ID: 1023120393

View in Genome Browser
Species Human (GRCh38)
Location 7:36903082-36903104
Sequence CTGTGAGATGGGCAGGTAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 390}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023120393_1023120397 -7 Left 1023120393 7:36903082-36903104 CCGTCTACCTGCCCATCTCACAG 0: 1
1: 0
2: 0
3: 33
4: 390
Right 1023120397 7:36903098-36903120 CTCACAGAGACGTCCTTACCTGG No data
1023120393_1023120404 29 Left 1023120393 7:36903082-36903104 CCGTCTACCTGCCCATCTCACAG 0: 1
1: 0
2: 0
3: 33
4: 390
Right 1023120404 7:36903134-36903156 CCCCACAATCTTGTCTCACTAGG 0: 1
1: 1
2: 0
3: 21
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023120393 Original CRISPR CTGTGAGATGGGCAGGTAGA CGG (reversed) Intronic
900151562 1:1181204-1181226 CTGTGAGATGGACAGGTGGGTGG - Intronic
900965063 1:5952141-5952163 CTGTGACACGGGCAGGCCGAGGG + Intronic
901956417 1:12788775-12788797 CCTTGAAATGGGCAGGAAGAGGG + Intergenic
901979796 1:13024830-13024852 CCTTGAAATGGGCAGGAAGAGGG + Intronic
902002287 1:13204108-13204130 CCTTGAAATGGGCAGGAAGAGGG - Intergenic
902021518 1:13349872-13349894 CCTTGAAATGGGCAGGAAGAGGG - Intergenic
902142720 1:14370198-14370220 TTGGGAGGTGGGCAGGGAGATGG + Intergenic
903471237 1:23588877-23588899 CTGAATGATGGGCATGTAGAGGG - Intronic
903690190 1:25167795-25167817 CTGGCAGATGAGGAGGTAGATGG + Intergenic
903935589 1:26892716-26892738 CTCCGAGATGGACAGGAAGATGG - Exonic
904370441 1:30044589-30044611 CTGGGAGTGGGGCAGGGAGACGG + Intergenic
905008713 1:34732017-34732039 CTGTGAGATGGAGAGGGAGGAGG + Intronic
905175292 1:36131389-36131411 CTTTGGGAAGGGAAGGTAGAAGG + Intergenic
905481204 1:38263288-38263310 CAGTGAGTTGGGCAGGATGATGG + Intergenic
905733277 1:40310786-40310808 CTGTCAGACAGGCAGGCAGATGG + Intronic
907524736 1:55047529-55047551 CTGTGAGAAGGACAGGGACAGGG - Intronic
909077024 1:71061408-71061430 CTGTTAGAGGGGAAAGTAGATGG - Intergenic
909602528 1:77475286-77475308 CAGGGAGGTGGGGAGGTAGAAGG + Intronic
910203491 1:84724259-84724281 CTGGGGTATGGGCTGGTAGATGG + Intergenic
910709559 1:90165670-90165692 CTGTGAGATAGTCAAGTAGGAGG - Intergenic
911615501 1:100006347-100006369 CAGTGGGCTGGGCAGGTAGGTGG + Intronic
911841510 1:102688057-102688079 CTGTGAGGTGGGAAGCAAGATGG - Intergenic
912660597 1:111526173-111526195 GTGTGTGGTGGGGAGGTAGAGGG - Intronic
913445356 1:118944832-118944854 CTGTGAGATGTGCTGGAACATGG - Intronic
913473978 1:119218834-119218856 TTGAGAGATGGGCATGTAGAGGG - Intergenic
915508197 1:156370657-156370679 CTCTGTGATTAGCAGGTAGATGG - Intronic
915565912 1:156712606-156712628 CTGGGAGCTGGGGAGGGAGAGGG - Intergenic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
915662357 1:157414896-157414918 GTGTGTGGTGAGCAGGTAGAAGG - Intergenic
918043287 1:180926192-180926214 CTGGGAGGTGGGCAGTGAGATGG + Intronic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
918371547 1:183866618-183866640 CTGTGAGGTGAGCAGGAAGGTGG + Intronic
920351790 1:205342885-205342907 CTCTGAGATTGGGAGGCAGAGGG + Intronic
