ID: 1023119968

View in Genome Browser
Species Human (GRCh38)
Location 7:36899313-36899335
Sequence CCTCAACTAGAGCAGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023119968_1023119976 29 Left 1023119968 7:36899313-36899335 CCTTATTCCTGCTCTAGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 108
Right 1023119976 7:36899365-36899387 GGCTGAGACAACATTTTGCTTGG No data
1023119968_1023119975 8 Left 1023119968 7:36899313-36899335 CCTTATTCCTGCTCTAGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 108
Right 1023119975 7:36899344-36899366 GGATGTTACAGAAGTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023119968 Original CRISPR CCTCAACTAGAGCAGGAATA AGG (reversed) Intronic
903282980 1:22260745-22260767 CCTCAACTAGAGGAGGATTTGGG - Intergenic
904263006 1:29301175-29301197 CCTCACCCAGAGCAGGAGGAGGG + Intronic
908244818 1:62219411-62219433 GCTCAACAAGGGCAGGAAAAAGG + Intergenic
908407729 1:63831290-63831312 CCTCTACTAGGGCAGGCAGAGGG - Intronic
909650962 1:77975791-77975813 CCTGAACTAAAGCAGCAATCTGG + Intronic
909944026 1:81643002-81643024 TCTCACCAAGATCAGGAATAAGG + Intronic
912579939 1:110711451-110711473 GCCCAACTAGAGCAAGAAAATGG - Intergenic
916497391 1:165357419-165357441 CCCCCTCCAGAGCAGGAATAAGG + Intergenic
917796268 1:178534892-178534914 CCACCACGAGATCAGGAATAGGG - Intronic
919522074 1:198600888-198600910 CCTCTACTAGGGCAGCAATGAGG - Intergenic
919804062 1:201370287-201370309 CCTCATTCAGAGCAGGAACATGG - Intronic
922653627 1:227362239-227362261 ACTCAACAAGAGGAGGAATTTGG - Intergenic
1062807262 10:431890-431912 CCTCAACTTGATAAAGAATATGG - Intronic
1076331779 10:129675597-129675619 CCTCAACAAGAGCAGGCCCAAGG - Intronic
1077694337 11:4380508-4380530 AATAAACTGGAGCAGGAATATGG - Intergenic
1078736028 11:14021714-14021736 CCAGCACTAGAGCAGGAATTGGG - Intronic
1083000026 11:59283029-59283051 CCTCAAGTGGATCAGAAATACGG - Intergenic
1083615438 11:64023805-64023827 CCTCGATTAGACCAGGAAGAGGG - Intronic
1084318349 11:68358879-68358901 GCTCCACTAGTGCAGGAATGGGG - Intronic
1086387883 11:86328147-86328169 CCTGAAATAGAGCAGGGATTAGG + Intronic
1086917822 11:92551172-92551194 CCTCAATTACAGCAGGTATCTGG + Intronic
1088097925 11:106121469-106121491 CCTCAGCTAGCTCTGGAATAAGG - Intergenic
1088532144 11:110821947-110821969 CCTCATCTAGACCAGAAAGAAGG - Intergenic
1091989589 12:4944220-4944242 CCTTCACTAGAGCAGGAAGAAGG - Intergenic
1093101062 12:15029844-15029866 CATCACCCAGAGCAGTAATATGG - Intergenic
1095411331 12:41927992-41928014 CCTCAACTAGAGCAGTCCTCTGG - Intergenic
1096804448 12:54131907-54131929 CCCCAACTGCATCAGGAATAGGG - Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1099583381 12:84482919-84482941 CCTCAACTAGAGAATAAACAAGG - Intergenic
1100787230 12:98091295-98091317 CTTCAATTAGAGCATGAACAAGG + Intergenic
1102803271 12:115756143-115756165 CCTCAACTAAAATAGGATTAAGG - Intergenic
1106347366 13:28892140-28892162 CCTCAAGGAGTCCAGGAATATGG - Intronic
1111651323 13:91094086-91094108 TCTCAACTAGGGAATGAATAAGG - Intergenic
1116664398 14:47756628-47756650 CCTTAACTACAGAAGGAAAAGGG + Intergenic
1117947850 14:61049145-61049167 TCTGAACTAAAGCAGGAGTACGG - Intronic
