ID: 1023109663

View in Genome Browser
Species Human (GRCh38)
Location 7:36796553-36796575
Sequence AGTGCACCCTGCAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023109658_1023109663 6 Left 1023109658 7:36796524-36796546 CCCAGTCTGATGGAGTGTGGATG No data
Right 1023109663 7:36796553-36796575 AGTGCACCCTGCAATGGGGATGG No data
1023109659_1023109663 5 Left 1023109659 7:36796525-36796547 CCAGTCTGATGGAGTGTGGATGC No data
Right 1023109663 7:36796553-36796575 AGTGCACCCTGCAATGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023109663 Original CRISPR AGTGCACCCTGCAATGGGGA TGG Intergenic
No off target data available for this crispr