ID: 1023116566

View in Genome Browser
Species Human (GRCh38)
Location 7:36868642-36868664
Sequence CAGAATAAGGAGAAGCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023116566_1023116576 27 Left 1023116566 7:36868642-36868664 CCTGCCCGCTTCTCCTTATTCTG 0: 1
1: 0
2: 2
3: 16
4: 209
Right 1023116576 7:36868692-36868714 TTATATGTTGGGGCTGAAACAGG 0: 1
1: 1
2: 7
3: 33
4: 166
1023116566_1023116573 15 Left 1023116566 7:36868642-36868664 CCTGCCCGCTTCTCCTTATTCTG 0: 1
1: 0
2: 2
3: 16
4: 209
Right 1023116573 7:36868680-36868702 CTCTCAAGCTCTTTATATGTTGG No data
1023116566_1023116575 17 Left 1023116566 7:36868642-36868664 CCTGCCCGCTTCTCCTTATTCTG 0: 1
1: 0
2: 2
3: 16
4: 209
Right 1023116575 7:36868682-36868704 CTCAAGCTCTTTATATGTTGGGG 0: 1
1: 0
2: 1
3: 22
4: 240
1023116566_1023116574 16 Left 1023116566 7:36868642-36868664 CCTGCCCGCTTCTCCTTATTCTG 0: 1
1: 0
2: 2
3: 16
4: 209
Right 1023116574 7:36868681-36868703 TCTCAAGCTCTTTATATGTTGGG 0: 2
1: 0
2: 1
3: 31
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023116566 Original CRISPR CAGAATAAGGAGAAGCGGGC AGG (reversed) Intronic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
905531601 1:38683796-38683818 AAGAATAAGAAGAAGCTGGGGGG - Intergenic
905707702 1:40074423-40074445 AAGAAGAAGAAGAAGCGGGGGGG - Intronic
906150726 1:43585966-43585988 CAGAATTAGCAGAGGCTGGCAGG - Intronic
911463743 1:98224245-98224267 TAGAGTGAGGAGAAGCGGGAAGG + Intergenic
912519386 1:110234775-110234797 AAGAATAAGGAGAGGCAAGCAGG - Intronic
912843149 1:113057140-113057162 CAGAACAAGAAGAACCAGGCAGG - Intergenic
915156968 1:153885051-153885073 CAGAAGATGGAGAACAGGGCCGG - Intronic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
920024033 1:202978896-202978918 CAAAATAAGGGGTAGTGGGCAGG - Intergenic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1064253876 10:13727742-13727764 CAGAGTAAGGAAGAGCGGGAGGG - Intronic
1066053446 10:31659059-31659081 CAGAAAAAGGACAGGCGGACTGG + Intergenic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1066718520 10:38312751-38312773 CAAAATAAGTAGAAGGGGGTCGG - Intergenic
1066720445 10:38331668-38331690 TAGAAAAAAGAGAAGCTGGCTGG - Intergenic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1071335993 10:84601001-84601023 CAGAATTTGGAGGAGCTGGCAGG - Intergenic
1071603236 10:86969087-86969109 CAGAATACGGAGGAGAGAGCTGG - Intronic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084607960 11:70183591-70183613 CAGAATAAAGAGGAACGAGCTGG + Intronic
1084957524 11:72699206-72699228 CAGAATAAGGACAAGCGCCAAGG - Intronic
1085349242 11:75787981-75788003 CAGAGTAAGGACAAGTGGGTAGG + Intronic
1085387584 11:76165777-76165799 CAGAATGAGGACTGGCGGGCAGG + Intergenic
1086061644 11:82706115-82706137 TAAAATAAGGAGAAACTGGCTGG - Intergenic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1098364517 12:69688730-69688752 CAGAAGAAAGAGAAGCTGGAGGG + Intronic
1099436978 12:82657290-82657312 CAGAATAAGGAGGACAGGGCTGG - Intergenic
1100718295 12:97328689-97328711 GAGAATTAGGAGGTGCGGGCAGG + Intergenic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1105356320 13:19663264-19663286 GGGGAGAAGGAGAAGCGGGCTGG + Intronic
1107945479 13:45414320-45414342 CCAAATAAGGAAAAGGGGGCGGG + Intronic
1110714405 13:78684652-78684674 CAGAATAAAGAAAATCAGGCTGG - Intergenic
1111251606 13:85608633-85608655 AAGGGTAAGGAGAAGAGGGCGGG - Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115298874 14:31861565-31861587 AAGAAGGAGGAGAAGAGGGCAGG - Intergenic
1117390946 14:55262011-55262033 AAGAATAAGGACAGGCTGGCTGG + Intergenic
1118413066 14:65502519-65502541 CAGAATAAGTGGACCCGGGCCGG - Intronic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128223216 15:65982982-65983004 GGGAAGAGGGAGAAGCGGGCAGG - Intronic
1130528667 15:84728628-84728650 TAGAAAAAGCAGAAGAGGGCCGG - Intergenic
1131238605 15:90718521-90718543 CAGAAGATGAAGAAGCGGGTAGG + Intronic
1133141232 16:3746224-3746246 CAGATTAAGGGGACGAGGGCAGG - Intronic
1133371462 16:5248691-5248713 CAGAGTTAGGACAAGAGGGCCGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1139256336 16:65546533-65546555 CAGAATTAAGAGATGGGGGCAGG - Intergenic
1139542150 16:67626141-67626163 AAGAATCAGGAGAAATGGGCTGG + Intronic
1140516947 16:75550133-75550155 GAGAAGAAGGGGAAGCGGGTGGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141911712 16:87064671-87064693 GAAAGTAAGCAGAAGCGGGCTGG - Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1146570457 17:33948223-33948245 CAGAATGAGGTAAAGCAGGCTGG - Intronic