1118668776 14:68100178-68100200 CCTCAACTATAGAAGGTAGAAGG + Intronic
1124844949 15:33281178-33281200 CCATTACTGGAGCAGGAATATGG - Intergenic
1129350654 15:74954279-74954301 ACTCATCAAGAGCAGGAATTTGG + Intergenic
1130685816 15:86036550-86036572 TCTGAACTTGAGCAGGAACAAGG + Intergenic
1131657158 15:94473572-94473594 CCTCTACAATAGAAGGAATATGG - Intronic
1132860011 16:2065786-2065808 CCTCCACAAGAGCAGGAGGAAGG - Intronic
1133578683 16:7121186-7121208 TCTCCATTAGAGCAGGAACAAGG + Intronic
1134790522 16:16985425-16985447 CCTCAACTTTAGCAGAATTAGGG + Intergenic
1137389770 16:48071603-48071625 CCTTCACTAGATGAGGAATAGGG + Intergenic
1137491723 16:48938587-48938609 CCTCAAATAGTTCAAGAATATGG + Intergenic
1143381430 17:6498620-6498642 CCTCAACTAGAGAAGGGATGGGG + Intronic
1143908441 17:10227977-10227999 CCTCAGTTAGAGCAGAAATGAGG - Intergenic
1149358624 17:55869887-55869909 CCTCCACTAGAGCAGTATGAAGG - Intergenic
1152275763 17:79356049-79356071 CCTGAATTAGAGCATGAATGTGG + Intronic
1158104776 18:53873332-53873354 CATGAACTGAAGCAGGAATATGG + Intergenic
1158975593 18:62708650-62708672 TCTCAACTAGTGCAGGATGAGGG - Intergenic
1163268995 19:16238420-16238442 ATTCAACTAGAGCAGTGATATGG + Intronic
1165119944 19:33552473-33552495 CTTCAATTAGAGCAGAAATAGGG - Intergenic
1165301884 19:34975370-34975392 CCTCAAGAGGAGCAGGAAAAGGG - Intergenic
1168520460 19:57046226-57046248 CCTGAACCAGAACAGGCATAGGG + Intergenic
930306249 2:49678114-49678136 CCGCAACTAGAACAGCAATCAGG - Intergenic
932073137 2:68641036-68641058 CTTCAATTAGGGCATGAATAAGG - Intergenic
932538656 2:72627270-72627292 ACTCAACTAGAGAAGGAATTTGG - Intronic
934789600 2:97047388-97047410 CATCAGCAAGAGCAGGAATTGGG - Intergenic
941499745 2:166257808-166257830 CTTCAACTAGAGCCTAAATAAGG - Intronic
942659694 2:178251204-178251226 CCAGAACAAGAGCAGGAATCTGG - Intronic
944075823 2:195729760-195729782 CCTAAAAGAGAGCAGCAATAGGG - Intronic
946433467 2:219637765-219637787 CCTGAACTTGCGCAGGAAGAAGG - Exonic
948426154 2:237887601-237887623 CTTTAACTCGAGCAGGAGTAGGG - Intronic
1170214099 20:13873863-13873885 CCTCAACTAGAGGAGGGCAAAGG - Intronic
1173088650 20:39949588-39949610 CTTCAAATAGAGAAGTAATATGG - Intergenic
1173135104 20:40432505-40432527 CATCTACAAGATCAGGAATAAGG + Intergenic
1176205840 20:63887693-63887715 CCTCAATTAATCCAGGAATATGG - Intronic
1181806891 22:25380314-25380336 GCTCCACTAGTGCAGGAATGGGG + Intronic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1184053840 22:42030760-42030782 AACCAACTAGAGCAGGGATAAGG + Intronic
950823491 3:15789268-15789290 CATCCCCTGGAGCAGGAATAGGG - Intronic
952122887 3:30265767-30265789 CCTAAACTATAGCAGAAACATGG - Intergenic
954946021 3:54425008-54425030 CCTCAGCTAGTGAAGGAACATGG + Intronic
955035671 3:55264797-55264819 CTACAGCTAGAGCAGGAACATGG + Intergenic
960882364 3:122357956-122357978 CCTCAACTAATGAAGGAAGATGG - Intergenic
962490456 3:135888758-135888780 CATTAGCAAGAGCAGGAATATGG + Intergenic
963205074 3:142625464-142625486 CCTCAGCTGGAGCAGGTATAGGG - Intronic
965939598 3:174162651-174162673 CCTCAATTAGAGAATGACTATGG + Intronic
