ID: 1023114242

View in Genome Browser
Species Human (GRCh38)
Location 7:36845825-36845847
Sequence CTGGTATGCAGAAGAATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023114239_1023114242 6 Left 1023114239 7:36845796-36845818 CCTCATTGCAGTGCACTGTGGAC No data
Right 1023114242 7:36845825-36845847 CTGGTATGCAGAAGAATTGATGG No data
1023114237_1023114242 13 Left 1023114237 7:36845789-36845811 CCTCTCTCCTCATTGCAGTGCAC No data
Right 1023114242 7:36845825-36845847 CTGGTATGCAGAAGAATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023114242 Original CRISPR CTGGTATGCAGAAGAATTGA TGG Intergenic
No off target data available for this crispr