ID: 1023108033

View in Genome Browser
Species Human (GRCh38)
Location 7:36782327-36782349
Sequence AGCACGGACCACCCCACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023108028_1023108033 -3 Left 1023108028 7:36782307-36782329 CCTATAACTTCCCTCCTCTGAGC 0: 1
1: 0
2: 1
3: 28
4: 270
Right 1023108033 7:36782327-36782349 AGCACGGACCACCCCACTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 152
1023108027_1023108033 -2 Left 1023108027 7:36782306-36782328 CCCTATAACTTCCCTCCTCTGAG 0: 1
1: 0
2: 0
3: 23
4: 184
Right 1023108033 7:36782327-36782349 AGCACGGACCACCCCACTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023108033 Original CRISPR AGCACGGACCACCCCACTCC TGG Intergenic
900289820 1:1919109-1919131 TGCTCGGACCACGCCCCTCCCGG - Intronic
906145243 1:43556773-43556795 AGCAACCACCACCACACTCCTGG - Intronic
908882281 1:68745620-68745642 AGCAGGGACCATCCTGCTCCCGG - Intergenic
913502557 1:119484428-119484450 AGCATGGACCATCCCATGCCTGG - Intergenic
916072258 1:161177169-161177191 AGCGCGGACCACGCCCCTCTAGG - Intronic
917664793 1:177214596-177214618 ATCACGGAAATCCCCACTCCTGG - Intronic
919808938 1:201397182-201397204 AGCACGGTCCTCCCCAGCCCAGG + Intronic
1063208062 10:3853896-3853918 AGCACCGTCCACTCCACTCCTGG + Intergenic
1067084121 10:43229278-43229300 ACCGCGGACCACCCCTCGCCCGG + Intronic
1067767013 10:49094493-49094515 AGCAAGTACCACCCTGCTCCAGG + Intronic
1070273982 10:74986880-74986902 TGCACTGACCATCCCACTCCTGG + Intronic
1074399218 10:113128056-113128078 CACGCGGACCACCACACTCCTGG - Intronic
1074910316 10:117902658-117902680 TGCAGGGACCACCCAAATCCAGG + Intergenic
1075270942 10:121050100-121050122 ACCACAGTCAACCCCACTCCTGG + Intergenic
1075429369 10:122367386-122367408 AACTCGGAGCTCCCCACTCCTGG - Intergenic
1077224614 11:1434640-1434662 ATCACAGAGGACCCCACTCCTGG - Intronic
1077285502 11:1763617-1763639 TGCACGGACCACCCGCCTACGGG - Intronic
1077298714 11:1837693-1837715 AGCACAGATCTCCCCTCTCCGGG + Intergenic
1084003617 11:66312173-66312195 AGCACCGCCCACTCCACCCCTGG - Intergenic
1085016489 11:73177477-73177499 AGCAGGGTCCACCCCAGCCCAGG + Intergenic
1085284613 11:75351678-75351700 AGCGCGGGCCAGCCCGCTCCCGG + Exonic
1085816497 11:79742694-79742716 TGCACTGACCACACCACGCCAGG + Intergenic
1091408476 12:223786-223808 GGCATGGACCACCCACCTCCAGG - Intronic
1093492973 12:19725871-19725893 AGAAGGGAGCAACCCACTCCAGG - Intergenic
1095145433 12:38721257-38721279 AGAAAGGAGCAACCCACTCCAGG + Intronic
1096783491 12:54004200-54004222 ACCAGGGAGCACCCCACTCCTGG - Intronic
1098399979 12:70064777-70064799 AGCCCAGACTACCCCACTGCAGG - Intergenic
1102568089 12:113810184-113810206 AGCACGGCCCTGCCCACACCTGG + Intergenic
1102785202 12:115599198-115599220 AGCTCCCCCCACCCCACTCCCGG - Intergenic
1104715334 12:131012612-131012634 AGCACGTCCCACCTCACCCCCGG - Intronic
1104964315 12:132502205-132502227 AGGACGGACCACACCATTGCTGG - Intronic
1105499509 13:20959146-20959168 AGCAGAGATCACGCCACTCCAGG + Intergenic
1107060998 13:36159681-36159703 AGATCGCACCACCGCACTCCAGG + Intergenic
1110475232 13:75906538-75906560 AGATCGCACCACCGCACTCCAGG - Intergenic
