ID: 1023086916

View in Genome Browser
Species Human (GRCh38)
Location 7:36579929-36579951
Sequence CAATTCCTTCAGACTTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023086916 Original CRISPR CAATTCCTTCAGACTTGTGA GGG (reversed) Intronic
902039069 1:13479771-13479793 CAATACCCTCAGCCTTGTGCTGG - Intronic
904224253 1:29001648-29001670 CAATGCCTTCAAAATTCTGAAGG - Intronic
907673727 1:56499562-56499584 CAACTCCTACAGACTTGAGGGGG + Intronic
907695214 1:56718693-56718715 AAATTCCATCACACTTGTGAAGG + Intergenic
909298716 1:73983745-73983767 CTATGCCTTCAGGCCTGTGATGG + Intergenic
911078489 1:93904438-93904460 TAATTTCTTCAGTTTTGTGAGGG - Intronic
911520715 1:98927042-98927064 CACTTAATTCAGACCTGTGATGG + Intronic
912038013 1:105346873-105346895 CAATTCTTTCACATTTGTCAAGG + Intergenic
912112356 1:106358642-106358664 CAGTACCTTCAGACTTATTAGGG - Intergenic
912182656 1:107237558-107237580 CCAGGCCTTCAGACCTGTGATGG - Intronic
912302085 1:108528480-108528502 CAATTCCTTCACAGTTCTGAAGG + Intergenic
912440000 1:109690527-109690549 GAAGTCCTTCAGATTTGGGAAGG - Exonic
916663094 1:166940480-166940502 CCCTCCTTTCAGACTTGTGATGG + Intronic
917773896 1:178312387-178312409 AATTTCCTTCAGAATTTTGAGGG - Intronic
918745409 1:188192802-188192824 CTATTCCTTCACAGTTGTGAAGG + Intergenic
920976135 1:210787086-210787108 CAAGGCCTTGAGACTTGTTAGGG - Intronic
924589754 1:245392521-245392543 CATTTTCCTCAGAATTGTGAAGG + Intronic
924782912 1:247169432-247169454 GGATTCTTTCACACTTGTGAAGG - Intronic
924787120 1:247209278-247209300 GGATTCTCTCAGACTTGTGAAGG - Intergenic
1063040891 10:2336351-2336373 CAATTCCTTCAGAGCTCTGATGG - Intergenic
1065910614 10:30300937-30300959 CAATGCCTTCAGAGTTCTGGTGG - Intergenic
1066975530 10:42365012-42365034 TGATTCTTTCAGATTTGTGAAGG - Intergenic
1069499639 10:68940085-68940107 CAATTTCTTTAAACTTTTGAAGG - Intronic
1071676707 10:87661545-87661567 GAATTCCTTCTCAGTTGTGATGG + Intronic
1073735412 10:106339403-106339425 CCATTTCTTCAGATTTCTGAAGG + Intergenic
1075582252 10:123629732-123629754 CAATTCATTCAGAATTGCCATGG - Intergenic
1077249307 11:1554013-1554035 CTCTTCCTTCAGACTGGTGGTGG - Intergenic
1078213109 11:9287485-9287507 CAAATGTTTCAGACCTGTGATGG - Intronic
1079957335 11:26881701-26881723 CCAGTCCTTCAGGCCTGTGATGG - Intergenic
1080013801 11:27484094-27484116 GAATTCCTTCAGTCTTCTGATGG - Intergenic
1080608127 11:33881446-33881468 CAATTGCTTGACCCTTGTGAAGG - Intronic
1082926001 11:58548093-58548115 CAATGTCTTCAGAATTATGAAGG + Intronic
1083539568 11:63503165-63503187 TAATTTCTTCAGGCTTGGGAGGG - Intergenic
1084413838 11:69019096-69019118 CTCTTCCTTCAGGCTTGTGGCGG - Intergenic
