ID: 1023086665

View in Genome Browser
Species Human (GRCh38)
Location 7:36577093-36577115
Sequence ATTCTATTGTAGTGCATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023086665 Original CRISPR ATTCTATTGTAGTGCATGAA GGG (reversed) Intronic
903153492 1:21429244-21429266 GTGCTGTTGTACTGCATGAAGGG - Intergenic
907818941 1:57947918-57947940 ATTCTCTTGCAGAGCATGCAAGG + Intronic
909047720 1:70730117-70730139 TTTCTAATGTAGTGCTGGAATGG + Intergenic
909218529 1:72924021-72924043 ATTCTATTTTAATGAAAGAATGG - Intergenic
909275403 1:73678767-73678789 TTTCTTTTATAGTTCATGAAAGG + Intergenic
912271959 1:108220421-108220443 ATTTAATTGTTGTGCATGTATGG - Intergenic
913005045 1:114621718-114621740 ATGCTAGAGAAGTGCATGAATGG - Intronic
914781380 1:150788672-150788694 ATTCTCCTATAGTCCATGAAGGG - Intergenic
915055817 1:153128934-153128956 ATTTTATTCTACTGCATGAAAGG + Intergenic
918206954 1:182317987-182318009 ATTCTAGTGTAGTTGCTGAATGG - Intergenic
920441293 1:205982517-205982539 ATGCTATTGTAGTGCAGAGAGGG - Intronic
1063556881 10:7088888-7088910 TTTTTATTGCAGTGCAAGAATGG - Intergenic
1064782931 10:18862679-18862701 ATTTTATTTTAGTTCATGTAGGG + Intergenic
1067701893 10:48579861-48579883 TTTCTATTTAATTGCATGAACGG - Intronic
1068576989 10:58695160-58695182 ATTTCATTGTAGTCCAAGAAAGG - Intronic
1070300375 10:75199305-75199327 ATTCTATTGAAGAGCTTGATGGG + Intergenic
1074170191 10:110925755-110925777 ATTAAATTATATTGCATGAAAGG - Intronic
1075966023 10:126612417-126612439 GTTCTATTGGATGGCATGAAAGG + Intronic
1078985665 11:16594133-16594155 ATTCTTATGTAGGGCATGACAGG - Intronic
1079960354 11:26915953-26915975 ATGCTATTGTAGTCTATGATAGG - Intergenic
1086689935 11:89778194-89778216 ATTCTAGTGTATTGGATAAACGG + Intergenic
1086715919 11:90061761-90061783 ATTCTAGTGTATTGGATAAACGG - Intergenic
1093281546 12:17202413-17202435 ATTCTATTGTTGTTCCTGTATGG - Intergenic
1094418856 12:30248636-30248658 TTTTTATTGTATTACATGAAGGG - Intergenic
1095341867 12:41099165-41099187 ATTCTGTTGTTTTGTATGAATGG + Intergenic
1099539076 12:83883080-83883102 ATTCAATGGCAGTGCCTGAAGGG + Intergenic
1105949591 13:25217734-25217756 ATTCTAGTGAAGTGCTTGAGAGG + Intergenic
1108829413 13:54458994-54459016 ATTATACTGTAGAGGATGAAAGG - Intergenic
1109782289 13:67127543-67127565 GTTCTGTTGTAGTGCAAAAAAGG - Intronic
1110241612 13:73273451-73273473 ATTCTCTTTTACTGCATGACAGG + Intergenic
1110666500 13:78123716-78123738 ATTCAATTGTATTGAATGATGGG + Intergenic
1111795943 13:92919973-92919995 ATGCTATTTTAATGTATGAATGG - Intergenic
1111921980 13:94421945-94421967 ATTATATGATAGTGTATGAAGGG + Intergenic
