ID: 1023100314

View in Genome Browser
Species Human (GRCh38)
Location 7:36711381-36711403
Sequence ATGCTGTGCTTCAGGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023100314_1023100316 -10 Left 1023100314 7:36711381-36711403 CCTTTGTTCCTGAAGCACAGCAT 0: 1
1: 0
2: 2
3: 25
4: 238
Right 1023100316 7:36711394-36711416 AGCACAGCATGCTGTCATCATGG 0: 1
1: 0
2: 1
3: 18
4: 191
1023100314_1023100317 0 Left 1023100314 7:36711381-36711403 CCTTTGTTCCTGAAGCACAGCAT 0: 1
1: 0
2: 2
3: 25
4: 238
Right 1023100317 7:36711404-36711426 GCTGTCATCATGGATTCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023100314 Original CRISPR ATGCTGTGCTTCAGGAACAA AGG (reversed) Intronic
902766953 1:18623243-18623265 ATGCTGAGTTTCAGAAACCAGGG - Intergenic
904553539 1:31342017-31342039 ATGCTATACATCAGGCACAATGG - Intronic
905115043 1:35631416-35631438 ATGGTGGGCTTTAGGAACAGGGG - Intronic
906792321 1:48669790-48669812 ATGCTGGGCATCAGGCAGAATGG - Intronic
907749437 1:57247894-57247916 AGGCAGTCATTCAGGAACAAAGG - Intronic
909709765 1:78634485-78634507 AAGCTGTGCTTCAGAAATAAAGG + Intronic
909889435 1:80985288-80985310 GTGCTGTGCTTGGGAAACAAAGG - Intergenic
910535749 1:88295652-88295674 ATGATCTGCTTCAGGAAAGAAGG - Intergenic
910743265 1:90545247-90545269 ATGAAGTGCTACAGGAACACAGG - Intergenic
911572432 1:99534110-99534132 ATGCTGCTGTTAAGGAACAAAGG - Intergenic
912873836 1:113335457-113335479 ATGCTGTTTTTTACGAACAATGG + Intergenic
913460129 1:119076597-119076619 TTGCTGTCTTTCTGGAACAAAGG + Exonic
914345278 1:146793792-146793814 CTGCTGTTCTGCAGGATCAAGGG - Intergenic
915016778 1:152741646-152741668 GAGCTGTGCGTCAGGAACTAGGG + Intronic
915281023 1:154822177-154822199 ATGGAGTCCTGCAGGAACAATGG + Exonic
916897602 1:169181824-169181846 ATGGAGGGCTTCAGGAATAATGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918533369 1:185547879-185547901 ATGCTGTCCATCAGAAACTATGG + Intergenic
919120365 1:193332837-193332859 AAGCTGTCCTTCAGGAATGAAGG - Intergenic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
921582799 1:216914704-216914726 ATGTTGAGCATCAGGAACACTGG - Intronic
922022678 1:221720123-221720145 AAGCTATGCTACAGGAACCAGGG - Intronic
922989325 1:229892949-229892971 ATGGTGCCCTTCAAGAACAAAGG - Intergenic
923103669 1:230837684-230837706 TTGCTGTGCTTTTGGAAGAAGGG - Exonic
923351579 1:233112480-233112502 AAGGTGTGCTTAAGGCACAAAGG - Intronic
923624857 1:235605787-235605809 CTCCTGGGCTTCAGGAATAAGGG - Intronic
1063185951 10:3651787-3651809 AAGCTCTGCTTCAGGGAGAAGGG + Intergenic
1064468138 10:15606125-15606147 ATGCAGTGTTTCAGGAAACATGG + Intronic
1067677917 10:48401929-48401951 ATTGTTTGCTTCAGGATCAATGG + Intronic
1067797227 10:49329400-49329422 ATTCTGTGCTTCAGGAAGACAGG - Intergenic