1085999774 11:81968582-81968604 TAATTCCATCAGACATGTAATGG - Intergenic
1086471247 11:87114008-87114030 ATTTTCCTTCAGAATTGTGAAGG - Intronic
1087524189 11:99286999-99287021 CAATTTCTTCAGAATTTTAAAGG - Intronic
1088642748 11:111889211-111889233 CAATTCCTTCAGTCTTCTGATGG + Intergenic
1090179625 11:124685135-124685157 CTATGCCTCCAGGCTTGTGATGG - Intronic
1090591165 11:128270908-128270930 CAATTTCTTCAGAATTTTGAAGG - Intergenic
1091962321 12:4707057-4707079 CTATTCTTTCAAACTTGTTAAGG - Intronic
1092232430 12:6783559-6783581 CCATGCTTTCAGACATGTGATGG + Intergenic
1095341895 12:41099737-41099759 CAATTCTTTGAGTCATGTGAAGG - Intergenic
1095796727 12:46227148-46227170 CAATACCTTCAAAATTCTGAAGG + Intronic
1096190983 12:49619072-49619094 CAATGCCTTCATAATTCTGAAGG + Intronic
1096190984 12:49619077-49619099 GAATTCCTTCAGAATTATGAAGG - Intronic
1097158055 12:57026974-57026996 CAGTGCCTTCAGCCCTGTGAAGG + Intronic
1098319790 12:69231940-69231962 CTAGGCCTTCAGACCTGTGAAGG - Intergenic
1098995211 12:77111263-77111285 CAATGACTTTAAACTTGTGAGGG - Intergenic
1099202879 12:79695398-79695420 CAATGCCTTCAAAATTATGAAGG - Intergenic
1099433904 12:82620466-82620488 CAAGTCTTTCAGACTTGTAGAGG - Intergenic
1100347225 12:93744169-93744191 CCTTTACTTCAGCCTTGTGAAGG - Intronic
1101041318 12:100758719-100758741 CTATTCCTTCACAGTTCTGAAGG + Intronic
1106016850 13:25877804-25877826 CAAGCCCTTCAGACATGTCAAGG + Intronic
1107105393 13:36637220-36637242 CTAAGCCTTCAGACTTGTAATGG + Intergenic
1107239226 13:38212003-38212025 CAATACCCTCAGACTTATTAGGG - Intergenic
1109817200 13:67600239-67600261 CACTGCCTTCAGAATTGTAATGG + Intergenic
1110325839 13:74214560-74214582 CAACGCCTTCACATTTGTGAAGG - Intergenic
1110473641 13:75888319-75888341 CATTACTTTCAGAGTTGTGAGGG - Intergenic
1112487724 13:99834862-99834884 CAATTGGTTCAGAATTTTGACGG + Intronic
1113828044 13:113272047-113272069 CAATCCCTTCAAAGTTCTGAGGG - Intergenic
1115232486 14:31176514-31176536 CAATTATTTAAGACTTGTAAGGG + Intronic
1116057677 14:39884365-39884387 CAATCCAGTCAGACATGTGAGGG + Intergenic
1116592578 14:46797652-46797674 GAGTTCCCTCAGACTTGAGATGG + Intergenic
1116877970 14:50132896-50132918 CAATTCTTTGAGAGTTTTGATGG + Intronic
1119833810 14:77728624-77728646 CCATTCCCTCAGACTGGCGAGGG - Intronic
1120623229 14:86791967-86791989 CTAGTCCTCCAGGCTTGTGATGG - Intergenic
1120763350 14:88305893-88305915 CAATTCCCTCAGCCTTGGGTAGG - Intronic
1121663766 14:95656026-95656048 CAATGCCTTCAAAGTTCTGAGGG - Intergenic
1124134033 15:27018325-27018347 CAAATCCTTCAGAGCTCTGATGG - Intronic
1125336185 15:38628613-38628635 CAATGCCCTCTGAATTGTGAGGG + Intergenic
1126633154 15:50757502-50757524 CAATTCCTTCAGACTGGTCCTGG + Intronic