1112735674 13:102413786-102413808 GGCACAGACCACCACCCTCCAGG - Intergenic
1114626763 14:24135625-24135647 AGCCCGGACCAACTCTCTCCTGG - Intergenic
1115409054 14:33051805-33051827 AGCTCGCACCACTGCACTCCAGG - Intronic
1115600546 14:34951698-34951720 GGCATGCACCACCACACTCCTGG + Intergenic
1115608750 14:35031965-35031987 AGATCGGACCACTGCACTCCAGG + Intergenic
1117861595 14:60097716-60097738 AGCATGGGTCACCCCATTCCTGG + Intronic
1122214401 14:100193510-100193532 GGCACCGACCACCCCACACTGGG + Intergenic
1122685216 14:103501184-103501206 AGCCTGGACCACGCCACTCAGGG - Intronic
1122696241 14:103554077-103554099 AGCCTGGACCACACCACTCAGGG + Intergenic
1124249592 15:28098017-28098039 AGCCAGGACCTCCCCATTCCTGG + Intronic
1124984404 15:34592035-34592057 GGCATGAACCACCCCAATCCTGG + Intergenic
1125716363 15:41822089-41822111 AGCCCGGAGCACCCCACTGAAGG + Exonic
1129075779 15:72994859-72994881 AGAACTGCCCACCCCACCCCTGG + Intergenic
1131190919 15:90315921-90315943 GGCAAGGACCACCCCACACTGGG - Intergenic
1132694580 16:1196161-1196183 GGCAGGGGCCACCCCACTGCTGG - Intronic
1135704706 16:24665111-24665133 TGCACGAACCACTGCACTCCAGG - Intergenic
1137063571 16:35814082-35814104 AGCAGAGACCACCCCAGCCCTGG + Intergenic
1139365154 16:66428168-66428190 GGCAGGGCCCACCCCACACCCGG + Intronic
1140708062 16:77649495-77649517 ACCAAGGACCACCCCACCCCAGG + Intergenic
1141886937 16:86898716-86898738 ACCACGGCCCACCCCGCTCCAGG - Intergenic
1141907814 16:87039156-87039178 AGCAAGGACCAGCCCAGCCCAGG - Intergenic
1146526933 17:33575017-33575039 AGATCAGACCTCCCCACTCCTGG - Intronic
1146789735 17:35744586-35744608 AGAACGGCTCACCACACTCCTGG - Exonic
1146821836 17:35989639-35989661 AGAATGCACCACCTCACTCCTGG - Intronic
1147387464 17:40090758-40090780 AGCACCGACCACCCCTCCCCTGG - Intronic
1148078597 17:44954831-44954853 TGCAACCACCACCCCACTCCGGG + Intergenic
1148239355 17:45989926-45989948 AGCCCCAAACACCCCACTCCTGG + Exonic
1149494493 17:57108730-57108752 ACCAGGGACCACCCCACTGAGGG + Intronic
1151512628 17:74570635-74570657 AGCTCAGACCACACCTCTCCTGG + Intergenic
1152097182 17:78278953-78278975 AGCACCGACCACCCCAGGGCAGG - Intergenic
1152737135 17:82002920-82002942 AGATCGCACCACCACACTCCAGG - Intronic
1157541727 18:48515551-48515573 AGCACTGACCACTCCACTATGGG - Intergenic
1158523944 18:58195565-58195587 AGCACGGCACCTCCCACTCCAGG + Intronic
1159516954 18:69470552-69470574 AGCACTGCCCATCCCACCCCAGG + Intronic
1159884583 18:73891852-73891874 GGCACAGGCCACACCACTCCAGG - Intergenic
1160500631 18:79399865-79399887 GGCTGGGACCTCCCCACTCCCGG + Intronic
1161001671 19:1913993-1914015 GGCACGGACTCCCCCACTGCAGG - Intronic
1161484743 19:4529259-4529281 AGGAAGGGCCCCCCCACTCCAGG + Exonic
1163030950 19:14543878-14543900 GGCATGCACCACCCCACACCTGG + Intronic
1163093779 19:15040761-15040783 AGCTGGGACTACACCACTCCTGG + Intergenic
1164056936 19:21629860-21629882 AGCAAGGACCCCCCCCCCCCCGG + Intergenic
1164653444 19:29902245-29902267 AGATTGGACCACCGCACTCCAGG - Intergenic
1164878054 19:31706690-31706712 GGAAGGGACCACCCCACTCCTGG + Intergenic
1166991882 19:46697599-46697621 AGCACGGCCCAGCCCACTACTGG + Intronic
1167801737 19:51747358-51747380 GGTATGCACCACCCCACTCCTGG + Intronic
