ID: 1023095288

View in Genome Browser
Species Human (GRCh38)
Location 7:36654112-36654134
Sequence GTGTGTACGCACACACGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 7, 3: 43, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023095288_1023095289 29 Left 1023095288 7:36654112-36654134 CCTGTGCGTGTGTGCGTACACAC 0: 1
1: 0
2: 7
3: 43
4: 240
Right 1023095289 7:36654164-36654186 CTGTTTCATGTGCAAATGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023095288 Original CRISPR GTGTGTACGCACACACGCAC AGG (reversed) Intronic