ID: 1023111416

View in Genome Browser
Species Human (GRCh38)
Location 7:36815147-36815169
Sequence TGTCAGGAGCGTGAGCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023111414_1023111416 5 Left 1023111414 7:36815119-36815141 CCTTTAGGAGGTAATTGGGTTTT No data
Right 1023111416 7:36815147-36815169 TGTCAGGAGCGTGAGCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023111416 Original CRISPR TGTCAGGAGCGTGAGCCCTC AGG Intergenic
No off target data available for this crispr