ID: 1023119560

View in Genome Browser
Species Human (GRCh38)
Location 7:36895486-36895508
Sequence TGGCGAAAGCAGTCTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023119560_1023119566 18 Left 1023119560 7:36895486-36895508 CCTCTCCCAGACTGCTTTCGCCA 0: 1
1: 0
2: 2
3: 21
4: 246
Right 1023119566 7:36895527-36895549 GTTCATACTAATTACGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023119560 Original CRISPR TGGCGAAAGCAGTCTGGGAG AGG (reversed) Intronic
902939996 1:19794059-19794081 TGGCTAGAGCAGCATGGGAGAGG - Intronic
902955761 1:19923312-19923334 AGGAGAATGCAGGCTGGGAGGGG - Intronic
903258104 1:22116104-22116126 TGAAGAAATGAGTCTGGGAGAGG + Intergenic
904318395 1:29680778-29680800 TGGAGAAAGCAGTGTGGGCCGGG - Intergenic
905465408 1:38149340-38149362 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
906036619 1:42754422-42754444 GGGAGAAAACAGTTTGGGAGTGG + Intronic
906355612 1:45104753-45104775 TTGCCAGAGGAGTCTGGGAGGGG - Intronic
906745505 1:48219356-48219378 TAGTGAAAGCAGTGTGGTAGTGG - Intergenic
906795362 1:48692471-48692493 GGCGGAAAGAAGTCTGGGAGAGG + Intronic
908757918 1:67486005-67486027 TGGGGAAAGCAGTCTAGATGGGG - Intergenic
909477355 1:76095745-76095767 TGGGGGAAGGAGTGTGGGAGGGG + Intronic
910370813 1:86513387-86513409 TGGCCAAAGAAGTGTGGCAGTGG + Intergenic
910791647 1:91056905-91056927 TGGCTAAAGAAGTATGGCAGTGG - Intergenic
910830924 1:91462188-91462210 TGGCAAAAGAAGTGTGGCAGTGG - Intergenic
911284893 1:95978063-95978085 TGGCAAAAGAAGTTTGGGAGTGG - Intergenic
911980583 1:104560656-104560678 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
912129740 1:106586819-106586841 TGGCTAAAGAAGTGTGGAAGTGG - Intergenic
912733154 1:112127594-112127616 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
913272633 1:117109194-117109216 TGAAGTAAGCAATCTGGGAGAGG + Intergenic
914965341 1:152252672-152252694 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
915709829 1:157884875-157884897 TGGCTAAAGAAGTGTGGCAGTGG + Intronic
916106020 1:161433061-161433083 TGGCAAAAGCAGTGTGGCAGTGG - Intergenic
916171003 1:162001682-162001704 TGTGGAAAGCAGGCTAGGAGAGG - Intronic
917462875 1:175247394-175247416 CGGCTAAAGCAGTGTGGCAGTGG + Intergenic
918958408 1:191239171-191239193 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
919000569 1:191826639-191826661 TGGCTAAAGCAGTGTGGCAATGG - Intergenic
920045302 1:203128738-203128760 TGGGGAGACCCGTCTGGGAGGGG - Intronic
922090037 1:222387215-222387237 TGGGAAAAGCAGCTTGGGAGAGG - Intergenic
922933487 1:229407662-229407684 TGGGGAAAGCAGTCTGTGGAGGG + Intergenic
923105140 1:230848724-230848746 TGGGGAAAGCAGTGGGGAAGAGG - Intronic
924068128 1:240247210-240247232 TAGAAAAAGCAGGCTGGGAGTGG + Intronic
924777382 1:247119489-247119511 TGGAGGAAGCAGACAGGGAGGGG + Intergenic
1063385171 10:5611956-5611978 TGGCAACAGCAGTCTGGGGTTGG + Intergenic