1068250999 10:54440187-54440209 ATGCTGTGCTTAATGAACGGAGG + Intronic
1071492084 10:86143126-86143148 CTGCTGTCCCTCAGGAACACTGG - Intronic
1071902589 10:90136977-90136999 GTGCTGGGATCCAGGAACAAGGG + Intergenic
1071908035 10:90196775-90196797 AGCCTGTGCTTGGGGAACAAGGG + Intergenic
1072469405 10:95698322-95698344 ATGCTGATATTCAGGAGCAAAGG + Intergenic
1073582755 10:104682834-104682856 ATGGTTTGCTTCAGGAGCCAGGG - Intronic
1073821649 10:107271253-107271275 TTGCTGAGCTTCAGGTAAAATGG + Intergenic
1075813800 10:125248635-125248657 AGACTGTGTTTCAGGCACAATGG - Intergenic
1077165538 11:1134057-1134079 ATGCTGTGCCCCAGGAACAAGGG + Intergenic
1085012517 11:73151117-73151139 ATGCTGTGTCTTTGGAACAAAGG - Intergenic
1087521280 11:99240024-99240046 TTGATGTGCATCTGGAACAAGGG - Intronic
1088674137 11:112175296-112175318 ATGCTGTGCATCAGGATAAACGG + Intronic
1089601694 11:119619726-119619748 TTGCTGTGCATGAGGCACAAGGG - Intergenic
1089603802 11:119630117-119630139 ATGCTGTGGTCCAGAAGCAAGGG + Intronic
1089887379 11:121840822-121840844 ATGCTGTGATTCAGTAGCAGAGG + Intergenic
1090287447 11:125512157-125512179 ACAGTGTGCTTCAGGAACCACGG + Intergenic
1090981347 11:131725155-131725177 ATGCAGTACTTCACCAACAAGGG + Intronic
1091946491 12:4549563-4549585 CTCCTGTCCTTCTGGAACAACGG + Intronic
1092551177 12:9501640-9501662 ATTTTGTGCTTTAGGAAGAAGGG - Intergenic
1092996281 12:13953849-13953871 ATGCTGGGAATCAGGGACAAAGG - Intronic
1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG + Intronic
1094176333 12:27545630-27545652 TTTCTATGCTTCAGGAACACAGG - Intronic
1094207093 12:27851927-27851949 ATCTTGAGCTCCAGGAACAAAGG + Intergenic
1094520630 12:31184716-31184738 ATTTTGTGCTTTAGGAAGAAGGG + Intergenic
1095637035 12:44447049-44447071 AGGCTATGCTTCAGGAGTAAGGG + Intergenic
1098921298 12:76304571-76304593 ATGCTGTTCTTCTGGAAGAAAGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1099423191 12:82489736-82489758 AAGCTGTCCTTCAGGAATGAAGG + Intergenic
1099646700 12:85366722-85366744 ATCCTGTGCTTCGGGGAAAAAGG - Intergenic
1099938057 12:89151671-89151693 TTGCTGTGCGTCAGGAAACAGGG - Intergenic
1100717037 12:97316840-97316862 ATGACCTGCTTCAGGAAGAAGGG - Intergenic
1101523726 12:105508172-105508194 GTGGTGAGCTTCAGGAAAAACGG - Intergenic
1101613794 12:106316419-106316441 TTGCTGTGCTTCAGCCACACTGG + Intronic
1103835412 12:123816147-123816169 AGGCTGTGCGCCAGGAACCAGGG - Intronic
1106845672 13:33735653-33735675 ATGACCTGCTTCAGGAAGAAGGG - Intergenic
1107372508 13:39768005-39768027 ATGCTGTCCATTAGGAACCAGGG + Intronic
1108123308 13:47213137-47213159 ATGATGTGCTTCAGTATTAAAGG - Intergenic
1108945417 13:56017452-56017474 AAGCTGTCCTTCAGAAACAAAGG - Intergenic
1109254695 13:60064923-60064945 TTGCTGTGCTTCAGGGAATAGGG + Intronic