1127990478 15:64111690-64111712 AAATTCCCTCAGATTTGTTAAGG + Intronic
1128068525 15:64779062-64779084 CAACTCTTTCAGACATCTGAAGG + Intergenic
1128988171 15:72236377-72236399 CAATTTCTTCAGGCCTATGAGGG + Intergenic
1129665473 15:77577203-77577225 GAATTCCTTAAGAGTTGGGAAGG - Intergenic
1130399185 15:83533333-83533355 CAATACCTAGAGACTTGGGATGG + Intronic
1131569823 15:93523544-93523566 CAAATACTTGAGACTTGTCAGGG + Intergenic
1136465405 16:30439743-30439765 CAATGCCTTCAAAATTCTGAGGG - Intergenic
1136673145 16:31875513-31875535 AGATTCATTCAGATTTGTGAAGG + Intronic
1137409375 16:48214784-48214806 CAAAGCCTTCAGACCTTTGAGGG + Intronic
1138067044 16:53953076-53953098 CAATTACTTGAGAATTGTGAAGG + Intronic
1140657238 16:77153282-77153304 CATTTCCTTCTGCCTGGTGAAGG - Intergenic
1141162687 16:81639778-81639800 CAATCCCATCAGACTGGTGTTGG - Intronic
1141329373 16:83094777-83094799 GACTTCCTTCTGACTTGTCAAGG + Intronic
1144521418 17:15954832-15954854 CAACCCCTTCAGACATCTGAGGG - Intronic
1146975488 17:37107770-37107792 CAATTGCTTCACACTTGGGCTGG + Intronic
1146999202 17:37348520-37348542 CAATGCCTTCAAAATTCTGAAGG + Intronic
1148963770 17:51417116-51417138 CATTTCCCTGAGACTTCTGAGGG - Intergenic
1149076943 17:52607084-52607106 CCATTCCTTCATACTCGTGAAGG + Intergenic
1149228536 17:54504464-54504486 CAATTTCTTCAGATTGGGGATGG + Intergenic
1151922569 17:77168541-77168563 CTTTTCCATGAGACTTGTGATGG + Intronic
1154049722 18:10942798-10942820 CTAGGCCTTCAGGCTTGTGATGG - Intronic
1156172257 18:34499710-34499732 CATTTCCTTAAGACTAATGATGG + Intronic
1157896522 18:51473938-51473960 CAATGCCTTCAAAATTATGAAGG - Intergenic
1158032642 18:52985369-52985391 CAATGTCTTCAGAGTTCTGAGGG - Intronic
1158836739 18:61338103-61338125 CAATCCCTTTTGATTTGTGATGG - Intronic
1160384829 18:78489345-78489367 CAATTCCTTCTGACTGGTTGAGG - Intergenic
1161445719 19:4318034-4318056 AAATTCCTCCAGACGTGGGAGGG + Intronic
1164890058 19:31815608-31815630 CGATTCCTGCACATTTGTGATGG - Intergenic
1166119909 19:40680034-40680056 GAATTCCTTCCTACTTCTGAAGG - Intronic
925761147 2:7186121-7186143 CATTTCCTTTGAACTTGTGATGG + Intergenic
926514087 2:13819356-13819378 CTCTTTCTTCAGACTTGTCAGGG + Intergenic
927557948 2:24049432-24049454 CCAGTCCTACAGACTTGTGGGGG - Intronic
931988775 2:67768459-67768481 AATTTCCTTCAGAATTTTGAAGG - Intergenic
932308973 2:70724664-70724686 CAAGTCCTGCAGCCTTGAGAGGG - Intronic
933052346 2:77615380-77615402 CAACTTCTTCAGTCTTGGGAGGG - Intergenic
933700819 2:85254257-85254279 CAATTAATTCAGACTTGGGGTGG + Intronic
938367474 2:130746091-130746113 CAATTCCTTTATAATTCTGAGGG + Intergenic
939105594 2:137945028-137945050 CCTTTCTTTCAGAGTTGTGAAGG - Intergenic