920596997 1:207281929-207281951 CTCTGAGATGAGCAGGGTGAGGG + Intergenic
921283614 1:213589856-213589878 CTGAAAGATGGGCAGTAAGATGG + Intergenic
921430345 1:215058160-215058182 CTGTGAGAAGGACAGAGAGATGG - Intronic
923483611 1:234407769-234407791 ATGTGAGATGGGCATGCAGAGGG - Intronic
1063459304 10:6205022-6205044 GTGTGAGACGTGCAGGTTGATGG - Intronic
1064549219 10:16481815-16481837 CTGTAAGATGGTCAGCCAGAAGG + Intronic
1065277961 10:24105435-24105457 CTGTGAGATGGGCTGAATGAGGG - Intronic
1067220260 10:44338967-44338989 CTGTGAGATGGACAAGAACATGG - Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1068474931 10:57512924-57512946 CTGGAAAATGGGCAGATAGACGG - Intergenic
1068923907 10:62514860-62514882 TTGTTAGGTGGGCAGATAGATGG - Intronic
1070425932 10:76287213-76287235 CTGAGAGTGGGGCAGGCAGATGG - Intronic
1071077952 10:81776864-81776886 CTGTGAGATTGACAGTTAGCAGG - Intergenic
1071505221 10:86227941-86227963 CAGACAGATGGGTAGGTAGATGG + Intronic
1071569068 10:86686570-86686592 CTGTGAGATGCCAAGGCAGAAGG + Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1073553846 10:104428776-104428798 ATGTGAGATGGACAGGAAGGCGG + Intronic
1074039149 10:109770932-109770954 CAGTGAGATGGGCTGGCAGGAGG - Intergenic
1074866335 10:117546282-117546304 ATGGGCGATGGGAAGGTAGAGGG + Intronic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075808016 10:125204044-125204066 GGTTGAGAAGGGCAGGTAGAAGG - Intergenic
1076015037 10:127020987-127021009 CTTTGAGCTGGGAAGGTAGCAGG + Intronic
1076435839 10:130440707-130440729 CTGTGAGATGGACTGTTTGAGGG + Intergenic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1076867620 10:133175787-133175809 CTGATGGATGGGTAGGTAGATGG + Intronic
1077089033 11:770007-770029 CGGGGAGGTGGGCAGGAAGAAGG + Exonic
1077431125 11:2516496-2516518 CTTTGAGATGGACAGGGAGCTGG + Intronic
1078723726 11:13908775-13908797 CTGTGAGATTAGAAGGCAGAAGG - Intergenic
1079359367 11:19757642-19757664 GTGTGTGATGGGAAGGTATAAGG + Intronic
1080173734 11:29337461-29337483 CTGTGGGATGGGCAAGGAAAGGG + Intergenic
1082787835 11:57326660-57326682 CTGTGGGCTGGGCAGGGTGAGGG - Intronic
1083158171 11:60838330-60838352 CTGAGAGAAGGGCAGGGAAAGGG - Intergenic
1083327293 11:61879312-61879334 CTGAGAGATGGCCAGGATGAAGG + Exonic
1083407973 11:62471896-62471918 AGGTGAGATGGACAGGGAGAGGG + Intronic
1083436696 11:62647948-62647970 CTGTTTGGTGGGCAAGTAGATGG - Exonic
1084033754 11:66495607-66495629 CTGTGAGAGGGGCAGGCAGGTGG - Intronic
1084537907 11:69768686-69768708 CTGTGGGATGGGCAGGGAGGAGG - Intergenic
1084785689 11:71440498-71440520 TGGGGAGATGGGCAGGTGGATGG + Intronic
1084842490 11:71867251-71867273 CTGTAAGATGGCTAAGTAGAAGG + Intronic
1085119334 11:73957197-73957219 CGGGGAGATGGGGAGGGAGAAGG + Intronic
1086984334 11:93232133-93232155 CTTTGAGACTTGCAGGTAGAGGG + Intergenic
1087777459 11:102269275-102269297 CTGGGTGTTGGACAGGTAGAGGG + Intergenic
1088368773 11:109066366-109066388 TTGTGAGATGGGAAGGAAGGTGG + Intergenic
1088417108 11:109601227-109601249 ATGTGAGAAGGGCAGATGGATGG + Intergenic