1110634594 13:77751794-77751816 ATGCTGTGCTCTAGGAAGAGTGG + Intronic
1112552026 13:100430345-100430367 ATGGTGTTCTTCAGGGACACTGG - Intronic
1113045199 13:106147710-106147732 GGGCAATGCTTCAGGAACAAAGG + Intergenic
1113441725 13:110334288-110334310 CTGCTGTGCTTGATAAACAAAGG - Intronic
1114287168 14:21256014-21256036 ATACTGTGCTTCAGCCACACTGG - Intronic
1114354831 14:21896094-21896116 ATCCAGATCTTCAGGAACAAAGG - Intergenic
1114836294 14:26206429-26206451 ATGCTATGATTCAAGACCAAAGG - Intergenic
1115382301 14:32754734-32754756 ATGATGTCCTTCAGAAATAAAGG - Intronic
1115860778 14:37683887-37683909 ATGCTGTGGTTCAAGGAAAAGGG - Intronic
1117457389 14:55912053-55912075 ATGCTGTTCTTCTGGACCACAGG + Intergenic
1118520214 14:66575167-66575189 AAGCTGTCCTTCAGGAATAAAGG - Intronic
1118616422 14:67577325-67577347 ATGCTGTGCTACAGCAAAGACGG + Exonic
1121776664 14:96595458-96595480 ATGCTGTACATCAGTAACAAAGG + Intergenic
1122478485 14:102029140-102029162 TTGCTGTGCTTCAGAAATCAAGG + Intronic
1127461551 15:59203773-59203795 ATGCTATGCTTCAGACACCAGGG - Intronic
1128485830 15:68086914-68086936 AAGCTGTCTTTCAGGAAAAAAGG + Intronic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1130195796 15:81779226-81779248 ATGATGTGGGTCAGGAACAAAGG - Intergenic
1130398796 15:83529925-83529947 CTGCTGTGCTGCTGAAACAAGGG - Intronic
1131321578 15:91398703-91398725 AAGCTGGCCTTCAGAAACAAAGG - Intergenic
1131346384 15:91652899-91652921 CTGCTGTGCTTCAGAAAGAGAGG + Intergenic
1132877307 16:2145761-2145783 ACGCTGTGCTACAGGAATATTGG - Intronic
1132929645 16:2452271-2452293 ATGCTGTGCTCCAGCCACAGGGG + Intronic
1135473317 16:22751519-22751541 ATCCTCTGCTGCAGGAACACAGG + Intergenic
1135473325 16:22751603-22751625 AGACTCTGCTTGAGGAACAAAGG - Intergenic
1135878463 16:26228106-26228128 ATGCTTGGATTGAGGAACAAGGG + Intergenic
1135885246 16:26300253-26300275 AAGCTCTGCATCAGGAACCAAGG - Intergenic
1135964045 16:27021321-27021343 CTGCTGTGCTCCAGGCACACTGG + Intergenic
1137968796 16:52962894-52962916 ATCATGTGCTTCAGGAAAAAGGG - Intergenic
1139988714 16:70921500-70921522 CTGCTGTTCTGCAGGATCAAGGG + Intronic
1140158341 16:72457465-72457487 AAGCTGTCCTTCAGAAATAAGGG - Intergenic
1141099132 16:81184322-81184344 ATGCTGTGCTTCTCCAACCAAGG + Intergenic
1141111440 16:81274019-81274041 CTGCGGTGCTTCTGGAGCAAGGG - Intronic
1142251788 16:88995302-88995324 ATGCTGTGCGGCAGGAACGTGGG - Intergenic
1144350618 17:14392028-14392050 AAGCTGTACTTCATAAACAAGGG + Intergenic
1144380517 17:14692663-14692685 AAGCTGTTCTTCAGAAATAAAGG - Intergenic
1147659093 17:42107767-42107789 TGGCTGGGCTTCAGGAGCAACGG - Exonic
1149047416 17:52264019-52264041 TTTGTGTGCTTCAGGAACTAAGG + Intergenic
1149495068 17:57112329-57112351 AAGCTCTGCTTTAGGAAGAAAGG - Intronic