940834282 2:158503100-158503122 CAATTCCTTCACATGTGTTATGG - Intronic
941892775 2:170598807-170598829 CAAATCTTTCAGAGTTGTTACGG + Intronic
942733405 2:179083010-179083032 CTAAGCCTTCAGACTTGTGATGG + Intergenic
942753200 2:179311295-179311317 CATTTCCTTCAGATTATTGATGG - Intergenic
942825466 2:180169852-180169874 CTAGCCCTCCAGACTTGTGATGG + Intergenic
942900492 2:181111027-181111049 AAATTCTTTCAAACCTGTGAGGG - Intergenic
942979570 2:182063659-182063681 CGATGCCATCAGACCTGTGAGGG - Intronic
943229148 2:185223204-185223226 GAATTACTTCAGTCTTCTGAGGG + Intergenic
943775473 2:191761164-191761186 GAATGCTTTCAGACTTCTGACGG + Intergenic
943910802 2:193564165-193564187 CAATTATTTCAGAGTTATGAGGG + Intergenic
944835946 2:203579963-203579985 TGATTCCTTCAGACCTTTGAAGG + Intergenic
944961387 2:204878223-204878245 CAATTTCTTCAGTCCTTTGATGG - Intronic
946003303 2:216501370-216501392 CAACTCCTTCAGTCTTCTGATGG - Exonic
1169775668 20:9250157-9250179 AAAATCCTTCAGCCTTGTGTTGG + Intronic
1170836204 20:19886739-19886761 AAATTCCTCCAGACTTGTACCGG - Exonic
1173625085 20:44466576-44466598 CAACTCCTTCAGGCTTCTGATGG + Intergenic
1174373317 20:50108979-50109001 CATTTCCTGCAGGCTGGTGAGGG + Intronic
1177165146 21:17593160-17593182 TAATTCCATCAGTCTTGTAAGGG - Intronic
1177678334 21:24332303-24332325 AAATTCCTGAGGACTTGTGAGGG - Intergenic
1181679826 22:24486309-24486331 CACTTCATTCAGATTTCTGAAGG - Intergenic
1182576145 22:31274328-31274350 TAATTCCTACAAAGTTGTGAGGG + Intronic
1184441063 22:44516113-44516135 AAATGCCTTCAGAATTTTGAAGG + Intergenic
1184914553 22:47560343-47560365 CCATCCCTTTAGACTTGCGATGG - Intergenic
1185219091 22:49620134-49620156 GAATTCGTGCAGACTTGAGATGG + Intronic
951162594 3:19443144-19443166 CAATTTCATCAGCCTTGTGTGGG - Intronic
952503087 3:33982447-33982469 CAATGTCATCAGAATTGTGAGGG - Intergenic
953235992 3:41107663-41107685 CAATTCCTTTACATTTGTGGAGG + Intergenic
954935682 3:54324341-54324363 CATTTACTTCAGACATCTGACGG - Intronic
957691682 3:83579150-83579172 CAACTCCTACAGAATTTTGATGG + Intergenic
958672224 3:97219653-97219675 CTAGGCCTCCAGACTTGTGATGG + Intronic
959316303 3:104811742-104811764 CATTTCCTTGAGATTAGTGATGG - Intergenic
960800595 3:121535365-121535387 CTTTTCCTTCAGAGTTGTCAAGG - Intronic
961570308 3:127793044-127793066 GAATTCCTTCAGACTTAGGTAGG - Intronic
962589562 3:136874869-136874891 CAAGGCCTTCAGAATTCTGAAGG - Intronic
964440292 3:156701570-156701592 CCATTCCTCCAGATTAGTGATGG + Intronic
965506069 3:169516707-169516729 CAAATCCTGCAAACATGTGATGG - Intronic
966333442 3:178840783-178840805 CAATGCCTCCAGGCCTGTGATGG + Intronic
966469520 3:180273425-180273447 CAAAGCCTTCAAAATTGTGAGGG - Intergenic