1088429598 11:109744635-109744657 CTGGGAGAGGGGCAAGTACAGGG + Intergenic
1088720188 11:112585397-112585419 GTGTGAGATGGGTAGGCAGGAGG + Intergenic
1090630592 11:128644036-128644058 CTCTCAGATGGGCAGGAAGGCGG - Intergenic
1090857107 11:130619756-130619778 CTGTTAGATGGGTTGATAGATGG - Intergenic
1091044628 11:132314715-132314737 CTCTGAGCTGGGCAAGAAGAGGG + Intronic
1091226524 11:133959862-133959884 CTCTGGGATGTGCAGGTAGGTGG - Intergenic
1091786944 12:3248888-3248910 CTGGGAGCTGGGCAGGTGGTGGG - Intronic
1094348624 12:29498579-29498601 GTGGGAGATGAGCAGGTAGATGG + Intergenic
1095818475 12:46450642-46450664 CTGGGGGATGGGCAGGGACAGGG + Intergenic
1095907394 12:47392006-47392028 CTGGGAGATGGAAAGGGAGAAGG - Intergenic
1096195467 12:49646595-49646617 CTGGGAGACGGGCATGCAGAGGG + Intronic
1096747694 12:53739174-53739196 GTGGGAGGTGGGCAGGAAGAGGG + Intergenic
1097548904 12:61041656-61041678 CTGTGGAATGGAAAGGTAGAGGG - Intergenic
1098882554 12:75931089-75931111 TTGTGGGATGGGGAGGCAGAAGG + Intergenic
1100661223 12:96701178-96701200 GTGTGAGATTGATAGGTAGATGG + Intronic
1100819869 12:98420860-98420882 CTGGGAGATGGGCAGGTGACAGG + Intergenic
1101049299 12:100844589-100844611 CTGTGGGGTGGTAAGGTAGAGGG + Intronic
1101796674 12:107981448-107981470 CTGTGTGCTGGGCAGATTGAGGG + Intergenic
1101817948 12:108160168-108160190 CTGTGAGTTCTGCAGGAAGATGG + Intronic
1101953599 12:109195071-109195093 CTCTGAGATGCACAGGTAGGGGG + Intronic
1102180118 12:110906267-110906289 ATGTGAGAGGGGGAGGGAGAGGG + Intronic
1102480572 12:113220779-113220801 CCATGAAGTGGGCAGGTAGAAGG + Intronic
1102504177 12:113373524-113373546 GTGTGGAATGGACAGGTAGATGG - Intronic
1103922284 12:124405251-124405273 CTGTAAGATGGACAGGTGGGTGG - Intronic
1104460514 12:128952162-128952184 CTGGGAGATGGGCAGGAAGCAGG + Intronic
1104611445 12:130231852-130231874 CTGTGAGATGCCAAGGCAGAAGG + Intergenic
1105282697 13:18977783-18977805 CTGTAAAGTTGGCAGGTAGAAGG + Intergenic
1107100338 13:36583446-36583468 TTGGGAGACGGGCAGGGAGATGG - Intergenic
1108842187 13:54632691-54632713 ATCAGTGATGGGCAGGTAGAGGG - Intergenic
1110396821 13:75039795-75039817 CTGTGAGCTGGGTATCTAGATGG + Intergenic
1111849393 13:93553378-93553400 TACTGCGATGGGCAGGTAGAAGG + Intronic
1112547609 13:100386813-100386835 CTGTGAGTTGGGGAGCTGGAGGG + Intronic
1112652665 13:101416161-101416183 CTGCGAGAGGGGCTGCTAGAGGG - Intronic
1112731616 13:102369114-102369136 CTGTGACTTGGGCATGTAAATGG - Intronic
1113069593 13:106407619-106407641 CTGTGTGATGGACAGTGAGAAGG + Intergenic
1113306318 13:109082874-109082896 CTGTGAGATGCTAAGGCAGAGGG + Intronic
1113594212 13:111519966-111519988 CTCTGAGCTGGGCAGGGTGAGGG - Intergenic
1113638414 13:111938196-111938218 CTGTGATATGAGCAGACAGAGGG + Intergenic
1114488080 14:23076247-23076269 CCATGTGATAGGCAGGTAGAAGG + Intronic
1117202107 14:53401531-53401553 GTGTGTGGTGGGCAGGGAGAAGG - Intergenic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118332790 14:64826769-64826791 CTGCTAGACGGGCAGGTGGATGG - Intronic
1118629423 14:67689216-67689238 CTGTGAGATGGGAAGGAAACTGG - Intronic
