ID: 1023088503

View in Genome Browser
Species Human (GRCh38)
Location 7:36596175-36596197
Sequence ATCTCTTAGGGGAAGGTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023088503_1023088509 -1 Left 1023088503 7:36596175-36596197 CCCGTCACCTTCCCCTAAGAGAT 0: 1
1: 0
2: 1
3: 12
4: 136
Right 1023088509 7:36596197-36596219 TAACTCTTGTGAGATAACCACGG 0: 1
1: 0
2: 1
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023088503 Original CRISPR ATCTCTTAGGGGAAGGTGAC GGG (reversed) Intronic
900549504 1:3247127-3247149 ACCTCATAGGGGAACATGACGGG + Intronic
901868137 1:12121234-12121256 CCCTCTTTGGGGAAGGTCACTGG - Intronic
901868699 1:12124899-12124921 AGCTCTTAGGGAAAGATGCCAGG + Intronic
902560120 1:17272114-17272136 AGCTCTTAGGGGAGCATGACTGG + Intronic
903423141 1:23233050-23233072 ATCACTTAGGAGAGGGTGACTGG + Intergenic
903685184 1:25126349-25126371 ATGTATTAGGAGAAAGTGACTGG + Intergenic
905337032 1:37251878-37251900 ATGTCTCAGGGGAAGGGGCCTGG + Intergenic
905809632 1:40902614-40902636 ATCGCTGAGGCGATGGTGACAGG + Intergenic
905870329 1:41399897-41399919 TTCTCTTAGGGGAAGCTGGCAGG - Intergenic
906492321 1:46278303-46278325 AGCTCTTAGAGGAAGGAGATAGG + Exonic
909003687 1:70250027-70250049 ACCTCCTAGGGGATGGTGAGCGG - Exonic
921566541 1:216728488-216728510 AACTCTGAGAGGAAGGTGGCGGG + Intronic
924503408 1:244657866-244657888 ATCTCTTCGGGGAAGGAGTGGGG - Intronic
1065998326 10:31080565-31080587 AGCTCTTAGGAGAAGGTGAGTGG - Intergenic
1068265024 10:54636341-54636363 ATCTCTGAGGGTAAAGAGACAGG - Intronic
1070037219 10:72738184-72738206 ATTTATTTGGGGAAGGTGAAGGG + Intronic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1070417690 10:76205808-76205830 AACTCTTGGGGGAAGTTGGCTGG + Intronic
1071081651 10:81819832-81819854 ATCTTTTAGAGGAATTTGACCGG - Intergenic
1073571299 10:104583079-104583101 ACCCCTCAGGGGAGGGTGACTGG + Intergenic
1079508992 11:21188117-21188139 ATCCCTTTGGGGAAGATGAAGGG + Intronic
1080137798 11:28877546-28877568 AGCACATAAGGGAAGGTGACAGG - Intergenic
1080889959 11:36400928-36400950 ACCTCTTAGAGGAAGTTGGCTGG - Intronic
1083028589 11:59571623-59571645 ATCCCTCAGGGGAAGGAGACAGG - Intergenic
1084084098 11:66846881-66846903 TCCTCTGAGGGGAAGATGACTGG + Intergenic
1084939292 11:72603779-72603801 AGTTGTTAGGGGAAGGTGAAAGG + Intronic
1089358627 11:117872182-117872204 AGCTCTTCGGGAGAGGTGACAGG + Intronic
1095512586 12:42969297-42969319 ATCTCTTGGAGGCAGGTCACAGG + Intergenic
1098912420 12:76222628-76222650 CACTCTAAGGGAAAGGTGACTGG + Intergenic
1102161065 12:110769351-110769373 AGCTCTTAGGTGGATGTGACGGG + Intergenic
1106006859 13:25778743-25778765 ATCGCAGAGGGGCAGGTGACGGG - Intronic
1111838119 13:93414258-93414280 AGCTGTTAGGGGAGGGTGAATGG - Intronic