1064273941 10:13890249-13890271 TGGGGGCAGCAGTCAGGGAGAGG - Intronic
1064517416 10:16166548-16166570 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
1065592146 10:27274686-27274708 TGGTGAAAGCCATCTGGGACTGG + Intergenic
1067450181 10:46377216-46377238 TGGCCAAGGCAGTCTGGCACTGG + Intronic
1067587061 10:47482547-47482569 TGGCCAAGGCAGTCTGGCACTGG - Intronic
1068544121 10:58327211-58327233 TGGCGAACCGAGGCTGGGAGGGG + Intergenic
1068579604 10:58724468-58724490 TGGGAAAAGCAGTCAGGGAGAGG - Intronic
1069034703 10:63634321-63634343 TGGCGACGTCATTCTGGGAGAGG - Intergenic
1069435424 10:68377701-68377723 TGGCCAAAGAAGGCAGGGAGTGG - Intronic
1071266903 10:83972767-83972789 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
1071378552 10:85034596-85034618 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
1071566053 10:86671820-86671842 TGGGGATAGCAGGCTGGGCGCGG + Intronic
1072017164 10:91359754-91359776 GGGAGAAAGGAGTCTGGGAAGGG + Intergenic
1072298876 10:94039674-94039696 TGGAGAAATCAGGCTGGGTGTGG - Intronic
1072620587 10:97076517-97076539 TGGAGAGAGCAGGCAGGGAGGGG - Intronic
1072746160 10:97940644-97940666 TGCCGAGAGCAGCCTGGGGGTGG + Intronic
1074610513 10:115016869-115016891 TGACAAAAGCAGTCATGGAGCGG + Intergenic
1075065708 10:119287706-119287728 TGTGGACAGCAGTGTGGGAGTGG - Intronic
1075634247 10:124019523-124019545 TGAAGAGAGCAGTCGGGGAGAGG - Intronic
1076331620 10:129674683-129674705 TGGTGACAGCAGCCTGGGGGAGG + Intronic
1076772443 10:132673601-132673623 TGGCTAAAGAAGTGTGGCAGGGG - Intronic
1081378460 11:42387135-42387157 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
1081399323 11:42624687-42624709 TGGAGAAAGCAGTCTTGGAAGGG - Intergenic
1081519513 11:43868229-43868251 TGGACAAACCAGTCTGGGCGCGG + Intergenic
1081528084 11:43940721-43940743 TGGCTAAAGCAGAGTGAGAGAGG - Intronic
1082933160 11:58630108-58630130 TGGCAAAAGAAGTCTGGATGAGG - Intergenic
1083254530 11:61487938-61487960 TGGGGAAAGCATTATAGGAGTGG + Intronic
1083262493 11:61530795-61530817 TGGCTTAAGAAGGCTGGGAGTGG - Intronic
1083369440 11:62166695-62166717 GGGAAATAGCAGTCTGGGAGAGG - Intergenic
1085257723 11:75185464-75185486 TGGGGACAGCAGTTTGGAAGAGG - Intronic
1085888173 11:80545624-80545646 TGGCAAAATCACTCTGGTAGGGG - Intergenic
1088191488 11:107233289-107233311 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
1088533731 11:110837800-110837822 TGGGGAAAGCACTTTTGGAGTGG - Intergenic
1089203383 11:116739162-116739184 TGGAGAAAGCAGTCTGCCAAGGG - Intergenic
1089810269 11:121125851-121125873 TGGCGAACCCAGACTGGGTGTGG + Exonic
1092254979 12:6921945-6921967 AGGGGAAAGCTATCTGGGAGGGG - Intronic
1092999691 12:13982371-13982393 TGTCGGACGCAGTCTGGGACCGG + Intergenic
1093888340 12:24489374-24489396 TGGTGAAATCTGTTTGGGAGTGG + Intergenic