1119577563 14:75740613-75740635 CTTTGAAATTGGCAGGTGGAGGG - Intronic
1119582829 14:75802884-75802906 CTTAAAGATAGGCAGGTAGATGG + Intronic
1119715656 14:76857207-76857229 CAGTGAGATAGGCAGACAGATGG + Intronic
1119769910 14:77214072-77214094 CTGAGAGATGGGGATGGAGAAGG - Intronic
1120827382 14:88968162-88968184 CTGTGAGCTGGGCAGGAGCAGGG + Intergenic
1121357938 14:93230987-93231009 CTGTGCCATGGACAGGTAGCTGG + Intergenic
1122107893 14:99473072-99473094 CTGTTAGATGGGGAGGTTGTTGG - Intronic
1122134941 14:99627408-99627430 CAGATGGATGGGCAGGTAGATGG - Intergenic
1122138377 14:99647436-99647458 CAGTGAGGTGGGCAGGTGGATGG + Intronic
1123818066 15:23999586-23999608 CTAAGAGATGAGGAGGTAGAGGG + Intergenic
1124231034 15:27946702-27946724 CTGAGAGATGGGCAGGCAGGAGG - Intronic
1124624171 15:31298836-31298858 CTGTGGGATGGGCAAGGAGTGGG - Intergenic
1124990957 15:34673182-34673204 CTGGGAAATGGCCAAGTAGAGGG - Intergenic
1124998397 15:34746370-34746392 ATGTGAGTTGGGGAGGTGGAAGG - Intergenic
1125244560 15:37620205-37620227 ATGTGTGATGGGCTTGTAGAAGG + Intergenic
1125587089 15:40828604-40828626 CTGGGAGATGTGCAGGAAGCAGG + Exonic
1129525054 15:76208531-76208553 CTGTGGGATGGGCTGGAGGAAGG - Intronic
1131120840 15:89822685-89822707 TTGTCAGATGGACAGGTGGAGGG + Intergenic
1132745269 16:1433771-1433793 CGGTGGGATGGGCAGGCAGTGGG - Intergenic
1132851947 16:2028772-2028794 CTGGGAAGTGGGCAGGAAGAGGG - Intronic
1133214568 16:4283769-4283791 CTCTGAGTTGTGCAAGTAGAAGG - Intergenic
1133233045 16:4375284-4375306 CTGGGAGAGGGGCAGGCACAGGG - Intronic
1133472800 16:6091927-6091949 CAGATAGATGGGGAGGTAGATGG - Intronic
1133649663 16:7799783-7799805 CTTTGAGATTGGCAAGTACAGGG - Intergenic
1133962255 16:10504806-10504828 CTATTAGATGGGAAGGAAGAGGG - Intergenic
1134099146 16:11439396-11439418 CTGGGAGATGGGCAGAAAGAAGG - Intronic
1134788635 16:16968045-16968067 CTGGGTGATGGGCACCTAGAGGG - Intergenic
1135580126 16:23618399-23618421 CTGAGAGATGGGAAGGAAAAAGG + Intronic
1140253683 16:73317044-73317066 ACGTGAGATGGGCAGGTCTAGGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140437156 16:74956877-74956899 CTGGGAGAAGGGCAGGTTGGAGG - Intronic
1140640398 16:76965158-76965180 CAAGGAGTTGGGCAGGTAGAAGG + Intergenic
1141641872 16:85346324-85346346 ATGGATGATGGGCAGGTAGATGG + Intergenic
1141641996 16:85346852-85346874 ATGGGTGATGGACAGGTAGATGG + Intergenic
1142561457 17:811744-811766 CTGTGAGATGGACAGCTCAAGGG + Intronic
1143346990 17:6257089-6257111 CTGTGAAATGGGCATGATGAGGG - Intergenic
1144459415 17:15446164-15446186 CTGTGAGATGGGCAGTTTTGTGG - Intronic
1144678552 17:17177321-17177343 CTGTGACATCAGCAGGTTGAAGG + Exonic
1145231036 17:21173426-21173448 AGGGGAGATGGCCAGGTAGAAGG + Intronic
1146526768 17:33573425-33573447 CTCTGAGGAGGGAAGGTAGATGG - Intronic
1147154109 17:38534686-38534708 CTGTGAGCTGGGCAGGCTGCTGG - Intronic
1147656737 17:42095424-42095446 CTCTGAGAAGGGCAGCCAGAGGG + Intergenic
1147715795 17:42507445-42507467 CTGTGAGGTGGGAAGGGCGATGG - Intronic
