ID: 1023108774

View in Genome Browser
Species Human (GRCh38)
Location 7:36789367-36789389
Sequence TGGACGTGTGCTGGGTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023108774_1023108786 27 Left 1023108774 7:36789367-36789389 CCTGAAAACCCAGCACACGTCCA No data
Right 1023108786 7:36789417-36789439 AGAGGAGGCAGGGTGGTGTGTGG No data
1023108774_1023108779 9 Left 1023108774 7:36789367-36789389 CCTGAAAACCCAGCACACGTCCA No data
Right 1023108779 7:36789399-36789421 TTCCATCACCAGGAGATTAGAGG No data
1023108774_1023108784 17 Left 1023108774 7:36789367-36789389 CCTGAAAACCCAGCACACGTCCA No data
Right 1023108784 7:36789407-36789429 CCAGGAGATTAGAGGAGGCAGGG No data
1023108774_1023108785 20 Left 1023108774 7:36789367-36789389 CCTGAAAACCCAGCACACGTCCA No data
Right 1023108785 7:36789410-36789432 GGAGATTAGAGGAGGCAGGGTGG No data
1023108774_1023108782 16 Left 1023108774 7:36789367-36789389 CCTGAAAACCCAGCACACGTCCA No data
Right 1023108782 7:36789406-36789428 ACCAGGAGATTAGAGGAGGCAGG No data
1023108774_1023108787 28 Left 1023108774 7:36789367-36789389 CCTGAAAACCCAGCACACGTCCA No data
Right 1023108787 7:36789418-36789440 GAGGAGGCAGGGTGGTGTGTGGG No data
1023108774_1023108778 -1 Left 1023108774 7:36789367-36789389 CCTGAAAACCCAGCACACGTCCA No data
Right 1023108778 7:36789389-36789411 AAGAGAGTCATTCCATCACCAGG No data
1023108774_1023108781 12 Left 1023108774 7:36789367-36789389 CCTGAAAACCCAGCACACGTCCA No data
Right 1023108781 7:36789402-36789424 CATCACCAGGAGATTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023108774 Original CRISPR TGGACGTGTGCTGGGTTTTC AGG (reversed) Intergenic
No off target data available for this crispr