1112109606 13:96281505-96281527 ATTCTATTGTAGTGCTAGAGAGG - Intronic
1112963134 13:105152960-105152982 ATTATTTTTTATTGCATGAATGG + Intergenic
1115186447 14:30693731-30693753 ATCCTAATATAGTTCATGAATGG + Intronic
1115776719 14:36723626-36723648 ATTCTTTTGTTGGGCAGGAAGGG + Intronic
1115916659 14:38322370-38322392 TTTTTATAGTAGTGCAAGAATGG - Intergenic
1118967334 14:70600295-70600317 ATTCTATTGGAGTGAAGGAATGG - Intronic
1119235493 14:73015693-73015715 ATTCTAGTGGAGTTCAGGAATGG - Intronic
1123801085 15:23821385-23821407 ATTGTATTGTGGTCCTTGAATGG - Intergenic
1124420435 15:29516328-29516350 ATTCTATTCCATTGCATGAATGG - Intronic
1127057723 15:55149462-55149484 TTTCTATTTTAATGTATGAAAGG + Intergenic
1127337370 15:58001762-58001784 ACTCCATTGTAGGGTATGAATGG + Intronic
1131736087 15:95333996-95334018 GTTCTATTGTGGTGGGTGAAGGG + Intergenic
1132077350 15:98833115-98833137 ATTCTATTGAAGTTCAGGAGAGG - Intronic
1133616523 16:7482158-7482180 ATTCCATTGTGTTGCATGAAGGG + Intronic
1135526439 16:23216910-23216932 CTGCCACTGTAGTGCATGAATGG - Intergenic
1140255972 16:73336757-73336779 ATTCTGCTTTAGTGGATGAAAGG - Intergenic
1140441556 16:74991904-74991926 ATTTTATTGTTTTGCTTGAAAGG - Intronic
1141023949 16:80526003-80526025 GTTCTATTGAAATGCAAGAATGG - Intergenic
1141843780 16:86593092-86593114 ATTCTATAACAGCGCATGAAAGG - Intergenic
1143695567 17:8613482-8613504 ATTCTTTTGTAGATCATGATAGG - Intronic
1143976469 17:10833931-10833953 TATCTATTGTAGTGCATGTGTGG - Intronic
1150013152 17:61525082-61525104 ATACTATGGTAGAGAATGAATGG + Intergenic
1150907712 17:69355802-69355824 ATACTCTTGTAGTGGATAAAAGG + Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1156058114 18:33035684-33035706 GATCTATTGTATAGCATGAATGG + Intronic
1159788628 18:72747450-72747472 TTTCTACTGTAGAGTATGAATGG + Exonic
1162658648 19:12152443-12152465 ATTATGGTGTATTGCATGAATGG - Intronic
1162826878 19:13258051-13258073 TTTCTACTGCTGTGCATGAAGGG + Intronic
927001997 2:18805731-18805753 ATTCTGTTTTATTGCATGTATGG - Intergenic
927407167 2:22784026-22784048 GTTTTATTGTAGTGCATTAGGGG - Intergenic
928925973 2:36579730-36579752 ATTTTATAGCAGTGCAAGAATGG + Intronic
930131792 2:47859684-47859706 ATTCTGTTTCAGTGCTTGAAGGG - Intronic
930917675 2:56713674-56713696 ATCCTATTGGAGTGCATGCCAGG + Intergenic
932390122 2:71381563-71381585 ATTCTATTGAAGGCCTTGAAGGG + Intronic
933858834 2:86443805-86443827 AATATATTGTGGTGCAAGAATGG + Intronic
938063337 2:128268433-128268455 GTGCTATTGTACTGCATGAAGGG + Exonic
941214430 2:162688076-162688098 AGTCTATTTTATTGCATGAGAGG + Intronic
946466790 2:219919212-219919234 ATTCTATTAAAGAGCATGCATGG - Intergenic
