ID: 1023115001

View in Genome Browser
Species Human (GRCh38)
Location 7:36854171-36854193
Sequence CTATGGTGACCTAGCAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023114997_1023115001 -6 Left 1023114997 7:36854154-36854176 CCACTGATGCTCAGAGCCTATGG 0: 1
1: 0
2: 1
3: 15
4: 132
Right 1023115001 7:36854171-36854193 CTATGGTGACCTAGCAATGGTGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023115001 Original CRISPR CTATGGTGACCTAGCAATGG TGG Intergenic
900126474 1:1071030-1071052 CTGTGGTTACCTTGCACTGGGGG + Exonic
903910855 1:26723802-26723824 TTGTGGTGACGTAGCATTGGAGG - Intronic
903927169 1:26838892-26838914 TTATGGTGACCTAGCACTCGAGG + Intronic
916442056 1:164836764-164836786 CTCTGGTGACATAGCAATTATGG + Intronic
917640531 1:176979267-176979289 TTATGATGATGTAGCAATGGTGG + Intronic
920187822 1:204172608-204172630 CTCTGTTGACCTAGTAAGGGTGG + Intergenic
920362461 1:205428836-205428858 ATTTGGTGACCTATCAAAGGTGG + Intronic
1066302665 10:34110564-34110586 CCATGGTGACCAAACAATGTTGG + Exonic
1071515548 10:86294475-86294497 CGATGGTGGCTTAGCCATGGGGG + Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1094370211 12:29729503-29729525 CTGAGGTGACCTAGCAGTGAGGG - Intronic
1095580504 12:43791796-43791818 CTCTGGTGACCTACCACTGCTGG + Intergenic
1097739996 12:63230534-63230556 CTGTGTTGACCTAGCAAAGCAGG - Intergenic
1098202276 12:68068684-68068706 GTTTGGTGACCTGGCAATGGTGG - Intergenic
1098581053 12:72099320-72099342 CTATGCTGACATAGAAATGATGG - Intronic
1100916147 12:99424460-99424482 TTAAGTTGACCAAGCAATGGTGG + Intronic
1103948569 12:124540196-124540218 CCATGGCGACCCAGCAGTGGTGG + Intronic
1107736843 13:43407722-43407744 CTTAGGTGGCCTAACAATGGTGG - Intronic
1110796288 13:79642412-79642434 AAATGGTGAACTACCAATGGTGG - Intergenic
1111690280 13:91555481-91555503 CTCTGGTGGCCAAGAAATGGTGG - Intronic
1116171431 14:41407514-41407536 CTTTGATGACCCAGAAATGGAGG - Intergenic
1117010451 14:51465448-51465470 CTATGGTTACCTAGAGATGGCGG - Intergenic
1121878799 14:97480489-97480511 CCATGGTTACCTGGCAATTGAGG - Intergenic
1125592161 15:40861567-40861589 CTCTGGGGACCTAGCAATCCAGG + Intergenic
1128995765 15:72293248-72293270 CTCAGGTGACCCAGAAATGGTGG + Intronic
1129005939 15:72373664-72373686 CTATGGTGCTATAGCAATGGAGG + Intronic
1129504576 15:76070852-76070874 TTTTGGTGGCCTAGCATTGGAGG - Intronic
1137984913 16:53099533-53099555 CTCTGGTGACCTATCTAAGGTGG - Intronic
1140781104 16:78297717-78297739 CTATGGAGACCTATGCATGGTGG + Intronic
1141312122 16:82924707-82924729 CCATGGTGACCTAGAAGAGGTGG - Intronic
1142286263 16:89172707-89172729 CTAGGGGGACCTAGACATGGAGG + Intronic
1147336025 17:39727393-39727415 TGATGGTGACCTGGGAATGGGGG + Exonic
1150648314 17:66993507-66993529 CCCTGGTGACCTGGCAATGGAGG - Intronic
1150839272 17:68592926-68592948 CTTTGGAGACCAAGCACTGGGGG - Intronic
1157576178 18:48745336-48745358 CTATGATTACCTGGCAAAGGTGG + Intronic
1165823768 19:38693839-38693861 CCATGGTGACCCAGCTAAGGCGG - Intronic
925662268 2:6214747-6214769 CTGAGATCACCTAGCAATGGGGG - Intergenic