1151209586 17:72534363-72534385 AGGCTGTGCTTCAGGAAATTAGG - Intergenic
1151544124 17:74781864-74781886 TTGCTGTGCTTCAGCCACACAGG + Intronic
1152647492 17:81476228-81476250 CTGCTGTGCTCCAGGAAGATGGG + Intergenic
1153235133 18:2978949-2978971 AAGCTGTGCCTCAGGACCACAGG + Intronic
1154163708 18:11998472-11998494 AAACTGTGTTTCAGGAACCATGG - Intronic
1155136196 18:22995145-22995167 TGACTGTGCTTCAGGAAAAAGGG - Intronic
1155332909 18:24736241-24736263 ATGCTGAGCTTCAGCAAGAATGG - Intergenic
1155515189 18:26617407-26617429 ATGCCGTGTTTGAGGAGCAAAGG + Intronic
1156545129 18:37956736-37956758 CAGCAGTGGTTCAGGAACAAGGG - Intergenic
1158348240 18:56537650-56537672 ATGCTGGGCTTAAGAAAAAAGGG + Intergenic
1158569909 18:58589405-58589427 ATTTTGTGCTTTGGGAACAAGGG + Intronic
1159039120 18:63306546-63306568 AGGCAGAACTTCAGGAACAAAGG - Intronic
1159616506 18:70586136-70586158 AAGCTGTCCTTCAGAAAGAAAGG + Intergenic
1160484075 18:79272307-79272329 ATGCTGTGCCGCTGGAACAAAGG - Intronic
1160960027 19:1716675-1716697 ATGCTGTGCTCTGGGGACAAAGG - Intergenic
1161930586 19:7336916-7336938 ATGCTGTCATTCAGGAAGACAGG - Intergenic
1162180557 19:8865944-8865966 ATGCTGCTCTTCTGGAACAAGGG + Exonic
1164109836 19:22145799-22145821 GTGTTGTGATTCAGGAAAAAAGG + Intergenic
1165495803 19:36151509-36151531 ATGCCGCCCTTCAGGTACAACGG + Exonic
930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG + Intergenic
930765768 2:55083915-55083937 AAGCTCTGTTTCAGGAACCAGGG - Intronic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
931184941 2:59940669-59940691 GTGCTGTGCTTCAGCATCACTGG - Intergenic
931450658 2:62365141-62365163 ATGCGGTGCTTCAGGACCAGTGG + Intergenic
932246704 2:70202522-70202544 ATGCTCCGCTTCTGGGACAAAGG + Intronic
932958892 2:76388939-76388961 ATACTGTGCTTCAAGTACCAAGG + Intergenic
933082237 2:78005239-78005261 AAGCTGTGTTTCAGAAATAAGGG - Intergenic
933281942 2:80341396-80341418 AAGCTGTGTGACAGGAACAAAGG + Intronic
933537783 2:83598277-83598299 ATCCTCTCCTTCAGAAACAAAGG + Intergenic
934163544 2:89274147-89274169 ATGCTGGGCTCCCTGAACAATGG + Intergenic
934203729 2:89908377-89908399 ATGCTGGGCTCCCTGAACAATGG - Intergenic
934515186 2:94981882-94981904 ATGCTGTACTCCAGGGACACAGG + Intergenic
940091087 2:149918122-149918144 AAGCTGTCCTTCAGAAATAAAGG + Intergenic
941443736 2:165573853-165573875 AAGCTGTGTTTCAAAAACAAGGG + Intronic
943341431 2:186686598-186686620 TTGCTATGCTTCAGGAAAATGGG - Intergenic
944627643 2:201588634-201588656 CTGATGTGCTTCAAAAACAATGG + Intronic
945515947 2:210763292-210763314 ATGCTTAGATGCAGGAACAAAGG - Intergenic
947133489 2:226953983-226954005 ATCCTGTGCTTCAGAAGCCATGG - Intronic
948472628 2:238194323-238194345 CTGCTGTGTTTCAGGATCAGGGG - Exonic
1169819642 20:9695554-9695576 ATGCTCTCCTTCAGAAGCAAGGG - Intronic