1112645680 13:101328949-101328971 AGCTCTTAGGGGACAGAGACAGG - Intronic
1114298499 14:21352372-21352394 ATGTCTTGGCAGAAGGTGACAGG + Exonic
1116672931 14:47866774-47866796 TTCTCTGAGGGGAAGGTGACGGG - Intergenic
1119323030 14:73742712-73742734 AGCTCTTCGGTGAGGGTGACAGG - Intronic
1124134469 15:27022046-27022068 ATCTACCAGGGGAAGGTGGCAGG - Intronic
1124585370 15:31000703-31000725 TTCTCTTGGGGGATGGTGAGGGG + Intergenic
1124835482 15:33192865-33192887 GTCTCTTAGGAGAAGGTGTGAGG - Intronic
1124934569 15:34158080-34158102 ACCTCTTAGGGGAAGGTATCTGG - Intronic
1126494129 15:49271491-49271513 ATCTCTCAGGGAAAGGTTTCAGG - Intronic
1126600538 15:50423534-50423556 CTCTCTTAGAGAAAGGTGATTGG - Intergenic
1127103648 15:55590622-55590644 AACTCTTAGTGGAAGGAGAATGG + Intergenic
1130255711 15:82325185-82325207 TTCCCTGAGGGGAAGGTGGCAGG + Intergenic
1130255931 15:82326067-82326089 TTCCCTGAGGGGAAGGTGGCAGG + Intergenic
1130599251 15:85264801-85264823 TTCCCTGAGGGGAAGGTGGCAGG - Intergenic
1131024889 15:89131976-89131998 ATCTCTCAGGGGCAGGAGTCAGG + Intronic
1131938035 15:97528813-97528835 CTCCTTTAGGGGAAGATGACGGG - Intergenic
1134141034 16:11719607-11719629 ATCTCCTGGGGGAAGGTAATAGG + Intronic
1135490806 16:22907781-22907803 ATCTCTTAGGTGATGGTTAAAGG + Intronic
1139484494 16:67248256-67248278 ATCTCTTTGATGAAGCTGACAGG - Intronic
1140213174 16:72986744-72986766 ACCTCTTAGGGGAAAGCCACTGG + Intronic
1141162452 16:81638453-81638475 CTCTCTGAGGGGATGGTGCCTGG + Intronic
1142120669 16:88385107-88385129 TTCTCCCAGGGGAAGGTGGCAGG - Intergenic
1147547178 17:41411032-41411054 ATCTCTTGAGTGAAGGTGAATGG - Intergenic
1147887732 17:43696055-43696077 CTCTCTTAGGGAAAGGGGAAGGG - Intergenic
1148133027 17:45273801-45273823 ATCTCTGAGGGCAAAGGGACAGG + Intronic
1148462423 17:47846347-47846369 ATCCCTGAGGGGAAGGCAACTGG + Exonic
1149383339 17:56116613-56116635 ATCTCATGGTGGAAGGTGAAGGG - Intronic
1149394891 17:56230339-56230361 ATCTTTTTGGGGAAGGAGAGAGG + Intronic
1149468472 17:56897771-56897793 AGCTTTCAGAGGAAGGTGACTGG + Intronic
1155222684 18:23699514-23699536 ATCTCCTTGAGGAAGGTGTCTGG + Intronic
1158549658 18:58424619-58424641 ATCGCTTTGGGGTAGGTGCCAGG + Intergenic
1159194510 18:65095463-65095485 ATCTCTTATGGGAAGATGAATGG - Intergenic
1161438274 19:4277062-4277084 AGGTCACAGGGGAAGGTGACTGG + Intergenic
1161439566 19:4282986-4283008 ACGGCTTGGGGGAAGGTGACAGG + Intronic
1164761410 19:30731170-30731192 ATCTCTGATGTGAGGGTGACTGG + Intergenic
1165171392 19:33894486-33894508 AACTCCTAGGGAAAGGTGTCTGG + Intergenic
926861651 2:17316567-17316589 ATCTCTTAGAGAAAGCTGTCAGG - Intergenic
928412340 2:31064779-31064801 ATCCAATAGGGGAAGGTGAAGGG + Intronic
930092667 2:47542525-47542547 AGCTCTGAGGGGAAGGTCTCTGG + Intronic