1168873178 20:1148224-1148246 ATTCCATTGTAGTGGAAGATTGG + Intronic
1170748061 20:19118380-19118402 ATTCCTCTGTGGTGCATGAATGG + Intergenic
1174821666 20:53731702-53731724 ATTTTATCGTAGAGCAGGAATGG + Intergenic
1179292458 21:40030592-40030614 ATTCTATGGGAGTGTTTGAAGGG - Intronic
1179665246 21:42906996-42907018 ATTTTTTTGTGGAGCATGAATGG + Intronic
949604818 3:5641141-5641163 ATCCTGTTATAGTGTATGAAAGG + Intergenic
949923160 3:9020285-9020307 ATTCTACTGTAAAGGATGAAAGG - Intronic
952038938 3:29238316-29238338 ATTCTCTTGAAGTATATGAAGGG + Intergenic
957372105 3:79308132-79308154 ATTATATTGTAGTACTTGTAAGG + Intronic
959574893 3:107924239-107924261 TCTCTATAGTAGTGCAAGAAAGG - Intergenic
960430093 3:117558796-117558818 TTTCTATTGAAGTCCTTGAAAGG - Intergenic
963338144 3:144001109-144001131 ATAGTATTTTACTGCATGAAGGG - Intronic
965421426 3:168463820-168463842 ATTTTATTGTGGGGCATGAAGGG + Intergenic
966483096 3:180433492-180433514 ATTCTATTATAATGAAAGAAAGG + Intergenic
966977797 3:185101459-185101481 TCTCTATAGTAGTGCAAGAATGG - Intronic
971228230 4:24775182-24775204 ATTCTATATCAGAGCATGAAGGG - Intergenic
973056256 4:45662921-45662943 ATTCTATTGGAGAGTAAGAATGG + Intergenic
973692103 4:53446124-53446146 CATCTTTTGTAGTGAATGAATGG - Intronic
975516913 4:75257972-75257994 TTTTTATAGTAGTGCAAGAATGG - Intergenic
975966768 4:79982954-79982976 ATTTTATTGTAATGTATAAAAGG + Intronic
976492135 4:85683334-85683356 ATTCTATCCTAGCCCATGAAGGG + Intronic
977228242 4:94419932-94419954 ATTCTTTTTTAATGCAGGAATGG + Intergenic
979220124 4:118213222-118213244 AGTCTACTGGAGTTCATGAATGG - Intronic
979460676 4:120979254-120979276 TTTCTATGGTAGTCCATGAGAGG + Intergenic
979847700 4:125537088-125537110 ATTCTACTGTAGTTCAACAAAGG + Intergenic
981626804 4:146766127-146766149 AATATATTCTAGTGTATGAATGG + Intronic
982929318 4:161382449-161382471 ATTTAATTGTCGTGCATTAAAGG + Intergenic
983250909 4:165345434-165345456 ATTCTATTCTTTTGCAAGAATGG - Intergenic
983673252 4:170262566-170262588 ATTGTTATGTACTGCATGAATGG - Intergenic
986080516 5:4387302-4387324 AGTCTATTTCAGTGCATAAAGGG - Intergenic
988350039 5:30091431-30091453 ATTCTATTGTAGTAAATAAAAGG - Intergenic
990563627 5:57007723-57007745 ATTTTATTTTAGGTCATGAATGG + Intergenic
990727379 5:58771431-58771453 ATTGTACTTTAATGCATGAAAGG + Intronic
993308582 5:86299584-86299606 ATTTAATTGTTGTGCATGTATGG + Intergenic
993920718 5:93797641-93797663 ATTTTAAAGTAGTGCCTGAAAGG + Intronic
999604566 5:153300351-153300373 ATTAAATTGTAGTGCCTGAACGG + Intergenic
1001525478 5:172425688-172425710 ATTCTACTGAAGAGCTTGAAGGG + Intronic
1004182790 6:13395441-13395463 TCTCTATTGTATTGCAAGAAAGG - Intronic
