ID: 1023095358

View in Genome Browser
Species Human (GRCh38)
Location 7:36654726-36654748
Sequence CCAGCTAATTCCTCATAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023095358_1023095361 -9 Left 1023095358 7:36654726-36654748 CCTGCTTATGAGGAATTAGCTGG 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1023095361 7:36654740-36654762 ATTAGCTGGCCCAGGAGCAGTGG 0: 1
1: 0
2: 7
3: 57
4: 458
1023095358_1023095365 18 Left 1023095358 7:36654726-36654748 CCTGCTTATGAGGAATTAGCTGG 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1023095365 7:36654767-36654789 ATTCAATGTGACAACACCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023095358 Original CRISPR CCAGCTAATTCCTCATAAGC AGG (reversed) Intronic
901610489 1:10494194-10494216 CCAGCTACTACCACATTAGCTGG - Intronic
904900803 1:33855618-33855640 CCAGCTAAAGCCTCAGCAGCTGG - Intronic
910099880 1:83564425-83564447 TCAGCTAATTCCACCCAAGCAGG + Intergenic
912936816 1:114010879-114010901 CCAGCACTTTCCCCATAAGCTGG + Intergenic
919811175 1:201409737-201409759 CCAGCTATTTCCTCAGATGGTGG + Intronic
921178236 1:212611293-212611315 CCAGTTAATTCCTCACTAACAGG + Intronic
924014661 1:239708020-239708042 CCATTTAACTCCTCATAGGCAGG + Intronic
924710096 1:246524196-246524218 CCAGCCAATTCATCAGAATCAGG - Intergenic
1063322260 10:5061263-5061285 CCAGCTCCTTCTTCAGAAGCTGG - Intronic
1071982598 10:91018849-91018871 CCCACTAATTCCACAAAAGCAGG + Intergenic
1075476411 10:122738596-122738618 TCAGCTCATTCCTCGTAATCAGG + Intergenic
1080481965 11:32660989-32661011 GCAGGGAATTCCACATAAGCGGG + Intronic
1080789546 11:35509800-35509822 CCAGCTCTTTCCTCCTAAGTAGG - Intronic
1081919544 11:46760319-46760341 CCTGCTAATTTCTCATTAGCAGG - Intronic
1082933074 11:58629523-58629545 CCAGATCATTCCTGGTAAGCAGG - Intergenic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1091183617 11:133628602-133628624 CCAGCAATTTCCTCTTAAACAGG + Intergenic
1092066784 12:5597008-5597030 CCAGCTAGTTGGTCAAAAGCTGG + Intronic
1092842936 12:12561221-12561243 CCAGCTTATTCATCACAGGCTGG + Intronic
1093678465 12:21971761-21971783 ACAGCTCATTACTCTTAAGCTGG - Intergenic
1103684500 12:122721112-122721134 TCATCTAATTCCTCATGAGCGGG - Intergenic
1104946760 12:132418119-132418141 CCAGCTACTTCCCCAGCAGCTGG + Intergenic
1109726390 13:66346798-66346820 CGAGCTAATTCCTCATTTGAAGG - Intronic
1111371437 13:87323069-87323091 GCGGCAAATTCCTCAGAAGCTGG + Intergenic
1113512632 13:110868141-110868163 CCAACTAGCTCCTCATGAGCTGG - Intergenic
1119286602 14:73459605-73459627 CCAGCAACTTTCTAATAAGCGGG + Intronic
1122385311 14:101341147-101341169 CAAGCCAATTCCTCATAATAAGG + Intergenic
1128468256 15:67930555-67930577 CCAGCTTGTTCCCCATCAGCAGG - Intergenic