1148612170 17:48971808-48971830 CACCATAAGGAGAAGCGCCCTGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149019684 17:51948599-51948621 CAGAATAAGGAGAAGGGACTGGG - Intronic
1149623750 17:58065073-58065095 CAAAATAAGGAGAGGCCTGCTGG - Intergenic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1203167345 17_GL000205v2_random:110025-110047 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1153647075 18:7204975-7204997 GAGAAAAGGGAGAAGCGGGGTGG - Intergenic
1157502237 18:48199647-48199669 GAGAATGAGGAGGAGCGGGAGGG - Intronic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160254970 18:77240449-77240471 CAAAATAACTAGAAGGGGGCTGG - Intergenic
1160527125 18:79544564-79544586 CAGGAAAAGGAAAAGCGGGGCGG - Intergenic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161957598 19:7505277-7505299 AAGAATAAGGTAAAGTGGGCTGG - Intronic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1166059073 19:40313619-40313641 CTTAAAAAGGAAAAGCGGGCTGG - Intergenic
926083331 2:10006247-10006269 CAGTAAGAGGTGAAGCGGGCTGG - Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
928930669 2:36620529-36620551 CAGAAGAAGGAGAAGCTGAAAGG - Intronic
932404358 2:71503679-71503701 CTGAATCTGGAGAAGAGGGCTGG - Intronic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
934042891 2:88144606-88144628 CAGAATAAGAAGACCTGGGCAGG + Intergenic
934605314 2:95690743-95690765 CAGAATCAGGAGAAGCCAGTAGG + Intergenic
936538771 2:113333296-113333318 CAGAATCAGGAGAAGCCAGTAGG + Intergenic
937217088 2:120319601-120319623 CAGCACAAGGTGAAGCTGGCTGG + Intergenic
939990295 2:148872028-148872050 AAGAAAAAGGAGAACAGGGCCGG - Intergenic
940285953 2:152033181-152033203 ATGAATGAGGAGAAGCGGGGTGG + Intronic
942802646 2:179893172-179893194 CAGAAGAAGCAGAAGCTGCCAGG + Intergenic
945233660 2:207614515-207614537 CAGCCTAAGGAGAAGTGGACTGG - Intronic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG + Intergenic
947161187 2:227216425-227216447 CAGAATAAAGAGATGCGGTAAGG - Intronic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948197726 2:236107721-236107743 CAGAATCAGGAAAACCTGGCTGG + Intronic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
1172147120 20:32764481-32764503 CAGGAAAAGGAGAGGCTGGCAGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1176334224 21:5580618-5580640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176393533 21:6240334-6240356 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176404414 21:6349110-6349132 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176432743 21:6639994-6640016 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176467886 21:7075840-7075862 CAGAATAAAAAGAAGAGGGTTGG + Intronic
1176491447 21:7457618-7457640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176509195 21:7680765-7680787 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1178573626 21:33764390-33764412 CAGAATAAGGAAGAGCGGGCAGG + Intronic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1180031379 21:45210818-45210840 CAGGAAAAGGAGGAGCTGGCAGG + Intronic
1181996652 22:26888151-26888173 CTGAATAAAAAGAAGCTGGCTGG + Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
951632577 3:24737626-24737648 CAGAATGGGGTGAAGCGGGACGG + Intergenic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
954871119 3:53768163-53768185 CAGAATAGGGAGAGGCCCGCAGG + Intronic
955997850 3:64696266-64696288 GAGAATAAGAAGCAGCCGGCCGG + Intergenic
956520554 3:70098778-70098800 CAGAATAAGGAGAAACTCCCAGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
960680617 3:120243784-120243806 CAGAATAAGGAGGAGCTGTTAGG + Intronic
960815134 3:121664248-121664270 CAGATTAAGCAGAAGCGTTCAGG + Exonic
961056486 3:123793373-123793395 CAGAAAAAGAAGACGCGGTCCGG - Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
962058872 3:131904262-131904284 CAGAAATAGGAGGAACGGGCTGG - Intronic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966830858 3:184007314-184007336 AAAAATAAGCAGAAGTGGGCCGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967322979 3:188212516-188212538 CCAAATATGGAGAAGCAGGCTGG - Intronic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
969798051 4:9541222-9541244 CAGAGTTAGGACAAGAGGGCTGG + Intergenic
970235956 4:13958166-13958188 AAGAAAAAGGAGGAGCGGGGAGG - Intergenic
971469673 4:27008872-27008894 CAGAATAAAGGGAAGAGGTCAGG - Exonic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
979996919 4:127442427-127442449 AAGAATAGGGAGAACCGGGCAGG + Intergenic