931835333 2:66093032-66093054 ATCTGCTAGGAGAAGGTAACTGG + Intergenic
935361802 2:102251540-102251562 CTGTCTTAAGGGAAGGTGCCTGG - Intergenic
935883464 2:107590547-107590569 ATCTCTTAGAGAAAAGTGAAAGG - Intergenic
937393538 2:121514391-121514413 ATCTCTTAGGGAAAGTTGGAGGG - Intronic
946330907 2:219008926-219008948 ATCTCTTAGGGCAGGCTGGCTGG + Intronic
946756682 2:222954159-222954181 ATCTCTTGGGGTAAGGTGGGAGG - Intergenic
948178686 2:235963073-235963095 GTCTCTTAGAGGAAGGTGGGTGG + Intronic
1170830321 20:19833944-19833966 AGCTCTCAGGAGAAGGGGACGGG - Intergenic
1173326928 20:42042390-42042412 ATGTCTGAGGGACAGGTGACTGG - Intergenic
1176077773 20:63256174-63256196 CTCTCTCAGGGGAAGCTGCCTGG + Intronic
949856982 3:8470852-8470874 TTCTCTCAGTGGAAGGTGGCTGG + Intergenic
954137740 3:48589774-48589796 ATCTGATAGGGGAAGATGATGGG + Intronic
959094356 3:101937053-101937075 ATCTCTAAGGGGAAGGAATCAGG + Intergenic
959505951 3:107156475-107156497 ATCTCTGAAGGAAAGGTAACAGG + Intergenic
960007457 3:112794680-112794702 ATCTCTTATGGGGTGGAGACTGG - Intronic
961754251 3:129118269-129118291 ATCTCTTTGGGGAAGGTGTTTGG + Intronic
962677860 3:137769725-137769747 ATCTCTCAAGAGAAGCTGACCGG - Intergenic
965966002 3:174490382-174490404 ATTTCCTAGGGGAAGGAGAAAGG + Intronic
966378551 3:179321975-179321997 ATCTCCTGGGGGATGGTGAAGGG + Intergenic
966995218 3:185273346-185273368 ATCATGTAGGGGAAGGTCACAGG - Intronic
972104615 4:35467227-35467249 ATCTCCTAGGTGAAGTTTACAGG + Intergenic
972557227 4:40193610-40193632 TTTTCTTAGGGGGAGGGGACAGG - Intronic
975947807 4:79728876-79728898 ATTGTTTAGGGGAAGGTGATGGG - Intergenic
976384074 4:84434907-84434929 ACCTTTCAGGGGAAAGTGACAGG - Intergenic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
983934635 4:173492839-173492861 ATCTCTTACAGCAAAGTGACTGG + Intergenic
984993636 4:185406448-185406470 ATTTTTTGGGGGAAGGTGCCCGG + Intronic
989554563 5:42778319-42778341 ATCTCTTGGGGGGTGGAGACAGG - Intronic
995838477 5:116421429-116421451 ATCACCTTGGGGAGGGTGACTGG + Intergenic
999885810 5:155921381-155921403 AGGTCTTAGGGGAAGGAGATGGG + Intronic
1000203797 5:159037907-159037929 ATCTCCTAGGGAAAGAGGACTGG + Intronic
1001191273 5:169634042-169634064 ATCCCGTGGTGGAAGGTGACAGG - Intergenic
1001417958 5:171561315-171561337 ATATTTTAGGAGAAGGTGATTGG - Intergenic
1001794252 5:174488963-174488985 AGCTCTTAGGGGAGGCTGGCTGG - Intergenic
1002190295 5:177474055-177474077 ACCTCTCAGGGAAAGGAGACGGG - Intronic
1002573539 5:180158260-180158282 ATCTCTTGGAGGATGGTGAAAGG - Intronic
1005256405 6:24007985-24008007 AAGTCTTATGGGAAGATGACTGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1011084466 6:83523789-83523811 ATCTGTTAGGAGAAAGAGACAGG + Exonic