1130287343 15:82566923-82566945 CCAGCTAAATCAACACAAGCAGG + Intronic
1131926015 15:97384815-97384837 CAGGCTTATTCCTCAAAAGCTGG - Intergenic
1134347149 16:13401627-13401649 CTAGCTAAGTCCTCATACGGGGG - Intergenic
1135750126 16:25051513-25051535 CCAGCTTGATCCTTATAAGCTGG + Intergenic
1140762160 16:78119456-78119478 CCAACTAATCCCTCATTAGAAGG - Intronic
1143203640 17:5128901-5128923 CCAGCTGATTCATCAGAATCAGG + Intronic
1144177716 17:12723140-12723162 CCAGTTAATTCTCCATAACCAGG + Intronic
1145759460 17:27418074-27418096 CCAGCTGATTCATCAGAATCAGG + Intergenic
1145960355 17:28883516-28883538 CCAGCTAATTCCTCCCTTGCAGG + Intronic
1146159432 17:30552040-30552062 CCAGCTGATTCTTCAGAATCAGG + Intergenic
1146490018 17:33274291-33274313 CCAGCTGCTTTCTCATTAGCTGG + Intronic
1146844942 17:36176479-36176501 CCAGCTGATTCATCAGAATCAGG - Exonic
1146857249 17:36264414-36264436 CCAGCTGATTCATCAGAATCAGG - Exonic
1146863366 17:36323961-36323983 CCAGCTGATTCATCAGAATCAGG + Exonic
1146873161 17:36388324-36388346 CCAGCTGATTCATCAGAATCAGG - Exonic
1146880518 17:36439410-36439432 CCAGCTGATTCATCAGAATCAGG - Exonic
1147066226 17:37924549-37924571 CCAGCTGATTCATCAGAATCAGG + Exonic
1147076044 17:37988949-37988971 CCAGCTGATTCATCAGAATCAGG - Intronic
1147077759 17:38004110-38004132 CCAGCTGATTCATCAGAATCAGG + Intronic
1147087569 17:38068495-38068517 CCAGCTGATTCATCAGAATCAGG - Exonic
1147093696 17:38128045-38128067 CCAGCTGATTCATCAGAATCAGG + Intergenic
1147103511 17:38192444-38192466 CCAGCTGATTCATCAGAATCAGG - Intergenic
1149524888 17:57347743-57347765 CCAGCCAATTCCACGGAAGCAGG - Intronic
1150086441 17:62275544-62275566 CCAGCTGATTCATCAGAATCAGG - Intronic
1153477583 18:5513720-5513742 CTTACTAAATCCTCATAAGCTGG - Intronic
1154473617 18:14729296-14729318 CCAGAAAATTCCTAATAAGGCGG + Intronic
1155906664 18:31460298-31460320 GCAGCTAATTCCTCATGTGATGG + Intronic
932138011 2:69247569-69247591 TCATGTAGTTCCTCATAAGCAGG + Exonic
933893602 2:86791341-86791363 CTAGCGAGTTCCTCAGAAGCGGG - Intronic
935213757 2:100959803-100959825 GCAACTAATTTATCATAAGCAGG + Intronic
937148627 2:119670197-119670219 CCAGGAGATTCATCATAAGCTGG - Intergenic
942273760 2:174302955-174302977 CCAGCTAATTTTGCATTAGCTGG + Intergenic
943163057 2:184280208-184280230 CTTGCAGATTCCTCATAAGCTGG + Intergenic
947183471 2:227433178-227433200 CCATCTGAGTCCTCATTAGCCGG + Intergenic
1170580146 20:17692940-17692962 CAAGCTATTTCCACATAAGCTGG + Intergenic
1174734491 20:52952688-52952710 GCAGCTAATTCTTCATATGGCGG + Intergenic
1177031230 21:15983708-15983730 CCAGCAATTTCCTCTTAAGAAGG - Intergenic
1178884076 21:36471465-36471487 CCAGCCAATTGCACACAAGCTGG - Intronic
