ID: 1023109491

View in Genome Browser
Species Human (GRCh38)
Location 7:36794976-36794998
Sequence AATGCCTGGCCTCCCACATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023109478_1023109491 20 Left 1023109478 7:36794933-36794955 CCAGTCCTCCTTCCCCACCATGT No data
Right 1023109491 7:36794976-36794998 AATGCCTGGCCTCCCACATCCGG No data
1023109482_1023109491 12 Left 1023109482 7:36794941-36794963 CCTTCCCCACCATGTGGGAGAGC No data
Right 1023109491 7:36794976-36794998 AATGCCTGGCCTCCCACATCCGG No data
1023109486_1023109491 6 Left 1023109486 7:36794947-36794969 CCACCATGTGGGAGAGCTGGCAG No data
Right 1023109491 7:36794976-36794998 AATGCCTGGCCTCCCACATCCGG No data
1023109481_1023109491 15 Left 1023109481 7:36794938-36794960 CCTCCTTCCCCACCATGTGGGAG No data
Right 1023109491 7:36794976-36794998 AATGCCTGGCCTCCCACATCCGG No data
1023109484_1023109491 8 Left 1023109484 7:36794945-36794967 CCCCACCATGTGGGAGAGCTGGC No data
Right 1023109491 7:36794976-36794998 AATGCCTGGCCTCCCACATCCGG No data
1023109488_1023109491 3 Left 1023109488 7:36794950-36794972 CCATGTGGGAGAGCTGGCAGGTT No data
Right 1023109491 7:36794976-36794998 AATGCCTGGCCTCCCACATCCGG No data
1023109485_1023109491 7 Left 1023109485 7:36794946-36794968 CCCACCATGTGGGAGAGCTGGCA No data
Right 1023109491 7:36794976-36794998 AATGCCTGGCCTCCCACATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023109491 Original CRISPR AATGCCTGGCCTCCCACATC CGG Intergenic
No off target data available for this crispr