1147925516 17:43943131-43943153 CTCTGAGATGGGGAGGGAAATGG - Intergenic
1147968963 17:44209542-44209564 CTGGGAGGTGGGTTGGTAGAAGG + Intronic
1148195649 17:45710804-45710826 CCCTGAGATGGGCAGGGGGATGG + Intergenic
1148395408 17:47304230-47304252 CTGGGAGATGAGCAGGGAGGCGG - Intronic
1148622467 17:49044725-49044747 CTGGGAGATTGGTAGGTGGAGGG + Intronic
1148655228 17:49278223-49278245 CAGTGAGTTCGGCAGGCAGATGG - Intergenic
1149657362 17:58317371-58317393 CTGTGGGCCGGGCAAGTAGACGG - Intronic
1150392105 17:64796172-64796194 TAGGGAGATGGGTAGGTAGATGG - Intergenic
1150979812 17:70128403-70128425 CTGAGAGAGGGGAAGTTAGAAGG - Intronic
1151039859 17:70846647-70846669 CTTTGAGATCAGCAGTTAGATGG + Intergenic
1151351580 17:73535051-73535073 CTATGAGATGGGCAGGGAAGAGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152438409 17:80289892-80289914 CTGAGAGTTGTGCAGGGAGAGGG - Intronic
1152698831 17:81809196-81809218 CAGGCAGATGGGCAGGCAGACGG - Intronic
1154123528 18:11670569-11670591 CAGTGAGCTCGGCAGGGAGAGGG - Intergenic
1154132603 18:11750242-11750264 CTGAGAAAGGAGCAGGTAGAAGG + Intronic
1154339887 18:13494015-13494037 CTGTGGGATGGCCAGGAAGGCGG - Intronic
1155999373 18:32367874-32367896 TTGAGGGATGGGCAGGGAGAAGG + Intronic
1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG + Intronic
1159613126 18:70548248-70548270 ATGTGCCATGGGCAGGGAGAAGG + Intergenic
1159965096 18:74587431-74587453 ATGTGAAATGGGCAGGAAGATGG - Intergenic
1160245363 18:77154795-77154817 CTGTGAGATGGGGTGGTACGGGG + Intergenic
1160994117 19:1873859-1873881 ATGTGAGAGGGACAGGCAGAGGG + Intergenic
1161090495 19:2357704-2357726 TGGCTAGATGGGCAGGTAGATGG - Intergenic
1161227288 19:3152648-3152670 CTCTGGGATTGGCAGTTAGAGGG + Intronic
1161820618 19:6528848-6528870 CTGGGAGATGGGAAGGGAGTTGG + Intergenic
1162087985 19:8260012-8260034 CTGTGAGATGGGGAGATGGTGGG + Intronic
1162726863 19:12695108-12695130 CTGGGAAATGGGCAGGCAGGTGG - Intronic
1162741129 19:12774572-12774594 CTGGGTGATGGGCAGGAAGAGGG - Intronic
1163112199 19:15168283-15168305 CTTTGGGATGGGAAGGCAGAAGG + Intronic
1163250538 19:16124120-16124142 CTGTGACATGGTCAGGGACAGGG - Intronic
1163654754 19:18539271-18539293 CTATAAAATGGGCAAGTAGATGG + Intronic
1164612067 19:29639306-29639328 CTGTGGGATCTCCAGGTAGATGG - Intergenic
1166069023 19:40377018-40377040 TGGGGACATGGGCAGGTAGAGGG + Intronic
1166072529 19:40395367-40395389 CTGTGGGATGGACAGATCGAGGG + Exonic
1166818897 19:45564292-45564314 CTGGAAGGGGGGCAGGTAGAGGG + Intronic
1168419574 19:56192541-56192563 CTAGGAGATGGACAGGCAGAGGG - Intronic
1168450443 19:56462397-56462419 CTGAGAGATGGGCAGAGAGCTGG + Exonic
1168450607 19:56463392-56463414 CTTTGAGATGGGTGGATAGAGGG - Intronic
925260198 2:2522054-2522076 ATGGGGGATGGGCAGGTGGATGG - Intergenic
925408348 2:3624180-3624202 GTGTGGGATGGGGAGGGAGAAGG - Intronic
925947555 2:8879810-8879832 CAGTGACAGGGGCAGGGAGAGGG + Intronic
927921067 2:26971951-26971973 CTGCAAGATGGGCAGGTGGAGGG - Intronic
928134678 2:28679466-28679488 CTGTGAGTGGGGCATGTGGATGG - Intergenic
