ID: 1023098875

View in Genome Browser
Species Human (GRCh38)
Location 7:36692193-36692215
Sequence CATGGTGCCTGGCATGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023098872_1023098875 -7 Left 1023098872 7:36692177-36692199 CCACACATAAAATGCACATGGTG 0: 1
1: 0
2: 3
3: 25
4: 373
Right 1023098875 7:36692193-36692215 CATGGTGCCTGGCATGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023098875 Original CRISPR CATGGTGCCTGGCATGGAGC AGG Intronic
No off target data available for this crispr