966248940 3:177840164-177840186 CCTAAACTAGATAAGGAATGGGG - Intergenic
970638852 4:18041004-18041026 ATTCAACTAGAGGAGGAAAAAGG + Intergenic
976756111 4:88499249-88499271 CCCCTACTATAGCAGGCATAGGG - Intronic
979456728 4:120934229-120934251 CCTCCAATTGAGCAGTAATATGG - Intergenic
984094155 4:175413149-175413171 TCACAACTTGAGGAGGAATAAGG - Intergenic
989415273 5:41167974-41167996 CTTCAATTAGGGCAGGAATAAGG - Intronic
990540475 5:56767570-56767592 CATCATCTAGAGCAGTAAAATGG - Intergenic
991147545 5:63324359-63324381 CCTCAGCCAGATCAGGAATAGGG - Intergenic
992180429 5:74191787-74191809 TCTCATCAAGATCAGGAATAAGG - Intergenic
1003490850 6:6620353-6620375 CCTCAAGTAGAGCTAGAATATGG + Intronic
1003634466 6:7819759-7819781 CCTCAACTCCAGCTGGAAGATGG - Intronic
1005099382 6:22153781-22153803 CCTCAAGTAGAGCAAGAGAAAGG - Intergenic
1005755763 6:28923833-28923855 CCTAAGCGAGAGCGGGAATACGG + Exonic
1007497827 6:42273254-42273276 TCTCTATTAGAGCAGGAATCAGG + Intronic
1011529938 6:88311301-88311323 CTTAAACTAGAGAAGGAATAGGG - Intergenic
1022570740 7:31451145-31451167 AATAAACCAGAGCAGGAATAAGG - Intergenic
1023108280 7:36784937-36784959 CCTAAGCTACAGAAGGAATAGGG + Intergenic
1023119968 7:36899313-36899335 CCTCAACTAGAGCAGGAATAAGG - Intronic
1023208589 7:37777692-37777714 TCTCAACTAGAGCAAAGATATGG - Intronic
1028061132 7:86317785-86317807 CATAAACTAGAGCAGCAATCAGG + Intergenic
1029184531 7:98729109-98729131 TCTCCACTTGAGCAGGAATGGGG + Intergenic
1030719612 7:112854938-112854960 TCTCAATAAGAGCAGGAATCTGG - Intronic
1031861864 7:126989528-126989550 CCTAAACTAGAGCAGGGGTCAGG + Intronic
1031932029 7:127695155-127695177 CCTAAACCAAAGCAGGAAAAGGG - Intronic
1032997453 7:137463934-137463956 CCTGAACTAAACCAGGAACAGGG - Intronic
1036124879 8:6053409-6053431 CCCCATCTAGGGTAGGAATAGGG + Intergenic
1036917502 8:12818710-12818732 CCACAACTAGAACAGGAAATAGG + Intergenic
1037584694 8:20268497-20268519 CCTCATCTAGAGCAGCAAATGGG - Intronic
1041363770 8:57079984-57080006 CCTCAACTTGATCAGAAATCAGG - Intergenic
1045138830 8:99255716-99255738 CCTCACTTAGAGCAGTAATGAGG - Intronic
1048134122 8:131729544-131729566 CCTCTGCTAGAGCAGGATCATGG + Intergenic
1051068598 9:13135407-13135429 CCTGAACTAAAGCTGGAAGAGGG - Intronic
1053006408 9:34607805-34607827 CGGGAACTAGAGCAGGATTATGG - Intergenic
1053560081 9:39183270-39183292 CCTCAACCAGACCAGGAATCAGG + Intronic
1053824192 9:42003505-42003527 CCTCAACCAGACCAGGAATCAGG + Intronic
1054137035 9:61435685-61435707 CCTCAACCAGACCAGGAATCAGG - Intergenic
1054606381 9:67183858-67183880 CCTCAACCAGACCAGGAATCAGG - Intergenic
1058230988 9:102424637-102424659 ACTCAACTTGAGCTGGAAAAAGG - Intergenic
1061373906 9:130212987-130213009 CCTCAACTGGAGCAGAGAGACGG - Intronic
1188577096 X:31664611-31664633 CCTCAACTGGAGCAGGAGGCAGG + Intronic
1191995846 X:67094535-67094557 CCTCTACTAGGGCAGGACTGAGG + Intergenic
1192037157 X:67576196-67576218 CCTCACGGAGAGCTGGAATATGG + Intronic
1192307445 X:69977100-69977122 TCTCAACCAGTGCAGGAACAGGG - Intronic
1193553816 X:82930319-82930341 CCTCAAGTGGATCAGAAATATGG - Intergenic
1197544446 X:127808144-127808166 GCTCAGCCACAGCAGGAATAAGG + Intergenic