950861590 3:16152115-16152137 TCAGCTAATTTCTCACAAGAGGG + Intergenic
964068541 3:152604558-152604580 CCAGCTGATCCATCATGAGCAGG + Intergenic
967537835 3:190627132-190627154 CTAGAGAATTACTCATAAGCAGG + Intronic
983883820 4:172960307-172960329 CCAGCAATTTCCTCTTAAACAGG - Intronic
985654735 5:1124342-1124364 GCAGCTACTTCCTCATGACCAGG - Intergenic
985783219 5:1881556-1881578 CCTACTAAATCCTCATCAGCTGG - Intronic
986582251 5:9278135-9278157 CCAGCTGAGACCTCATCAGCTGG - Intronic
990352870 5:54936448-54936470 CCAGCTCATGCCTAACAAGCAGG + Intergenic
993820173 5:92604506-92604528 TCAGATTATCCCTCATAAGCAGG + Intergenic
1001117280 5:168950212-168950234 CCAGCTACTTCCTCACATGGAGG - Intronic
1001549103 5:172589183-172589205 CCAGGTAATTCTTCATTAGAGGG - Intergenic
1003650339 6:7953645-7953667 CCAGCTAAATCTACAGAAGCTGG + Intronic
1013561133 6:111306219-111306241 TCAGCTGATTCCTCAGAAGATGG + Intronic
1014023269 6:116615861-116615883 CCAGGAGATTCCTTATAAGCAGG + Intergenic
1016011240 6:139139439-139139461 ACAGCTAATACTTCGTAAGCTGG - Intronic
1018291269 6:162294186-162294208 CCAGCTGATTCCTCAGCACCGGG - Intronic
1018408642 6:163517128-163517150 CAAGCCAATTCCTCATAATAAGG - Intronic
1018521529 6:164656047-164656069 CCAGCAATTTCCTCTTAAACAGG - Intergenic
1023095358 7:36654726-36654748 CCAGCTAATTCCTCATAAGCAGG - Intronic
1024812295 7:53226336-53226358 TCAGCCAATTGGTCATAAGCAGG + Intergenic
1026962086 7:74415357-74415379 CCAGCTGAAGCCTCATAGGCGGG - Intergenic
1032162553 7:129521938-129521960 CCAGCTCCTTCCTCATAGCCTGG + Intergenic
1034343401 7:150371811-150371833 CCAGCTAGTTGCCCACAAGCGGG + Exonic
1035460145 7:159033547-159033569 CCAGCTAATTCATGATGATCCGG - Intronic
1035610699 8:962187-962209 CCAACTAATTCCTCAGAATTTGG - Intergenic
1036499279 8:9298342-9298364 CCAGGTAATTCCTCAGAAGATGG + Intergenic
1045242527 8:100415119-100415141 CCAGCTAATTACTCACAAGCTGG - Intergenic
1048818611 8:138358299-138358321 CCAGCTAATTCCTCAGGAAGGGG - Intronic
1050491640 9:6194861-6194883 TCAGCTAATTCCACAGAAGCTGG - Intergenic
1051859074 9:21603887-21603909 GCAGCAAATTCCTGAAAAGCAGG - Intergenic
1059749470 9:117234379-117234401 CCAGCTAATCCCTCCTGAACCGG + Intronic
1186224625 X:7385041-7385063 CCAACTATTTCCCCATTAGCAGG - Intergenic
1188284864 X:28315244-28315266 CCAGCTAATTCCAGCTGAGCAGG - Intergenic
1188460226 X:30417030-30417052 CCATCTATGTCCTCATATGCAGG - Intergenic
1189771345 X:44430782-44430804 GCAGCCAATTCCACATAAGGAGG + Intergenic
1192849020 X:74934159-74934181 GGAGCTAATTTCTCAGAAGCTGG - Intergenic
1193791023 X:85815146-85815168 CCAGCTAATCCATCAAAGGCAGG + Intergenic
1198727634 X:139693165-139693187 CCAGCTACTGCTTCACAAGCAGG - Intronic