966530316 3:180971431-180971453 CAGTTTCTTCACACTTGAGATGG + Intronic
969885237 4:10209422-10209444 TAGATGCTTCAGACTTGTGAAGG + Intergenic
970659253 4:18265391-18265413 CTAGGCCTTCAGGCTTGTGATGG + Intergenic
970673634 4:18423277-18423299 CAATCCCTTCAGGCTTTGGATGG - Intergenic
972454289 4:39238116-39238138 AAATTCCTTCAGACTATTGGGGG - Intronic
973545551 4:51978091-51978113 CAACTCCTTCAGTCTTCTGATGG + Intergenic
973961048 4:56110221-56110243 CACTTCCCTCAGAATTTTGAAGG - Intergenic
974395057 4:61323246-61323268 CTATGCCTTCAGGCCTGTGATGG + Intronic
975038179 4:69710382-69710404 CTAGGCCTCCAGACTTGTGATGG + Intergenic
975730547 4:77333531-77333553 CTTTTCCATGAGACTTGTGAAGG + Intronic
976205306 4:82618551-82618573 CAGTTCCTCCAGGCTTGTAATGG - Intergenic
976770630 4:88648485-88648507 ACTTTCCTTCAGAATTGTGAGGG + Intronic
977153166 4:93539727-93539749 CAATGCATTCAAACTTCTGAAGG - Intronic
977349465 4:95862814-95862836 CATTTCCATCATCCTTGTGATGG - Intergenic
979426452 4:120572792-120572814 CAATACCTCCAGGCCTGTGATGG + Intergenic
979690263 4:123551949-123551971 CTTTTCCTTCAGATTTTTGAAGG + Intergenic
981873838 4:149517620-149517642 CAATACCTTCAGACATGCCAAGG - Intergenic
982127575 4:152197691-152197713 CTGATCCTTCAGACTTGGGAAGG + Intergenic
986353375 5:6901251-6901273 CAAATTCTGCAGGCTTGTGAGGG - Intergenic
988138194 5:27201572-27201594 CTAGTCCTACAGACCTGTGATGG + Intergenic
989029891 5:37107892-37107914 CATTTCCTTCAGCCTTTTGATGG - Intronic
989151583 5:38305310-38305332 CAATTACTTCAAAATTCTGAAGG + Intronic
989381788 5:40816559-40816581 CATTTCCTTCAGAATTTTGAAGG + Intergenic
989381789 5:40816564-40816586 CAATACCTTCAAAATTCTGAAGG - Intergenic
990099520 5:52164287-52164309 TATTTCCTTCAGATTTGTGTAGG + Intergenic
990520364 5:56573486-56573508 CTACACCTTCAGAGTTGTGATGG + Intronic
990939960 5:61192085-61192107 AAGTGCCTTCAAACTTGTGAAGG + Intergenic
991156945 5:63448947-63448969 CAATTCCTTCGGACTTGTCTTGG - Intergenic
991195700 5:63929833-63929855 CAATTTCTTTAGGCTTTTGAGGG - Intergenic
991414104 5:66374323-66374345 CAATTTCTACAGAATTCTGATGG - Intergenic
992829402 5:80579710-80579732 CAATGCCTTCAGATTTTTGAAGG + Intergenic
993335909 5:86658549-86658571 CATTTCCTTCAGACATTTGGAGG + Intergenic
994813212 5:104549394-104549416 CTTTACCTTCAGACTAGTGAAGG + Intergenic
994878936 5:105461190-105461212 CTATGCCTCCAGGCTTGTGATGG + Intergenic
996232112 5:121078451-121078473 CCATTCCCACAGACTTCTGAAGG + Intergenic
997435619 5:133872545-133872567 CAATGCCTTCAAATTTCTGAGGG + Intergenic
997935795 5:138109561-138109583 CAATTCCTTCATGCTTCTCAGGG - Intergenic
1005278086 6:24241734-24241756 AAAGTCCTTCAAACCTGTGATGG + Intronic