1094200661 12:27791940-27791962 AGGCGTCAGCAGTCTGGGAAGGG + Intronic
1094409408 12:30152939-30152961 AGGCAAAAGCAGTCTGGATGAGG + Intergenic
1095488145 12:42705861-42705883 TGCCTAAAGCAGTGTGGGAAGGG + Intergenic
1095622118 12:44269460-44269482 TGCAAAAAGTAGTCTGGGAGGGG - Intronic
1095844212 12:46728762-46728784 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096777846 12:53974728-53974750 TGGCGAGAGCAGTCGGGAGGCGG - Intronic
1097554754 12:61122815-61122837 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
1098045647 12:66397752-66397774 TGGAGAAACCAGACTGAGAGTGG + Intronic
1099736006 12:86566934-86566956 TGGCTAAAGAAGTGTGGCAGTGG + Intronic
1101578648 12:106021549-106021571 TGGAGAAAGCAGTCTAAAAGTGG - Intergenic
1101649117 12:106658816-106658838 GGGCCAAAGCAGCCTGTGAGTGG - Intronic
1102013398 12:109632651-109632673 TGGCCAACACAGTCTGGAAGGGG - Intergenic
1107370965 13:39747062-39747084 TGGAGAAAGCAGTCTTGGAGAGG + Intronic
1107728685 13:43326414-43326436 TGGCGAAAGCATTCTGAGGTTGG - Exonic
1108579286 13:51815043-51815065 TGGGGAAAGGAGGGTGGGAGAGG + Intergenic
1111057624 13:82971816-82971838 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
1111536136 13:89605401-89605423 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
1114206033 14:20571980-20572002 TGGCTAAAGCAGTGTGGCAGTGG + Intergenic
1114905224 14:27119344-27119366 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
1115059875 14:29175093-29175115 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
1115372834 14:32637903-32637925 TGTCGGAAGCAGAATGGGAGTGG + Intronic
1117534954 14:56694800-56694822 TGGAGACAGAAGCCTGGGAGTGG - Intronic
1118945422 14:70381809-70381831 TAGGGGAAGTAGTCTGGGAGTGG - Intronic
1119107383 14:71937630-71937652 TGGCCAAAGAAGTGTGGCAGTGG - Intronic
1120792537 14:88598401-88598423 TGGGGAAAGAAGGCTGGGGGAGG + Intronic
1121659967 14:95627491-95627513 TGGCCAAAGCCGGCTGGGCGTGG + Intergenic
1121680677 14:95790426-95790448 GGGCAACAGCATTCTGGGAGGGG + Intergenic
1121712438 14:96048814-96048836 TGGAAAAAGCAGGCTGGGCGTGG - Intronic
1122017473 14:98808431-98808453 TGGCTAAGGCAGTCTGGGGTTGG + Intergenic
1122977749 14:105177892-105177914 AGGAGCAAGCAGCCTGGGAGGGG + Intronic
1124403807 15:29376601-29376623 TGGCGAATGCAATGTCGGAGGGG - Intronic
1126515057 15:49524684-49524706 TGGTGAAAGCAGCCTGGAGGAGG + Intronic
1128652667 15:69430519-69430541 TGCCTAAACCAATCTGGGAGTGG + Intronic
1129114732 15:73358932-73358954 TAGTGAAAGCAGTCTTGGAATGG + Intronic
1130430106 15:83839258-83839280 TGGGGAAAGCATTGCGGGAGGGG + Intronic
1130923262 15:88366608-88366630 TGGCGGCAGGAGTCTGGGTGGGG - Intergenic
1131519706 15:93104539-93104561 TGGCAGATGCAGTCAGGGAGGGG - Intergenic
1132518847 16:378270-378292 TGGCGATGGCAGTGTGGGTGGGG - Intronic
1132839832 16:1973623-1973645 TGGAGAGAGGAGTCAGGGAGGGG + Intronic