1004941135 6:20557451-20557473 TTTCTATTTTAATGTATGAAAGG - Intronic
1007640955 6:43339263-43339285 ATTCTATAGTAGTGGTGGAAAGG - Exonic
1008277709 6:49560362-49560384 ATTCTGTTGGAGTGGAAGAAGGG + Intronic
1011918608 6:92542543-92542565 GTTCTATTGTTTTGGATGAATGG + Intergenic
1012557055 6:100526495-100526517 ATTATATTATAGTCCTTGAAGGG + Intronic
1013532892 6:111036243-111036265 ATTCTATTGTTGGGCATTAATGG + Intergenic
1013909641 6:115258437-115258459 TTTTTATAGTAGTGCAAGAATGG + Intergenic
1017603802 6:156111756-156111778 ATGATTTTGAAGTGCATGAAAGG + Intergenic
1017626508 6:156354783-156354805 ATTATATTGCAGGGCATAAAGGG + Intergenic
1020242134 7:6403837-6403859 ATTCTGTTGTAGTGGCTGAAGGG - Intronic
1021185691 7:17562247-17562269 ATTCTCTTTTAGTGAATGCATGG + Intergenic
1022124996 7:27347807-27347829 ATTAGATTGTAGTGATTGAAGGG + Intergenic
1022893210 7:34722252-34722274 ATTCTATTGTATTTCATTATAGG - Intronic
1023086665 7:36577093-36577115 ATTCTATTGTAGTGCATGAAGGG - Intronic
1023152211 7:37212824-37212846 GGTCTCTTGTTGTGCATGAAAGG - Intronic
1027586520 7:80065505-80065527 TTTCTATAGCAGTGCAAGAATGG - Intergenic
1034094645 7:148395931-148395953 AATCTATCGTAGGGGATGAAGGG - Intronic
1037099090 8:15020602-15020624 ATTCTATTATAGTGCAGGAAGGG + Intronic
1042914876 8:73865761-73865783 AGTCTTTTGTACTACATGAAAGG - Intronic
1043863220 8:85346265-85346287 AATCTCTTCTACTGCATGAATGG + Intronic
1044362850 8:91308897-91308919 ATTATCTTGTAGTGCCAGAAAGG - Intronic
1046376846 8:113394592-113394614 TTTCCATTTTAGTGCATCAAAGG + Intronic
1046408563 8:113808251-113808273 TTTCTCTTTTAGTGCATAAATGG + Intergenic
1046692317 8:117299514-117299536 ATTCTATTGAAGTATATGAGGGG - Intergenic
1050073339 9:1839196-1839218 AGTCTATTGTAATGCCTGGATGG + Intergenic
1051963111 9:22792167-22792189 ATTTCATTTTAGTGGATGAATGG - Intergenic
1052292043 9:26853117-26853139 ATTATTTTGTACTGTATGAATGG - Intronic
1055330640 9:75179474-75179496 ATTTTATAGCAGTGCAAGAACGG - Intergenic
1055811831 9:80157642-80157664 ATTCTACTGTAGCACATGAATGG - Intergenic
1058158944 9:101546375-101546397 TTTCTTTTGTTGTGAATGAATGG + Intronic
1058386005 9:104436704-104436726 ATTCTTATGGAGTGAATGAAGGG - Intergenic
1060449114 9:123720536-123720558 ATTGTATTTTGGTGAATGAAAGG - Intronic
1061301410 9:129707399-129707421 ATACTATTCCATTGCATGAATGG + Intronic
1061409469 9:130411269-130411291 ATAATATTGCATTGCATGAACGG - Intronic
1189589066 X:42492802-42492824 AGAATATTGTAGTGGATGAAAGG - Intergenic
1195557632 X:106245279-106245301 AATCTAATGTACAGCATGAATGG - Intergenic
1196651961 X:118177172-118177194 GATCCATTGTATTGCATGAAGGG + Intergenic