ID: 1023113931

View in Genome Browser
Species Human (GRCh38)
Location 7:36841880-36841902
Sequence AGCACTTAGGTCACTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023113931_1023113936 29 Left 1023113931 7:36841880-36841902 CCTTGGGAAGTGACCTAAGTGCT No data
Right 1023113936 7:36841932-36841954 GGTAATAATACCAACCTCCTGGG No data
1023113931_1023113933 -1 Left 1023113931 7:36841880-36841902 CCTTGGGAAGTGACCTAAGTGCT No data
Right 1023113933 7:36841902-36841924 TCTGAGCTTTTGACTTTTATAGG No data
1023113931_1023113934 8 Left 1023113931 7:36841880-36841902 CCTTGGGAAGTGACCTAAGTGCT No data
Right 1023113934 7:36841911-36841933 TTGACTTTTATAGGTAAAGTAGG No data
1023113931_1023113935 28 Left 1023113931 7:36841880-36841902 CCTTGGGAAGTGACCTAAGTGCT No data
Right 1023113935 7:36841931-36841953 AGGTAATAATACCAACCTCCTGG No data
1023113931_1023113937 30 Left 1023113931 7:36841880-36841902 CCTTGGGAAGTGACCTAAGTGCT No data
Right 1023113937 7:36841933-36841955 GTAATAATACCAACCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023113931 Original CRISPR AGCACTTAGGTCACTTCCCA AGG (reversed) Intergenic
No off target data available for this crispr