1170616665 20:17958440-17958462 ATACAGTGCTTAAGGAAAAAGGG - Intronic
1170647022 20:18206821-18206843 AGGCTGTGCAACTGGAACAAAGG - Intergenic
1172811435 20:37650969-37650991 ATGCTGTGCTCCAGAAAAAATGG + Intergenic
1174278351 20:49419955-49419977 CTGTTGTGCTCCAGGAACAGAGG - Intronic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1177268161 21:18810516-18810538 ATGCTCAGATTTAGGAACAAAGG - Intergenic
1177563602 21:22788902-22788924 TTTCTGTACTTCAGGAGCAAGGG + Intergenic
1178516941 21:33255950-33255972 AAGCTCTGCTCCAGGAACTAGGG + Intronic
1182392683 22:30012445-30012467 ATGCTGTGGATCAGGATCAGCGG + Exonic
1183570625 22:38650676-38650698 ATGCTGTGATTCTAGAATAAGGG + Intronic
1185151879 22:49168440-49168462 ATGCTGTGGTTCAGAGACATGGG - Intergenic
951267024 3:20579300-20579322 ATTCTGTTCTTCAGAAATAAAGG + Intergenic
952532548 3:34277158-34277180 ATGCAGTCATTCAGGAACACAGG + Intergenic
952965284 3:38617282-38617304 ATGCAATGGTTCAGTAACAAGGG - Intronic
954803976 3:53204618-53204640 ATGCTGGACATCAGGAACAAAGG + Intergenic
954847295 3:53571040-53571062 AGGATGTGATTCAGGAATAATGG - Intronic
954944044 3:54401651-54401673 AAGGTGTCCTTCAGGAATAAAGG + Intronic
955055507 3:55451798-55451820 AGGCTGTACTTCAGGTACTAAGG + Intergenic
956725089 3:72150429-72150451 ATGGTGTGCATCTGGAACTATGG - Intergenic
958014603 3:87924610-87924632 ATGCTATCCTTCAGAAACTAAGG - Intergenic
959762474 3:109982856-109982878 ATGCTGTGCTATAGAAAAAAGGG - Intergenic
960979653 3:123211059-123211081 AAGCTGTGCTGCAGGTTCAAGGG + Intronic
962267079 3:133951534-133951556 ATGCTGTGCTTCATGTGCAGTGG - Intronic
962422789 3:135242659-135242681 TTGATGTGCTTCAGGAGCAGAGG - Intronic
963181001 3:142355952-142355974 ATGCTGAGCTTTAGAAAAAAAGG - Intronic
964136962 3:153354797-153354819 ATGTTGTGGTTCAAGAAGAAAGG + Intergenic
964211279 3:154231112-154231134 TTCATGTGTTTCAGGAACAAAGG - Intronic
964473991 3:157082473-157082495 GTGCTGTGCTGCAGGAGCAAAGG + Intergenic
964660898 3:159119187-159119209 ATGCTGAGCTTCTGGAACCAGGG - Intronic
964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG + Intronic
965448742 3:168809897-168809919 ATCTTGTTCTTCAGGAGCAATGG + Intergenic
966080303 3:175992074-175992096 ATGATCTGCTTCAGGGAAAAAGG + Intergenic
966629969 3:182061645-182061667 AGGCTTTGCTTCAGCAAGAAAGG + Intergenic
968130986 3:196192682-196192704 AAGCTGTGGTTCAGGAAAAGTGG + Intergenic
969154665 4:5200008-5200030 ATGAGGTGCTGTAGGAACAAAGG + Intronic
970918255 4:21361878-21361900 ATACTGTCCTTCAGGAGTAAAGG + Intronic
971415512 4:26424343-26424365 ATGCATTGCCTCAGGAACAAAGG + Exonic
972189908 4:36577402-36577424 AATCTGTTCTTCAGGAATAAGGG + Intergenic
974501202 4:62705995-62706017 AAGCTCTGTCTCAGGAACAAGGG - Intergenic