1133021999 16:2970819-2970841 TGGGGAGAGCAGTGTGGGAGTGG + Intronic
1133023447 16:2976941-2976963 TGGCGGAAGTAGGCTGGGACTGG + Exonic
1136994548 16:35181040-35181062 TGGGGGAAGCAGGTTGGGAGAGG - Intergenic
1137564758 16:49526037-49526059 TGGCGAGAGCACTCTAGGAGAGG + Intronic
1137787092 16:51148910-51148932 TGAGGAAAGAAGGCTGGGAGGGG + Intronic
1141032992 16:80606108-80606130 TGGCTCCAGCAGACTGGGAGGGG + Intronic
1141778947 16:86143908-86143930 TGGAGAAAGCTGTCAGGGAGAGG - Intergenic
1142033969 16:87852387-87852409 TGGGGACGGCAGCCTGGGAGGGG + Intronic
1143117936 17:4591172-4591194 TTGGGGAATCAGTCTGGGAGGGG - Intronic
1143223473 17:5281540-5281562 TGTCGAAATCAGACGGGGAGTGG + Intergenic
1144940818 17:18939018-18939040 TGGCGAGAGTAGGCTGGGATTGG - Intergenic
1145101367 17:20080574-20080596 TGGGGAAGGCAGTCTCGGGGAGG + Intronic
1147466802 17:40616794-40616816 TGGCCAGTGCAGGCTGGGAGAGG - Intergenic
1147672452 17:42184425-42184447 TGACGACAGCAGTCGGGCAGGGG + Exonic
1148887072 17:50781535-50781557 TGGCGAAAGCCGTGTGAGGGGGG - Intergenic
1149255046 17:54816646-54816668 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
1151685263 17:75642445-75642467 TGGCAATAGCAGGCAGGGAGGGG + Intronic
1151841969 17:76625399-76625421 TGGAGAGAGAAGTCTGGAAGCGG - Exonic
1152223897 17:79083817-79083839 TGGAGAACACAGGCTGGGAGGGG + Exonic
1156384413 18:36592766-36592788 TGGAGGGAGCAGGCTGGGAGTGG + Intronic
1158115485 18:53990870-53990892 TGGCAGTAGCAGTCTGAGAGAGG - Intergenic
1160715222 19:573252-573274 TGGGGAAAGCGGCCTGGGCGTGG + Intronic
1161120097 19:2520963-2520985 GGGCGAAGGCAGGCTGGGCGTGG + Intronic
1161803032 19:6426254-6426276 TGGCAAAAGCAGGCTGGGGGTGG - Exonic
1162860878 19:13505438-13505460 TGGGGAAAGCAGTAGTGGAGAGG + Intronic
1163166950 19:15505185-15505207 AGTAGAAAGCTGTCTGGGAGTGG - Intergenic
1166123466 19:40699815-40699837 TGGCCAAAGCAGTTAGGCAGGGG + Intronic
1166147354 19:40846810-40846832 GAGGGAAATCAGTCTGGGAGTGG - Intronic
1168282684 19:55313872-55313894 TGGAATAAGCTGTCTGGGAGGGG - Intronic
925149463 2:1605313-1605335 TGAGGAAAGCTGTCTGAGAGCGG + Intergenic
925337992 2:3112559-3112581 TGGCGTTAGCATTCTGGAAGTGG - Intergenic
925460897 2:4061652-4061674 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
925979148 2:9163223-9163245 TGGCAAAAACAGGCTGGGCGCGG - Intergenic
929269660 2:39959588-39959610 TGGCTAAAGTAGTGTGGCAGTGG - Intergenic
930675730 2:54198352-54198374 TGGAGAAAGGAGTGTGGCAGGGG + Intronic
932803389 2:74762468-74762490 TGGCCCAAGCAGTTTGGGTGTGG - Intergenic
932870521 2:75393875-75393897 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
937205971 2:120237408-120237430 TGGCTGCAGCACTCTGGGAGGGG + Intergenic
942142987 2:172996637-172996659 TAGCGAAAGCAGTTTGGGAAGGG + Intronic
943334731 2:186599988-186600010 TGGGGAAAGCATTAAGGGAGAGG - Intronic
943487291 2:188501914-188501936 TGGGAAAATCAGACTGGGAGAGG - Intronic