980767850 4:137331503-137331525 CAGTATAAGAAGAAACAGGCAGG - Intergenic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
983059587 4:163142868-163142890 CTGTATGAGGAGAAGTGGGCCGG - Intronic
983686496 4:170415579-170415601 CATAATCAGGAGAAACAGGCAGG + Intergenic
984273932 4:177584622-177584644 CAGAAGAAGTAGAAGCCAGCAGG + Intergenic
990165486 5:52989267-52989289 CGGAATCAGGAGGGGCGGGCTGG + Intergenic
991423149 5:66462232-66462254 CAGAAAAAGGAGAATAGAGCTGG - Intergenic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
992473292 5:77077860-77077882 CAGAATGAGGAGTGGCGAGCCGG - Exonic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
995352339 5:111193845-111193867 CAGAGTATGTAGAAGAGGGCAGG + Intergenic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
995978282 5:118069733-118069755 CAGAATAATGAGAAGCCAGTAGG - Intergenic
996337809 5:122403878-122403900 CAGGATAAGGAGAAGAGGGGAGG - Intronic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
997952429 5:138252986-138253008 CAGAATCAAGGGAAGCGTGCAGG + Exonic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1006906113 6:37534870-37534892 CAGGATAAGGAGAAGCAGAAAGG - Intergenic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1008888009 6:56452348-56452370 CAGAATCAGGATAAACGGCCAGG + Intergenic
1014817249 6:125949753-125949775 CAGAAAAAGGAGAAGCCAACAGG - Intergenic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016781393 6:147963380-147963402 CAGAATGAGGAGAAAAGGGTAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020734848 7:11935041-11935063 CAGAGTAGGAAGAAGCAGGCAGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1026499946 7:70935629-70935651 CTGAATAAGGAAGAGGGGGCAGG - Intergenic
1026802276 7:73407885-73407907 AAGAAAAAGGAGCAGCGGGGTGG + Intergenic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029564124 7:101323736-101323758 CATAGAAAGGAGAACCGGGCTGG - Intergenic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1032173544 7:129605812-129605834 CAGATAGAGGGGAAGCGGGCGGG - Intergenic
1032943675 7:136825173-136825195 CAGAATAAGCACCAGCGGGCAGG - Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1034205235 7:149308965-149308987 CAGAATAGGGAGAAGCCACCTGG + Intergenic
1034413857 7:150955036-150955058 CAGGACCAGGAGAAGCCGGCAGG - Intronic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1034952992 7:155313543-155313565 CAGAATGAGGAGAAAAGGGGAGG - Intergenic
1035959821 8:4124869-4124891 CAGAAAAAGGAAAAGCGGAGGGG + Intronic
1037225486 8:16584628-16584650 GAAAATAAGGAGAAACGGCCAGG + Intergenic
1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG + Intronic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1042777455 8:72449224-72449246 AAGAATAAGGAGATGAGAGCAGG - Intergenic
1042978036 8:74492683-74492705 CAGAAATAAGAGAAGCAGGCAGG - Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG + Intronic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1050690396 9:8221166-8221188 AAGACTAAGGAGAAGCAGGGTGG + Intergenic
1051668565 9:19488235-19488257 CAGAACAAGGGGAAGCTGGTGGG - Intergenic
1055692715 9:78850801-78850823 TAGAATAAGAAAAAGAGGGCAGG - Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1060189507 9:121583089-121583111 TAGAAAACGGAGAAGCTGGCCGG + Intronic
1060317366 9:122525044-122525066 TAGACTAAGGAGATGAGGGCAGG + Intergenic
1060763434 9:126275303-126275325 CAGAATAAAGAGAAGAGGAGAGG - Intergenic
1061309808 9:129754826-129754848 CAGAACCCGGGGAAGCGGGCAGG - Intergenic
1203427414 Un_GL000195v1:54279-54301 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1203438793 Un_GL000195v1:168676-168698 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1189345155 X:40235251-40235273 GAGAATAAGTATAAGAGGGCTGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189896561 X:45662994-45663016 CAGAATAAAGGGAAGCTGGCTGG - Intergenic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1192465248 X:71350395-71350417 CAGAATAAAGAAAAGTGAGCCGG - Intergenic
1192473041 X:71416087-71416109 CAGAATAAAGAAAAGTGAGCCGG + Intronic
1193637351 X:83968934-83968956 CAGAGTTAGGAAAAGCGGGGGGG + Intergenic
1194142583 X:90223114-90223136 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1199991632 X:152990562-152990584 AAGAATAAGGAGAAGCCATCAGG - Exonic
1200144725 X:153920717-153920739 CGGCAGGAGGAGAAGCGGGCAGG - Exonic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200488337 Y:3792215-3792237 GAGAATAAGGCGAATGGGGCTGG + Intergenic