926613269 2:14969422-14969444 AGATCGCACCACTCCACTCCAGG - Intergenic
932779174 2:74549315-74549337 ATCAGGGAGCACCCCAATCCCGG + Intronic
934078831 2:88451196-88451218 AACACAGACCTCCTCACTCCAGG + Intronic
938030820 2:127991481-127991503 AGCACGCACCACACCATGCCTGG + Intronic
938474129 2:131591531-131591553 AGCACAGCCCACCCCACCCCAGG - Intergenic
942185781 2:173423705-173423727 AGATCGGACCACTGCACTCCAGG - Intergenic
943425803 2:187732148-187732170 AGCAGGGACCTGCCCACACCTGG + Intergenic
947183489 2:227433370-227433392 AGCAACAAACACCCCACTCCTGG + Intergenic
948365296 2:237450780-237450802 GGCACGGACCTCCCCACCCTGGG + Intergenic
948782258 2:240329190-240329212 AGCAAGGACAATCCCACTCTAGG + Intergenic
1169266492 20:4170328-4170350 AGGAGGCACCACCCAACTCCTGG - Intronic
1171935659 20:31272683-31272705 ACCAAGGACCATCCCACTCAGGG + Intergenic
1173404232 20:42751295-42751317 TACATGGACCACCCCTCTCCTGG - Intronic
1175456119 20:59115816-59115838 ATCACAGCCCACCCTACTCCAGG - Intergenic
1176166032 20:63674163-63674185 AGCACGGACTCCCCCAGCCCAGG + Intronic
1179658561 21:42860506-42860528 CTCACGGGCCACCCCATTCCAGG - Intronic
1179925407 21:44531471-44531493 AGCAGGGCCCGCCTCACTCCAGG + Intronic
1180835794 22:18928803-18928825 AGCATGGTCCACCCCCCCCCCGG + Intronic
1181283592 22:21736412-21736434 AGCACGGACGACCGCATTCTGGG - Intergenic
1181852083 22:25756636-25756658 AGCAGGGACCAGCCAACTCTTGG + Intronic
1182462244 22:30491230-30491252 TGCATGAACCACCCCACTCCAGG - Intronic
1183583540 22:38739333-38739355 AGCACGTACCTCCTGACTCCAGG + Exonic
1184075933 22:42177979-42178001 AGCTCTACCCACCCCACTCCAGG + Intronic
1185237796 22:49724901-49724923 AGCCCCGGCCACCCCACCCCTGG + Intergenic
950335056 3:12187011-12187033 GGCACAGACCACCCTGCTCCAGG - Intronic
950706207 3:14784117-14784139 AGCAGGGCCCACCCCACTGCGGG + Intergenic
952325677 3:32318612-32318634 AGATCGCACCACCGCACTCCAGG - Intronic
954279291 3:49564578-49564600 AACACTGGCCACCCCACTCCAGG - Intronic
957625870 3:82651109-82651131 AGAAAGGAGCAACCCACTCCAGG + Intergenic
964960719 3:162420911-162420933 AGAACACACCACCGCACTCCAGG + Intergenic
966927964 3:184657902-184657924 AGCAGGGACCAACCCACACTTGG - Intronic
966973224 3:185064229-185064251 AGCTCGCACCACTGCACTCCAGG + Intergenic
968481480 4:834975-834997 AGGGCAGCCCACCCCACTCCAGG - Intergenic
968593795 4:1472401-1472423 GGCTGGGACCCCCCCACTCCTGG + Intergenic
968729516 4:2262939-2262961 AGCATGCAGCCCCCCACTCCGGG - Intergenic
971943960 4:33250616-33250638 AGCATGGGCCATCCCACTCCTGG - Intergenic
975114271 4:70661645-70661667 GGCATGCACCACCCCACACCTGG - Intronic
976275943 4:83277919-83277941 AGCTCGCACCACTGCACTCCAGG + Intronic
982736744 4:159014403-159014425 AGGTCGCACCACCGCACTCCAGG + Intronic
991525702 5:67555639-67555661 AGCATGCACCACCACACTCAGGG + Intergenic
991637632 5:68722221-68722243 AGATCGCACCACCGCACTCCAGG + Intergenic
997474355 5:134134028-134134050 AGCTCTGGCCTCCCCACTCCTGG + Intronic
997970507 5:138397556-138397578 GGCATGAACCACACCACTCCCGG - Intronic
1000074856 5:157775391-157775413 AGATCGCACCACCGCACTCCAGG + Intergenic
1000266306 5:159641291-159641313 AGAAAGGACCTACCCACTCCAGG + Intergenic