946415338 2:219537332-219537354 TGGAGAAGGCAGGGTGGGAGTGG + Intronic
946864833 2:224033599-224033621 TGGAAAGAGCAGGCTGGGAGAGG - Intronic
1168797386 20:620623-620645 TGGAGAACGCAGGCTGGGAGGGG + Intergenic
1171958897 20:31479501-31479523 AGGCGAAAGCAAGCTGGGTGTGG - Intronic
1172993867 20:39055684-39055706 TGGGGAAATCTCTCTGGGAGGGG + Intergenic
1173331371 20:42078722-42078744 TGGGAGAAGCAGTCTGGGGGAGG - Exonic
1175283166 20:57819052-57819074 TGGGGAGAGAAGTGTGGGAGGGG - Intergenic
1175905488 20:62377593-62377615 TGGGGACAGCAGTCAGGCAGGGG + Intergenic
1176998334 21:15581469-15581491 CGGCTAAAGCAGTGTGGCAGTGG + Intergenic
1178005875 21:28219223-28219245 TGGCTAAAGAAGTATGGCAGTGG - Intergenic
1178287456 21:31337391-31337413 GAGCGAAAGCACTCAGGGAGAGG + Intronic
1181003663 22:19999493-19999515 TGGGGAAGGCAGGTTGGGAGGGG - Intronic
1181133952 22:20751397-20751419 TGGGGAAGGCAGTTTGGAAGAGG - Intronic
1181141560 22:20809105-20809127 TGGAGAAATGAGACTGGGAGAGG + Intronic
1181588385 22:23867087-23867109 GGGCAAAAGCAGGGTGGGAGGGG + Intronic
1182293458 22:29299559-29299581 GGGCGAAAGCAGTCAGTGGGTGG - Intronic
1185377261 22:50488265-50488287 AGGTGGAACCAGTCTGGGAGGGG - Exonic
951384690 3:22028728-22028750 TGGCTAAAGAAGTGTGGCAGTGG + Intronic
952408971 3:33030333-33030355 TAGAGAAATCACTCTGGGAGAGG + Intronic
952959546 3:38580816-38580838 CTGCCAAGGCAGTCTGGGAGGGG + Intronic
954896086 3:53976186-53976208 TGGCCAGGGCAGGCTGGGAGAGG + Intergenic
954962080 3:54575642-54575664 TGGCCAGTGCAGTCTTGGAGAGG + Intronic
955058409 3:55475631-55475653 TGGCAAAGGCAGTGGGGGAGTGG - Intronic
960521614 3:118661809-118661831 GGGGTAAAGCAGTGTGGGAGGGG + Intergenic
960991208 3:123312894-123312916 TGGATAAAGCAGGCTGGGGGGGG + Intronic
962393921 3:134998220-134998242 TGGGAAAAGCACTCTGTGAGAGG - Intronic
965226594 3:165999561-165999583 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
966445859 3:179999769-179999791 TGGCTAAAGAAGTGTGGCAGTGG + Intronic
967330891 3:188288218-188288240 TGCCGAAAGCAGGCTGTGATGGG + Intronic
967831960 3:193927190-193927212 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
967987547 3:195106728-195106750 TGGTGAAAGAAGTGTGGAAGAGG - Intronic
968585034 4:1412359-1412381 AGGCAAAAGCATTCTGGGACAGG + Intergenic
971473247 4:27049631-27049653 TGGGAAATGCAGTCAGGGAGGGG + Intergenic
971687216 4:29785884-29785906 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
973738251 4:53893688-53893710 TGGGGAAAGCATTTTGGAAGAGG - Intronic
974167043 4:58216776-58216798 TGGCAAAAACATTATGGGAGGGG - Intergenic
976436406 4:85023489-85023511 TGCCGAAGGCAGGCTGGGCGGGG + Intergenic
977489920 4:97698870-97698892 TGGCTAAAGAAGTGTGGCAGTGG - Intronic
978771981 4:112466578-112466600 TGGCTAAAGCAGTGTGGCAGTGG - Intergenic
981073956 4:140572597-140572619 TGGAGAGAGCAGTAGGGGAGAGG + Intergenic
