGGTAGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1036989419 8:13575835-13575857 ATTCTGAAGGGTATAAAGGAAGG + Intergenic
1037004300 8:13758570-13758592 TTTTTGTAGGGGAGAGAGGATGG + Intergenic
1037592797 8:20327662-20327684 TTTCTTAAGGCGCTTGGGGAAGG + Intergenic
1038045421 8:23761836-23761858 TTTATGGAAGGGATAGAGGAGGG - Intergenic
1038113393 8:24525158-24525180 TTTATGAAGAGGATAGAGGATGG - Intronic
1038404865 8:27313990-27314012 TTGCTTGAGGGGATTGGGGAGGG + Intronic
1038467086 8:27774348-27774370 TTGCTGCAGGGGATTGTGGGTGG + Intronic
1038559215 8:28556172-28556194 TTATTGCAGGGGATTGAGCAGGG + Intronic
1040106925 8:43546676-43546698 TTTCAGAAGGACATTGAGGCAGG - Intergenic
1040548702 8:48422092-48422114 TTTCAGAAAGGGATGGAGGGTGG + Intergenic
1040632475 8:49231261-49231283 TCTGTGAAGGGAATTGAAGAAGG + Intergenic
1041928293 8:63260510-63260532 TTTCCGCAGGGGATTGGGGGAGG - Intergenic
1043690670 8:83146930-83146952 TTTTTCAAGGGGGTGGAGGATGG - Intergenic
1046781263 8:118217807-118217829 TTTGTGAAGGGCATTATGGAGGG - Intronic
1046834737 8:118787904-118787926 TTTCTGTATGGTATTGAGGCAGG - Intergenic
1047461178 8:125066869-125066891 CTTCTGAAGGGGCCTGGGGAAGG - Intronic
1048629445 8:136226038-136226060 TTTCTAAAGTGGATGGAGGGAGG + Intergenic
1049922566 9:379020-379042 TTTGTGGATGGGAGTGAGGAGGG + Intronic
1050478451 9:6064880-6064902 TTGCTGAAGGGGCATGAGGAAGG + Intergenic
1051295352 9:15589094-15589116 TCTCTGAAGTGGATTGATGGGGG + Intronic
1051493620 9:17694884-17694906 TTTCTGTAGGGAATGGAGTAGGG + Intronic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053553362 9:39107417-39107439 CATCTGAATGGGATGGAGGAAGG + Intronic
1053817469 9:41927574-41927596 CATCTGAATGGGATGGAGGAAGG + Intronic
1054107725 9:61071245-61071267 CATCTGAATGGGATGGAGGAAGG + Intergenic
1054613132 9:67259880-67259902 CATCTGAATGGGATGGAGGAAGG - Intergenic
1054808171 9:69412677-69412699 TTACTAAAGGGAACTGAGGATGG + Intergenic
1055445409 9:76377463-76377485 TCTCTGTAGGGGGTTGAGGGTGG - Intergenic
1057966541 9:99509339-99509361 TGTCTGAAGGGGATTAAGTCTGG + Intergenic
1058447055 9:105063915-105063937 TTTATGAAGGGAATGGGGGAAGG - Intergenic
1058568008 9:106307715-106307737 TTTCTGAAACAGATTCAGGAAGG - Intergenic
1058752154 9:108050226-108050248 TTACTGAAGGGGAAAGAGGAAGG + Intergenic
1061234335 9:129333860-129333882 TTTCTGGAGGAGAGAGAGGAAGG - Intergenic
1062160464 9:135076792-135076814 ATTCTGAGGGAGATGGAGGAAGG - Intronic
1185508520 X:645710-645732 TTTCTGAAGGGGATAAAAGAGGG + Exonic
1186064044 X:5742547-5742569 TTTCTGATGGTGAATAAGGAAGG + Intergenic
1186683800 X:11903031-11903053 TTTTTGAAGGAAACTGAGGAAGG + Intergenic
1187071820 X:15896037-15896059 TTTCTGAAAGTGTCTGAGGAAGG - Intergenic
1187473387 X:19588908-19588930 TTTCTGAAGGTGATCATGGAAGG + Intronic
1187608612 X:20915343-20915365 TTTCTGAATGGGACTTAGAATGG + Intergenic
1187782454 X:22843213-22843235 CCTCTGAAAGGGATAGAGGAAGG - Intergenic
1187975711 X:24702747-24702769 TTTTGGAAGGGGATGGATGAGGG + Intronic
1189176893 X:38966477-38966499 TCACTAAAGGGGATGGAGGAAGG + Intergenic
1192337844 X:70236907-70236929 TTCCTGAATGGGTTTCAGGAGGG - Intronic
1192894696 X:75429805-75429827 TTTCTGTAGGGGACAGGGGAGGG - Intronic
1192953532 X:76043933-76043955 ATCCTGAAGGGGATGGAGCAGGG + Intergenic
1194329832 X:92568109-92568131 TTTTTGTAGTGTATTGAGGATGG - Intronic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1194972634 X:100360960-100360982 TTTGGGAAGGGGGATGAGGAGGG + Intronic
1195216068 X:102704212-102704234 TTGCTGAAGGGGGTGGAGGGAGG + Intergenic
1195429751 X:104775499-104775521 TTTCTGAAGGGTTTTGTTGAGGG + Intronic
1196898328 X:120359652-120359674 TTTTTGAAGTGCATGGAGGAGGG - Intergenic
1197240171 X:124114661-124114683 CTGCTGACTGGGATTGAGGAAGG + Intronic
1197288335 X:124623727-124623749 TTTTTAAAGGGCAATGAGGAAGG - Intronic
1198102835 X:133436845-133436867 TGTCTGCAGGGGATAGAAGAGGG + Intergenic
1198118947 X:133571906-133571928 TTTCTGAAGGACATGGGGGAAGG + Intronic
1199719550 X:150532724-150532746 TTTTCCAAGGGGTTTGAGGATGG - Intergenic
1200638536 Y:5687291-5687313 TTTTTGTAGTGTATTGAGGATGG - Intronic
1200832458 Y:7700324-7700346 TTTCCTAAGGGCATAGAGGAAGG + Intergenic
1201532350 Y:15005859-15005881 TTTCTGAGGGTGAATTAGGAAGG - Intergenic
1201966433 Y:19741472-19741494 TTTCAGATTGTGATTGAGGAAGG - Exonic