1002471720 5:179439503-179439525 TGCCCAGGCCACCCCACTCCAGG + Intergenic
1007292610 6:40798784-40798806 AGCACAGAGCCCCCCACCCCAGG + Intergenic
1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG + Intronic
1008182965 6:48355991-48356013 AGCACTGAACTCCCAACTCCTGG - Intergenic
1012249003 6:96959246-96959268 AGCACAGACCATCCCAGACCTGG + Intronic
1012281365 6:97331279-97331301 AGCTCGCACCACTGCACTCCAGG + Intergenic
1015394281 6:132717552-132717574 AGCAGTGATCACCCCACCCCAGG + Intergenic
1017870295 6:158481153-158481175 AGCACGGGCCGCCCACCTCCGGG - Exonic
1017967416 6:159278318-159278340 AGCACAGATCCCCCCACTGCTGG - Intergenic
1018326462 6:162675190-162675212 GGCACGCACCACCACACGCCTGG + Intronic
1019184641 6:170214000-170214022 AGCACGGAAGACTCCACACCAGG + Intergenic
1019309970 7:355174-355196 AGGACGGCCCACCCCAACCCAGG - Intergenic
1019562724 7:1666330-1666352 AGCCCGGGCCACCCCATCCCTGG + Intergenic
1019733744 7:2640605-2640627 AGCACAGGCCACACCACACCAGG - Intronic
1023108033 7:36782327-36782349 AGCACGGACCACCCCACTCCTGG + Intergenic
1030778087 7:113561736-113561758 ATTACGGACCTCCCTACTCCAGG + Intergenic
1033986795 7:147236150-147236172 GGCACTGACCTCCCCACTGCAGG + Intronic
1037305326 8:17497617-17497639 AGCTCGGCGCACCCCTCTCCGGG + Intronic
1037628674 8:20632134-20632156 ACCACAGACCACCCCACCCCTGG + Intergenic
1046431601 8:114135183-114135205 ATCAGGGGCCACCCTACTCCAGG - Intergenic
1048323235 8:133418112-133418134 ACCACAGACCACCCCAGTGCTGG - Intergenic
1048847003 8:138611458-138611480 AGTCAGAACCACCCCACTCCTGG + Intronic
1049040219 8:140107120-140107142 AGCAAGGACCACCATACTACAGG + Intronic
1049465158 8:142747885-142747907 AGCAGGGCCCAGCCCACCCCAGG - Intergenic
1051822289 9:21181784-21181806 AGCACAGACACCCCCATTCCAGG + Intergenic
1052905323 9:33828607-33828629 AGCTCGCACCACTGCACTCCAGG - Intronic
1052926731 9:34023176-34023198 AGATCGCACCACTCCACTCCAGG + Intronic
1056272672 9:84961977-84961999 AGCAAAGAAGACCCCACTCCTGG - Intronic
1057032368 9:91785650-91785672 AGCAGGCACCACCCCACATCTGG - Intronic
1057083468 9:92189344-92189366 CCCAGGGCCCACCCCACTCCCGG + Intergenic
1058805181 9:108583580-108583602 TGGATGGATCACCCCACTCCAGG - Intergenic
1060224306 9:121781984-121782006 AGCAAGGCCCAGCCTACTCCTGG - Intronic
1062091306 9:134679960-134679982 ACCCGGCACCACCCCACTCCCGG - Intronic
1062206414 9:135339904-135339926 AGGCTGGACCACCTCACTCCCGG + Intergenic
1185717482 X:2354338-2354360 AGCATGGAACACGCCACTGCTGG + Intronic
1187414737 X:19083412-19083434 AGAAGGGACCACCCCACCCCAGG - Intronic
1187866528 X:23727948-23727970 AGATCGGACCACTCTACTCCAGG + Intronic
1190475184 X:50820298-50820320 AGATCGCACCACCGCACTCCAGG - Intergenic
1196439687 X:115706967-115706989 AGAACATACCACCCCACACCTGG - Intergenic
1197812805 X:130463235-130463257 ATCATGGACCCCCCCACCCCCGG + Intergenic
1200180153 X:154145100-154145122 ACCAGTGACCGCCCCACTCCTGG + Intronic
1200185981 X:154183494-154183516 ACCAGTGACCGCCCCACTCCTGG + Intergenic
1200191633 X:154220632-154220654 ACCAGTGACCGCCCCACTCCTGG + Intronic
1200197388 X:154258436-154258458 ACCAGTGACCGCCCCACTCCTGG + Intronic