975667113 4:76742926-76742948 ATGCTGTGTTACAGCATCAAAGG + Intronic
977524569 4:98128182-98128204 ATGCTGAGATTCAGGGACACAGG - Intronic
977953808 4:103003724-103003746 CTGCTGTGCTGCAGGAGCCAAGG - Intronic
979626153 4:122847769-122847791 ATGTTGTGGTTCAAGACCAAAGG + Intronic
980806396 4:137820191-137820213 ATGCCATGTTTCAGGAAGAATGG - Intergenic
982314031 4:154012976-154012998 ATGCTGTGGTTCAAGTCCAAAGG - Intergenic
982791123 4:159592643-159592665 ATGATCTGCTTCAGGGAAAAAGG + Intergenic
984421949 4:179534796-179534818 ATGCTTTGCTTCAGGACTTATGG + Intergenic
986064095 5:4219127-4219149 ATTCTGTGGTTTATGAACAATGG + Intergenic
986416010 5:7528968-7528990 ATTCTGTGCTGCAAGAACATAGG - Intronic
986417191 5:7540990-7541012 ATGCTGTGCTTCCCATACAATGG + Intronic
994752863 5:103760580-103760602 GGGCTGTGCCTCAGGAATAATGG - Intergenic
994994239 5:107039239-107039261 ATGACGTGCTTCAGGAAAGAAGG + Intergenic
996225074 5:120982748-120982770 AAGCAGGACTTCAGGAACAAAGG - Intergenic
996696356 5:126400690-126400712 AAGCTGTCCTTCAGAAATAAAGG - Intronic
997970630 5:138398622-138398644 CTGCTGTGCTACAAAAACAAAGG - Intronic
998253063 5:140565440-140565462 ATGCTGAGCTTCTAGACCAATGG - Exonic
999888038 5:155945700-155945722 CTTCTGGGCTTCAGGAACACTGG - Intronic
1001218818 5:169881518-169881540 ATGCTGTGCTATAGGGACTAAGG - Intronic
1003024053 6:2537711-2537733 ATGACGTGCTTCACGAAGAAGGG + Intergenic
1003050924 6:2780747-2780769 CTGCTGCACTTCAGAAACAATGG - Intronic
1003157534 6:3609007-3609029 ATGGTGAGCATCAGGAACTAAGG - Intergenic
1003556977 6:7148656-7148678 ATGCTATGCTTAAGGAAACAGGG + Intronic
1004073605 6:12325085-12325107 ATGCTTAGCTTCTGAAACAAAGG - Intergenic
1005345114 6:24881707-24881729 ATGCTGTGATACAGGTACACTGG + Intronic
1005410309 6:25538618-25538640 AAGCTCTGGTTCAGGAACCAGGG - Intronic
1006203054 6:32314016-32314038 CAGCTTTGCCTCAGGAACAAAGG - Intronic
1006203710 6:32320503-32320525 CAGCTTTGCCTCAGGAACAAAGG - Intronic
1008095402 6:47334770-47334792 ATGCTCTGTGTCAGGAACTAGGG - Intergenic
1008846144 6:55966509-55966531 ATGTTGAGCATCAGGAAGAAAGG - Intergenic
1011320592 6:86088111-86088133 TTGCTGTGCTGCAGGGACCAAGG + Intergenic
1011671589 6:89688654-89688676 CTGCCGTGCTTCTGGAACATTGG + Exonic
1012168989 6:95994843-95994865 ATTCTGTCCTTCATGAAAAATGG - Intergenic
1014208440 6:118682466-118682488 ATGCTGCGATTCAGAAACACAGG + Intronic
1015381340 6:132573191-132573213 AGGCTGTGTTTAAGGAACACAGG + Intergenic
1017375854 6:153767171-153767193 TTGCTGTTTTCCAGGAACAAAGG - Intergenic
1017998709 6:159558632-159558654 AGGATGTACTTCAGGAAAAAGGG + Intergenic
1019923210 7:4175695-4175717 GTGATGTGCGGCAGGAACAAGGG - Intronic
1020036404 7:4965915-4965937 AAGCTCTGCCTCAGGAACCAAGG - Intergenic
1020919985 7:14251731-14251753 AGGCTGTTCTTCAGTAATAAAGG - Intronic