1005321264 6:24656700-24656722 GAATGCCTTCAGAATTCTGAAGG + Intronic
1005440359 6:25860903-25860925 CTAATCCTCCAGAATTGTGAGGG + Intronic
1005966958 6:30733398-30733420 GAATGCCTTCAGAATTCTGATGG - Intronic
1006458025 6:34143139-34143161 CAATACCTTCACACCTGTCAGGG - Intronic
1006482545 6:34309020-34309042 CTATTCTTTCAGATTTGTTAAGG - Intronic
1009306043 6:62090217-62090239 CAATTCCTTTAGTATGGTGAAGG - Intronic
1009501050 6:64414298-64414320 CATTTCCCTCAGAATTTTGAAGG - Intronic
1010499241 6:76575254-76575276 CAATTCTGTCTGACTTCTGAAGG - Intergenic
1010909078 6:81530841-81530863 CAATTGTTTCAGACTGGGGAGGG + Intronic
1011164840 6:84434863-84434885 TAATTTCTTATGACTTGTGATGG + Intergenic
1013021513 6:106225298-106225320 CAATTCATTCAGATTTTTCAAGG + Intronic
1015667893 6:135651852-135651874 CTATTCCTTCAAATTTGTTAAGG - Intergenic
1017681162 6:156865373-156865395 CAAGTGCTTCAGAATTGTGAAGG - Intronic
1019784090 7:2962843-2962865 CAATGCCTTCACATTTTTGATGG + Intronic
1021010330 7:15455702-15455724 CAATGCCTTCAAAATTCTGAAGG - Intronic
1021636105 7:22695376-22695398 CAATGCTTTCAAACATGTGAAGG - Intergenic
1022585739 7:31607470-31607492 TATTTCCTTCAGAATTCTGAAGG + Intronic
1022585740 7:31607475-31607497 CAAGGCCTTCAGAATTCTGAAGG - Intronic
1023086916 7:36579929-36579951 CAATTCCTTCAGACTTGTGAGGG - Intronic
1023132520 7:37016953-37016975 CAATTGTTTCAGATTTGTGTTGG - Intronic
1023222893 7:37938375-37938397 CAATTCCATGAGATTTTTGATGG - Intronic
1027353114 7:77331919-77331941 CAAATCCTGCAGACGTTTGATGG + Intronic
1028337236 7:89673019-89673041 CAGTTTCTTCAGAGTTTTGAAGG + Intergenic
1030251491 7:107450328-107450350 CAATTTCTTCAGTCTTCTGATGG - Intronic
1031238640 7:119210699-119210721 CAAGGCCTTGAGGCTTGTGATGG - Intergenic
1031315847 7:120256906-120256928 CTAAGCCTTCAGACCTGTGATGG - Intergenic
1033035243 7:137869617-137869639 CAATTCCTTTAAAATTCTGAAGG + Intergenic
1033186045 7:139227549-139227571 CAATTGCTTCAGTCTTCTGATGG + Intergenic
1034083924 7:148306124-148306146 AAATTCCTTCAAACTTGTGAAGG - Intronic
1035138885 7:156737248-156737270 CAATGCCTTCAGAATTCTGAAGG - Intronic
1035534196 8:378648-378670 CAATTCCTTCAGGCTTGGGGAGG + Intergenic
1035869814 8:3125611-3125633 CAATTCCTAAAGACTTCTGAAGG + Intronic
1037270518 8:17124784-17124806 CAATGCTTTCAGAATTCTGAGGG - Intergenic
1038111777 8:24507820-24507842 CTATTCTTTCAGACTTTTGTTGG + Intronic
1040626503 8:49155804-49155826 CAATCCCTTCTGGCTTGTAAAGG - Intergenic
1042169738 8:65979956-65979978 CTATGCCTCCAGACCTGTGATGG - Intergenic
1042494252 8:69438442-69438464 CAATTCCTTTAAACTTCTGAAGG + Intergenic
1043062468 8:75521955-75521977 CAATACATTCAGACTTAAGATGG + Intronic