929018535 2:37526687-37526709 CTGGGAGATGAACAGGGAGACGG + Intergenic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
930481130 2:51949006-51949028 CTTTCAGAAGGGCAGATAGAGGG + Intergenic
930821705 2:55652313-55652335 CTGTGGGATGGGCCGATACAAGG - Intronic
931516040 2:63051269-63051291 CTGTGAGAGATCCAGGTAGATGG + Exonic
931903462 2:66817921-66817943 CTTTGAGATGGACAGGTGAAAGG + Intergenic
932481514 2:72042221-72042243 GTGTGAGGTGGGCAGGGGGATGG + Intergenic
933248204 2:79999281-79999303 ATGTCAGATGGGCAGTGAGATGG - Intronic
934719204 2:96561547-96561569 ATGTGAGATGGACAGTTAGCAGG - Intergenic
934855103 2:97724670-97724692 ATGCCAGATGGGAAGGTAGAGGG + Intronic
935637404 2:105259947-105259969 CTGTTAGATGGGCTGATATAGGG + Intergenic
936705921 2:115073477-115073499 CTCTAAGATGGGCTGTTAGAGGG + Intronic
938187552 2:129245210-129245232 CAGAGAGATGAGCAGGAAGAGGG - Intergenic
938754755 2:134369359-134369381 TTGTGAGATTAGCAGGGAGATGG + Intronic
938789006 2:134660125-134660147 CTATGAGGTGGGGAGGTAGGTGG + Intronic
939399118 2:141668614-141668636 CAGTGAGATGGACAGGGAGCTGG - Intronic
939776546 2:146394437-146394459 CTGACAGAAGGGCAGGTACATGG + Intergenic
940041803 2:149369110-149369132 CTGTGACATCTGCAGTTAGAGGG + Intronic
940233084 2:151479112-151479134 CTGTGAACTGCGCTGGTAGATGG + Exonic
940451355 2:153842119-153842141 CTGTGGGATGGGGAGGTGGGGGG + Intergenic
944442001 2:199752222-199752244 CTGTGGGGTGGGGAGGGAGAGGG - Intergenic
944682819 2:202092306-202092328 CTCTGAGATGTGCAGGAAGAGGG - Intronic
945856052 2:215071324-215071346 CTGTCAGATAGGCAGGGTGAGGG + Intronic
946009666 2:216554614-216554636 CTAGGAGATGGGCTGGTGGAGGG + Intronic
946027273 2:216679454-216679476 CTGGGGGATGGCCAAGTAGATGG + Intronic
946435089 2:219646113-219646135 CTGTGAGATGGGCAGAGACCTGG + Intergenic
947404672 2:229762496-229762518 ATGTGAGAAGGGCAGGAAGAAGG - Intergenic
947452368 2:230220553-230220575 CTGAGAGCTGGGCAGGTAGTTGG + Intronic
947791970 2:232873698-232873720 CTGGGGGCTGGGCAGGTAAAAGG - Intronic
948375607 2:237518423-237518445 GGGAGGGATGGGCAGGTAGATGG + Intronic
1169117439 20:3074903-3074925 CAGTGACATGGGCAGGGGGATGG - Intergenic
1169174967 20:3502894-3502916 CAGAGATATGGGCAGGTAGGTGG + Intronic
1170306545 20:14944855-14944877 TTGTGGGACGGGCAGGCAGAAGG - Intronic
1170527891 20:17259660-17259682 CCTTGAGATAGGAAGGTAGAGGG + Intronic
1170569943 20:17627055-17627077 CAGAGAGATGGACAGGTGGATGG + Intronic
1171255510 20:23686591-23686613 CTGGGTGCTGGGCAGGGAGAAGG - Intronic
1171258236 20:23708371-23708393 CTGGGTGCTGGGCAGGGAGAAGG - Intergenic
1171258266 20:23708523-23708545 CTCTGACATGAGCAGGTGGATGG - Intergenic
1171262854 20:23748516-23748538 CTGTGTGCTGGGCAGGGAGAAGG - Intronic
1171265710 20:23770981-23771003 CTGGGTGCTGGGCAGGCAGAAGG - Intergenic
1171265742 20:23771133-23771155 CTCTGACATGAGCACGTAGATGG - Intergenic
1171266130 20:23773488-23773510 CTGGGTGCTGGGCAGGGAGATGG - Intergenic
1171271981 20:23824720-23824742 CTGTGTGCTGGGCAGGGAGAAGG - Intronic
1171275454 20:23853415-23853437 CTGGGTGCTGGGCAGGGAGAAGG - Intergenic