1022763038 7:33378175-33378197 ATACTGTGATGCAGAAACAAAGG - Intronic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1023472408 7:40538592-40538614 ATGCAGTGCTTATGTAACAATGG - Intronic
1023523262 7:41070490-41070512 ATGCTGTGCACCTGGAACAAAGG - Intergenic
1023966299 7:44964758-44964780 ATCCTGGGCTTCAGGAGCAGTGG - Intronic
1032927284 7:136621787-136621809 AAGCTGTATTTTAGGAACAATGG + Intergenic
1034850756 7:154491306-154491328 CTGCTGTGCGTTAGCAACAATGG + Intronic
1040503133 8:48022735-48022757 AAGCTGTTCTTCAGAAACAAAGG - Intronic
1040859459 8:51984181-51984203 ACCCTGTGCTCCAGGCACAAAGG + Intergenic
1040979594 8:53232591-53232613 ATGTTCTGTTTCAGGAAGAAGGG + Intronic
1041159512 8:55025065-55025087 ATCCTGTGCTTCAGAATCAAAGG + Intergenic
1042005931 8:64179830-64179852 AAGCTGTGCTTCAGAAATGAAGG + Intergenic
1043111955 8:76196661-76196683 TTGCTGAGCTTCTGCAACAATGG + Intergenic
1043541787 8:81271650-81271672 ATGGTTTTCTTGAGGAACAAGGG + Intergenic
1045402490 8:101833085-101833107 AAGCTGTGGCTCAGGAAGAAGGG - Intronic
1048800312 8:138188704-138188726 AGGCTGTGCTTGTGGAACAGTGG - Intronic
1048819818 8:138370279-138370301 ATGCTGTTGTTCAGGATGAATGG + Intronic
1050006648 9:1139140-1139162 AAGCTGTCCTTCAGAAATAAGGG - Intergenic
1050528000 9:6562964-6562986 GTGCTGTGCTTCAGGGAGAGGGG - Intronic
1053613559 9:39740688-39740710 ATGCATTGCCTCAGGAAAAAAGG - Intergenic
1053871600 9:42498645-42498667 ATGCATTGCCTCAGGAAAAAAGG - Intergenic
1054239955 9:62601709-62601731 ATGCATTGCCTCAGGAAAAAAGG + Intergenic
1054554088 9:66636235-66636257 ATGCATTGCCTCAGGAAGAAAGG + Intergenic
1056091399 9:83208996-83209018 CTTCTGTGCCTCAGGGACAAAGG + Intergenic
1059195506 9:112367480-112367502 ATGCTGTCCTTCAGAAATAAAGG - Intergenic
1059663554 9:116425025-116425047 AAGCTGTGCTAGAGGAAGAATGG - Intergenic
1061836501 9:133333203-133333225 GACCTGTGCTTCAGGAACAAGGG + Intronic
1062720048 9:138036112-138036134 AAGCTGTTCTTCAGGCAGAAGGG - Intronic
1188318197 X:28702235-28702257 ATGCTATGATTCAGGGTCAATGG + Intronic
1191669781 X:63738545-63738567 ATGCGGTGCTTCAGGAAAAATGG - Intronic
1191968564 X:66788429-66788451 AAGCTATCCTTCAGGAATAAAGG + Intergenic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1194140928 X:90208549-90208571 GTGCTTTTCTTCAGCAACAAAGG + Intergenic
1194659375 X:96612716-96612738 ATTCTGTGATGCATGAACAAGGG + Intergenic
1194917218 X:99721303-99721325 AAGCTGTTCTTCAGTAATAAAGG + Intergenic
1195102974 X:101574056-101574078 TTTCTGTGCTTCAGGATCCAGGG - Intergenic
1195377797 X:104244573-104244595 CTGTTGTGCTTCACAAACAAGGG - Intergenic
1197024062 X:121726268-121726290 ATGCTGAGCTTCAGGTTCATAGG - Intergenic
1198192131 X:134317660-134317682 AAGCTGTCCTTCAGAAATAAAGG + Intergenic