1012677569 6:102136795-102136817 AAATCATAGGGGAAGGTGAAGGG + Intergenic
1013466994 6:110426549-110426571 ATCTCTGAGGAGGAGGTGAGAGG - Intronic
1015324936 6:131914275-131914297 ATCCCATAGAGGAAGGTGAAGGG + Intergenic
1021277443 7:18671027-18671049 AACTTTTAGGGGAAGGAGAAAGG + Intronic
1022369801 7:29759760-29759782 ATCACATAGAGGAAGGTGAGAGG - Intergenic
1022903768 7:34835870-34835892 ATCTCTCAGGGAATGGTGTCTGG - Intronic
1023088503 7:36596175-36596197 ATCTCTTAGGGGAAGGTGACGGG - Intronic
1030149451 7:106388273-106388295 TTCTCTTAGAGGAAGGTGGCTGG + Intergenic
1030648337 7:112089619-112089641 ATCTCCTAGTGGGAGATGACTGG + Intronic
1031530128 7:122866038-122866060 ATTTCTTCTGGGAATGTGACTGG + Intronic
1033610214 7:142957744-142957766 ATCCCTTAGAGGAAGGTTGCAGG - Intronic
1037252329 8:16911017-16911039 TTCTCTTAGAGGAAGCTGGCTGG - Intergenic
1038799528 8:30736928-30736950 ACCTCTTGGGGGAGGGAGACAGG - Intronic
1039715111 8:40099807-40099829 TACTCTTAGAGGAAGGTGATGGG - Intergenic
1040853181 8:51923205-51923227 AAGTCTTAGGGGAAGGGGAGGGG - Intergenic
1043296385 8:78668164-78668186 ATCTCTTAGGGGAGGGAGAGGGG - Intronic
1043766977 8:84148016-84148038 ATCACTTAGAGAAAGATGACAGG + Intergenic
1044755432 8:95456954-95456976 ATCACTTGAGGGGAGGTGACTGG + Intergenic
1046355526 8:113080050-113080072 CTCTCTTAGGGGAAGGACAGAGG + Intronic
1046770992 8:118116370-118116392 ATCTCTTAGTGGAGAGAGACAGG - Intergenic
1047444519 8:124907316-124907338 CTCCCTTAGGGGAAGGGGAACGG + Intergenic
1049547242 8:143238706-143238728 ATCTCTTAGAGGTGGGGGACTGG + Intergenic
1056501672 9:87215726-87215748 ATCTCTAAAGAGAAGGTGTCAGG + Intergenic
1056931278 9:90880186-90880208 GCCTCTTAGGGAAAGGTGAGTGG - Intronic
1056943428 9:90974577-90974599 CTCTCTTAGGTGAAGGTGAGAGG + Intergenic
1058048202 9:100379964-100379986 ATCCCTGAGCGGAAGGGGACTGG + Intergenic
1058146700 9:101420101-101420123 ATCTTACAGGGCAAGGTGACAGG - Intergenic
1059983116 9:119794953-119794975 ATCTCTCTGGGGAAGGTGAAAGG + Intergenic
1060203682 9:121668743-121668765 TTCTCTTTGGAGAAGGGGACGGG - Intronic
1060702318 9:125767206-125767228 TTCTCTTAGTTGCAGGTGACCGG + Intronic
1062122493 9:134841279-134841301 TTGTCTTGGGGGAAGTTGACGGG + Intronic
1188714519 X:33444839-33444861 AACTCTCAGGGGAAGATGTCTGG + Intergenic
1190427223 X:50345118-50345140 ATCACTGAAGGGCAGGTGACAGG - Intronic
1196076884 X:111587393-111587415 ATCTCATGGCGGAAGGTGAAAGG - Intergenic
1196315767 X:114221284-114221306 ATCTCTTGGGGGTAGGTGAGTGG + Intergenic
1197485120 X:127039413-127039435 ATTTCTTATGGGAATCTGACAGG + Intergenic
1197506034 X:127306260-127306282 ATCTCTGAAGGAAAGGTAACAGG + Intergenic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1198775671 X:140176608-140176630 ATCCCTTAGTCCAAGGTGACAGG + Intergenic