1171275489 20:23853566-23853588 CTCTGACATGAGCAGGTGGATGG - Intergenic
1171459117 20:25288667-25288689 CAGTGAGCTGGGCAGGCAGGAGG - Intronic
1171975705 20:31593543-31593565 CTGTGAGGTGGGCAGGGAGCTGG + Intergenic
1172164475 20:32890610-32890632 CTGTAAGGTGGTCAGGGAGAGGG + Intronic
1172292094 20:33784000-33784022 GAGTGAGATGGGGAGGGAGATGG - Intronic
1172301540 20:33853735-33853757 CTGGGAGATGGGCGGGGGGAGGG + Exonic
1173249500 20:41357204-41357226 CTGTGGGAAGGGGAGGGAGAGGG + Intronic
1173413580 20:42837078-42837100 CTATAATATGGGCAGGAAGAAGG - Intronic
1173570761 20:44074592-44074614 CAGAGAGATGGGCAGGTGGGTGG - Intergenic
1174116894 20:48232418-48232440 CTGGGAGAGGGAGAGGTAGAGGG - Intergenic
1174677497 20:52372640-52372662 CTGTGACATGGGCAGTAAAATGG - Intergenic
1175839660 20:62018964-62018986 CTGTGAGCTGGGGAGGTTGCGGG - Intronic
1175933988 20:62506725-62506747 CTTTGTGATGGCCAGGGAGATGG + Intergenic
1176294293 21:5062794-5062816 CTGTGGCACGAGCAGGTAGACGG - Intergenic
1176522388 21:7834154-7834176 CTGTTAGAGGGGCAAGTAGTGGG - Intergenic
1177358772 21:20042391-20042413 GTGTCAGATAGCCAGGTAGATGG + Intergenic
1177797213 21:25791618-25791640 GTCTGAGATGGGTAGGAAGAGGG + Intergenic
1178656408 21:34464166-34464188 CTGTTAGAGGGGCAAGTAGTGGG - Intergenic
1179862967 21:44200854-44200876 CTGTGGCACGAGCAGGTAGACGG + Intergenic
1181235777 22:21446950-21446972 GGGTGGGATGGGGAGGTAGACGG - Exonic
1181275418 22:21684949-21684971 CCATGAGATGGGCAGGAAGACGG - Intronic
1181674793 22:24444645-24444667 CTTTGGGAAGGGCAGGGAGAGGG - Intergenic
1182036371 22:27201565-27201587 ATGTGAGATGGGAGAGTAGAGGG - Intergenic
1182080259 22:27523863-27523885 CTGTGAAATGGGTATGTAAATGG - Intergenic
1184502014 22:44880063-44880085 CTCTGAGATGGGGAGGTGGGAGG + Intergenic
1185309445 22:50146015-50146037 CAGTGGGATGGGCAGGCAGATGG + Intronic
1185383842 22:50522634-50522656 CTGTGAGCTGGGCAGCTAAGGGG - Intronic
950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG + Intronic
950474187 3:13205475-13205497 TAGGTAGATGGGCAGGTAGATGG - Intergenic
950720593 3:14879818-14879840 CTGGGAGTTAGCCAGGTAGAGGG + Intronic
952162527 3:30708433-30708455 CTGAGAGATAGGAAGGCAGAAGG - Intergenic
953189020 3:40666133-40666155 CTGTGAGGTGGAGAGATAGAAGG + Intergenic
955019227 3:55102671-55102693 CTGTGAGTTGGGGAGATTGATGG - Intergenic
955304881 3:57820521-57820543 CTGAGAGATGGGGTGGTAGTGGG - Intronic
956338834 3:68196695-68196717 CTGTGAGATGGACAGGGGCAGGG - Intronic
958451725 3:94281334-94281356 CTGTCAGATGAGCAGGCATATGG - Intergenic
960464508 3:117980381-117980403 CTTTGAGATGCGCAGCTATAGGG + Intergenic
960961426 3:123073036-123073058 CTGAAAGATGGCCAGGCAGAAGG - Intronic
961332082 3:126148368-126148390 CTGTGGGCTCGGCAGGTAGTGGG - Intronic
961390619 3:126550492-126550514 CTGGGAGATGGGCTGGAAGGAGG - Intronic
961691234 3:128671304-128671326 CTCTGACATGGGCAGGCAGAAGG - Intronic
962306068 3:134287433-134287455 CTGTGGGATGTGCAGCAAGAAGG - Intergenic
963591594 3:147267492-147267514 CTGTGAGTTCTGCATGTAGACGG - Intergenic