982057338 4:151565251-151565273 TGACGAAAGCAGTAAGGCAGTGG - Intronic
983069072 4:163247790-163247812 AGGCTAAAGCAGGCTGGGTGTGG - Intergenic
984128958 4:175849375-175849397 TGGCGAATGCAGTATCGTAGAGG + Intronic
985524780 5:396282-396304 TGGGGACAGCAGGCTGGGAGGGG + Intronic
985786668 5:1899154-1899176 TGCAGGCAGCAGTCTGGGAGCGG - Intergenic
987271810 5:16317269-16317291 AAGGGAAAGTAGTCTGGGAGCGG - Intergenic
988160654 5:27515661-27515683 TGGCTAAAGCAGTGTGGCAGTGG - Intergenic
988233134 5:28505880-28505902 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
988267584 5:28972139-28972161 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
991033721 5:62107129-62107151 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
991951752 5:71953338-71953360 TGGCGAGAGCAGTGTGTGAGTGG - Intergenic
992914581 5:81434877-81434899 TGAAAAAATCAGTCTGGGAGTGG + Intronic
994917110 5:105994675-105994697 TGGCAAAAGAAGTGTGGCAGTGG + Intergenic
995024721 5:107406708-107406730 TGGGGACAGGAGGCTGGGAGGGG - Intronic
996150065 5:120023773-120023795 TTGTGAAAGCAGTCGGGAAGGGG + Intergenic
999076976 5:148805831-148805853 TGGCAAAGGCAGTGTGGGGGCGG + Intergenic
1002570282 5:180136166-180136188 TGGTGAGAGCAGTCAGGGAGAGG + Intronic
1006046279 6:31301476-31301498 TAGCGAACGCTGTCTGGTAGTGG + Intronic
1006673335 6:35743756-35743778 TGGATAAAGGAGTCTGGGTGGGG + Intronic
1007687661 6:43676609-43676631 GGGCTCAAGCAGTCTGGGAATGG - Intronic
1007726380 6:43918401-43918423 TGGCTAAAGCAGACTGGCAGGGG + Intergenic
1007960198 6:45951820-45951842 TGGCGTAATCAGTTTGGGAGGGG + Intronic
1009039523 6:58159528-58159550 TAGAGAAAGCAGTCTCCGAGTGG + Intergenic
1010580647 6:77593036-77593058 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
1010915289 6:81609453-81609475 TGGCGCAAGCTTTCTGGGAATGG + Intronic
1011069272 6:83362864-83362886 TGGCCAAAGAAGTGTGGCAGTGG + Intronic
1012530483 6:100229416-100229438 TGGGGAAAGCAGGGTTGGAGAGG + Intergenic
1013406831 6:109850945-109850967 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
1013502203 6:110763703-110763725 TGGTGAGAGCAGGCTGGGCGTGG - Intronic
1016430707 6:143982369-143982391 TGGCTAAAGCAGTCAGTGAAGGG + Intronic
1020482496 7:8679235-8679257 TGGATAAAGCAGGCTGGGCGCGG - Intronic
1023119560 7:36895486-36895508 TGGCGAAAGCAGTCTGGGAGAGG - Intronic
1028044012 7:86092671-86092693 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
1029407291 7:100383174-100383196 TGGGGAAACCAGTCAGGGACGGG + Intronic
1029436269 7:100565722-100565744 ATACGAGAGCAGTCTGGGAGCGG - Exonic
1030776629 7:113541682-113541704 TGGAAAAAAGAGTCTGGGAGAGG - Intergenic
1031833176 7:126651225-126651247 TGGCCAAAGAAGTGTGGCAGTGG + Intronic
1032152930 7:129445750-129445772 TGGCTAAAGAAGTGTGGCAGTGG - Intronic
1032555122 7:132824737-132824759 TGGCTGAAACAGTGTGGGAGAGG - Intronic