1044687693 8:94843605-94843627 CAATTTCTTCAGTCTTATGATGG + Intronic
1044863209 8:96543446-96543468 TAATTCCTTCATATTTGTTAAGG + Intronic
1046087007 8:109450494-109450516 CAATGCTTTGAGACTTGTCAAGG + Intronic
1046803473 8:118454248-118454270 CAATGCCTTCAAAATTGTGAGGG - Intronic
1050131363 9:2415893-2415915 CAATGCCTTCAGAATTTTGAGGG - Intergenic
1052154701 9:25170779-25170801 AAAATATTTCAGACTTGTGATGG + Intergenic
1052454165 9:28673140-28673162 AAATTCCTTCAGAGTTTTGTGGG + Intergenic
1053672791 9:40385620-40385642 CCATTCCTTCAGCCTTGCAAAGG - Intergenic
1053922607 9:43012001-43012023 CCATTCCTTCAGCCTTGCAAAGG - Intergenic
1054383903 9:64525682-64525704 CCATTCCTTCAGCCTTGCAAAGG - Intergenic
1054511834 9:65990663-65990685 CCATTCCTTCAGCCTTGCAAAGG + Intergenic
1054722684 9:68618896-68618918 CAAAGCCTTCAAACTTCTGAAGG - Intergenic
1055634526 9:78262414-78262436 CAATTCCTCCAGAGTGTTGAGGG - Intronic
1055859736 9:80733754-80733776 CATTTGCTTCAGAATTTTGATGG - Intergenic
1058368572 9:104237258-104237280 CAATTCATTCTGACTTAAGATGG - Intergenic
1058449079 9:105079475-105079497 CACTTCCTTCACTCTTGTTAGGG - Intergenic
1058746242 9:107993808-107993830 GAATTCCTTCAGACTTGAACTGG + Intergenic
1059047272 9:110882539-110882561 CAATTCCTACACACTTTTGAAGG + Intronic
1186682382 X:11889397-11889419 CAATTCATTCAGACTTACAATGG - Intergenic
1186860774 X:13670398-13670420 CAATGCCTTCAAAGTTGTCAGGG + Intronic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1188777190 X:34234436-34234458 AAATTCCTTCAGTCTGGTTAGGG - Intergenic
1190879788 X:54483998-54484020 CAATCCCTTCAGCCTTGTGAAGG + Intronic
1192668410 X:73112341-73112363 TATTTCCTTCAGATTTGTGTAGG + Intergenic
1193745210 X:85270050-85270072 CAGTACCTTCAAATTTGTGACGG + Exonic
1194185039 X:90765327-90765349 CTAGACCTTCAGGCTTGTGATGG + Intergenic
1194596527 X:95865816-95865838 CAATCCCTTCTGGCTTGTAAGGG - Intergenic
1194838628 X:98713144-98713166 CTAGGCCTCCAGACTTGTGATGG - Intergenic
1194923766 X:99798311-99798333 CAATGCCTTCAAAATTTTGAGGG - Intergenic
1195242198 X:102963273-102963295 CAATTTCTTGAAACTTGAGAAGG + Intergenic
1196626963 X:117887608-117887630 CACTACCTTCAGACTTCTAAGGG + Intergenic
1197293071 X:124684264-124684286 GAATTCCTTAGCACTTGTGAAGG - Intronic
1197349834 X:125370104-125370126 CAAGGCCTTCATGCTTGTGATGG + Intergenic
1198688146 X:139249893-139249915 CTATGCCTTCAGATTTTTGATGG - Intergenic
1198959349 X:142167961-142167983 CAATTCCTTAAGTCTTGGCAGGG + Intergenic
1199797253 X:151212239-151212261 CTATTCCTTCAAATTTGTTAAGG - Intergenic
1200312519 X:155092975-155092997 CAATGCCTTCAAAGTTATGAGGG - Intronic
1201590046 Y:15604636-15604658 CTATACCTCCAGACCTGTGATGG + Intergenic