928536993 2:32250666-32250688 CTGTGGAGACCTAGCTCTGGAGG - Exonic
928563303 2:32515126-32515148 CTATGATGACATTGCACTGGAGG - Exonic
930910556 2:56624259-56624281 CTCTGGTGACTAAGTAATGGAGG - Intergenic
939638267 2:144609151-144609173 CTATGGCCACCCAGAAATGGGGG + Intergenic
940118282 2:150234685-150234707 CTATGCTGACCCTGAAATGGAGG - Intergenic
940971664 2:159903147-159903169 CTGTGGGGACCTAGCACAGGGGG + Intronic
941278190 2:163517176-163517198 CTCTGTTGAGCCAGCAATGGAGG + Intergenic
947914311 2:233821853-233821875 CTGTGGTCATCTAGCAGTGGAGG + Intronic
948499668 2:238382692-238382714 CTATGCTGAGCCAGCAAAGGAGG - Intronic
1174707481 20:52671084-52671106 CTTTGGTCACCTAGCATTGCAGG + Intergenic
1184080115 22:42213378-42213400 CAAAGGCCACCTAGCAATGGTGG - Exonic
950840404 3:15963443-15963465 ATATGGGAACCTAGCACTGGAGG + Intergenic
952084475 3:29801169-29801191 TTATGTTGACACAGCAATGGGGG + Intronic
955491083 3:59483428-59483450 GGCTGGTGACCTGGCAATGGAGG + Intergenic
960111845 3:113852515-113852537 CTAAGGGTACCTAGCAATGCTGG + Intronic
960213544 3:115000826-115000848 CTCTGCTGACCTAGTAGTGGGGG - Intronic
974585955 4:63877668-63877690 ACATGGTGACCTATGAATGGTGG + Intergenic
980532158 4:134070342-134070364 CTGTGGTGAGGTAGCAGTGGGGG + Intergenic
983625724 4:169800097-169800119 CTATTGTGAACCAGCAATGATGG + Intergenic
997000872 5:129760491-129760513 CTATGGTGACCTAAGTTTGGAGG + Exonic
1005431092 6:25757735-25757757 CTCTTGTGACCTGGCATTGGTGG + Intronic
1005497254 6:26398650-26398672 TTATGGTGGCTTGGCAATGGGGG - Intergenic
1011355491 6:86469096-86469118 GTAGGGTGACCTAGATATGGAGG - Intergenic
1012218089 6:96613476-96613498 CCATGGTGACACAGCAGTGGGGG - Intronic
1022530047 7:31061381-31061403 CTGGCGTGACCTAGCACTGGTGG - Intronic
1023115001 7:36854171-36854193 CTATGGTGACCTAGCAATGGTGG + Intergenic
1023599789 7:41870390-41870412 CCATGGTAAACTAGCAATGTGGG + Intergenic
1026635648 7:72079620-72079642 CCATGGTGACCCAGAAATGTAGG - Intronic
1030733098 7:113013108-113013130 CTGAGGAGGCCTAGCAATGGTGG - Intergenic
1041921380 8:63186357-63186379 CCATGTTGACCAAGAAATGGAGG - Exonic
1047091966 8:121584639-121584661 CCATGGTGCCCTACCAAAGGTGG - Intergenic
1047723698 8:127666455-127666477 CTATGGTGACCTTTCAGTGAGGG - Intergenic
1052075711 9:24136956-24136978 CCATGGAGACCTAGCTATTGAGG + Intergenic
1056517961 9:87372746-87372768 CTATGGGGACCCAGCAGAGGAGG - Intergenic
1187091032 X:16096828-16096850 CAATGGTTGCCTAGGAATGGGGG - Intergenic
1190742557 X:53299491-53299513 CTTTGGTGTCCTAGAAGTGGGGG + Intronic
1194897897 X:99468606-99468628 CTTTGGTGACTTGGCAGTGGCGG + Intergenic
1198954782 X:142116793-142116815 CAATGATGACCTAGCAATTGTGG + Intergenic
1199705872 X:150424515-150424537 ATATGCTGACCTAGCAGTGCTGG - Intronic
1202361777 Y:24118366-24118388 CTATTGTTACCTAGAAATAGTGG - Intergenic
1202363295 Y:24134730-24134752 CTATTGTTACCTAGAAATAGTGG + Intergenic
1202507485 Y:25535387-25535409 CTATTGTTACCTAGAAATAGTGG - Intergenic
1202509000 Y:25551747-25551769 CTATTGTTACCTAGAAATAGTGG + Intergenic