1034188184 7:149195363-149195385 TGGCGACCCCAGTCCGGGAGTGG + Intergenic
1034959480 7:155356025-155356047 TGGGCAAAGCAGTGTGGCAGGGG - Intergenic
1035035334 7:155890931-155890953 TGGAGAAAGCTTTATGGGAGAGG - Intergenic
1036290103 8:7480165-7480187 TGATGAAGGCAGTGTGGGAGTGG + Intergenic
1036331373 8:7831358-7831380 TGATGAAGGCAGTGTGGGAGTGG - Intergenic
1037283289 8:17268248-17268270 TGGAGGAAGCAATCTGGTAGAGG - Exonic
1037780463 8:21864998-21865020 TGGGGACTGCAGTCTGTGAGAGG - Intergenic
1038954057 8:32448286-32448308 TGGCAAAAGAAGTCTTGAAGAGG - Intronic
1043123167 8:76357049-76357071 TGGGGATAGCAGTCTAGGAGTGG + Intergenic
1044602359 8:94018160-94018182 TGCAGAAAGCACTTTGGGAGTGG - Intergenic
1045221942 8:100207771-100207793 TGGCTAAAGAAGTGTGGCAGTGG + Intronic
1046572877 8:115988766-115988788 TGGCAAAAGGAGGCTGGGCGCGG - Intergenic
1046960505 8:120107893-120107915 TGGCAAAATCAGTCTGGGGTAGG + Intronic
1054452919 9:65412992-65413014 TGGGGGAAGCAGCCTGGGATGGG - Intergenic
1054949119 9:70830079-70830101 AGACCAAAGCAGTCTGTGAGAGG + Intronic
1056072640 9:83005009-83005031 TGACAAATGCAGTCTGGGAGAGG + Intronic
1056156845 9:83846403-83846425 TGGCTAAAGAAGTGTGGCAGTGG + Intronic
1056353691 9:85777123-85777145 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
1057409085 9:94800793-94800815 TGGCAGAAGCATTCTGGAAGCGG - Exonic
1059196337 9:112374658-112374680 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
1060416388 9:123433817-123433839 TGGGGAAAGCAGTCAGGGGAAGG - Intronic
1061087887 9:128409747-128409769 TGGGGAAAGCAGGCTGGGAGAGG - Intergenic
1062732219 9:138116469-138116491 TGCTGAAAGCAGTGTGGGAATGG - Intronic
1186426672 X:9467987-9468009 TGGCGATGGCTGTGTGGGAGGGG - Intronic
1187100723 X:16188401-16188423 TGGCCAAAGCACTGTAGGAGAGG + Intergenic
1188983528 X:36749801-36749823 TGGTGCAAACAATCTGGGAGAGG - Intergenic
1190342571 X:49309084-49309106 TGGCCACAGCAGGCTGTGAGAGG + Intronic
1191658630 X:63628600-63628622 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
1193841391 X:86412560-86412582 TGGCTAAAGAATTGTGGGAGTGG - Intronic
1194108510 X:89801808-89801830 TAGCTCAAGCAGTCTGGCAGAGG + Intergenic
1194834117 X:98660003-98660025 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
1195782179 X:108478667-108478689 TGGCTAAAGCAGTGTGGCAGTGG - Intronic
1198378824 X:136065193-136065215 CGGCGACAGGAGGCTGGGAGGGG - Intergenic
1198883503 X:141307187-141307209 TGAGGAAAGGAGTTTGGGAGAGG - Intergenic
1200461168 Y:3456539-3456561 TAGCTCAAGCAGTCTGGCAGAGG + Intergenic
1201798553 Y:17927788-17927810 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
1201803000 Y:17978169-17978191 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic
1202359872 Y:24096478-24096500 TGGCTAAAGAAGTGTGGCAGTGG + Intergenic
1202510905 Y:25573636-25573658 TGGCTAAAGAAGTGTGGCAGTGG - Intergenic