964428281 3:156576322-156576344 CTGCTAGATGGGAAGGAAGAGGG + Intergenic
965402090 3:168224163-168224185 CTGGGATATGGGCAGGCAGGCGG - Intergenic
966625554 3:182012469-182012491 CTGTGAAATGGGCAGATGGTGGG - Intergenic
967099047 3:186200917-186200939 CTTTGAGAGGGGCAGCTGGAAGG + Intronic
967884501 3:194323907-194323929 CCGAGGGATGGGCAGGCAGAAGG + Intergenic
967929613 3:194681311-194681333 CTTTCAGAGGGGCAGGTTGAAGG + Intergenic
969460202 4:7324993-7325015 CCGTGAGATGGGAGGGCAGAAGG + Intronic
969783592 4:9433308-9433330 CTGTAAGATGGCTAAGTAGAAGG + Intergenic
971009816 4:22421454-22421476 CTGTAAGATGAGCATTTAGAGGG - Intronic
975349450 4:73329322-73329344 ATGTGGGATGCCCAGGTAGAAGG + Intergenic
979994901 4:127420121-127420143 CTGTCTGATGGGGTGGTAGAGGG - Intergenic
981547611 4:145910361-145910383 TGCTGAGACGGGCAGGTAGAGGG - Intronic
982525626 4:156474226-156474248 GCCTGAGATGGGGAGGTAGAGGG + Intergenic
982711623 4:158763680-158763702 CTGTAAGATTGTCAGGTGGATGG + Intergenic
984298090 4:177880019-177880041 CTTTCAGATGGGCAGGTTGTGGG - Intronic
985644058 5:1076816-1076838 CAGGGAGAAGGGCAGGAAGATGG + Intronic
986248165 5:6029883-6029905 CTGTCAGCTTAGCAGGTAGAGGG - Intergenic
986455715 5:7915884-7915906 CTGTGGGAAGCCCAGGTAGAAGG + Intergenic
987299579 5:16585526-16585548 CTGTGACCAGGTCAGGTAGAAGG - Intronic
987774622 5:22348180-22348202 CTGTGCTATGGGCAGCCAGAAGG - Intronic
988578169 5:32445931-32445953 CTGGGGGATGGGCATGGAGAAGG - Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
991257865 5:64634916-64634938 CTGAGAGATGCCCAGGAAGAGGG - Intergenic
991671400 5:69051871-69051893 CTGTGTCATGGGTATGTAGATGG + Intergenic
992168231 5:74076112-74076134 CTCTCAGAAGGGCAGGAAGAGGG - Intergenic
993057676 5:83001181-83001203 CTTTGAGACAGGCAGGTAGGAGG - Intergenic
996330924 5:122327902-122327924 ATGTGAAATGGGGAGGAAGATGG + Intronic
997420644 5:133764203-133764225 CTGGGAGCTGGGCAGGAAGGAGG - Intergenic
997566000 5:134886918-134886940 CTGTGAGATGGGCAAGACAAGGG - Intronic
997691588 5:135831061-135831083 CTATGAGGAGGGCAGGGAGAGGG + Intergenic
998152247 5:139764202-139764224 CTGCGAGATGGGGAGGGAGGGGG + Intergenic
999270364 5:150293325-150293347 CTGGGGGATGGGCAAGTTGAGGG + Intergenic
999624069 5:153501710-153501732 CTGGCAGATGGGCAGGAGGATGG + Intronic
999977571 5:156927105-156927127 CTGCTGGAAGGGCAGGTAGAGGG + Intronic
1000337219 5:160250556-160250578 CTGGAAGCTGGGTAGGTAGAGGG + Intergenic
1001491768 5:172161025-172161047 CTTTGAGCTGGCCAGGGAGAGGG - Intronic
1001713475 5:173795853-173795875 CTCTGAGATGGTGAGGTAGGAGG + Intergenic
1003257467 6:4487130-4487152 CTGTGATTTTGGCAGGTTGAAGG - Intergenic
1003662731 6:8078018-8078040 CTTTGAGATGTGGAGGTAAATGG - Intronic
1003809433 6:9763417-9763439 GAGTGAGATGTGCAGGAAGAGGG + Intronic
1005331327 6:24753299-24753321 GTGGGAGATGGGAAGGCAGAAGG - Intergenic
1005805570 6:29471417-29471439 AAGAGAGATGGGCAGGAAGAGGG + Intergenic
1006058790 6:31404413-31404435 CCCTGAGATGGGCAGGGAGGAGG - Intronic
1006071277 6:31499298-31499320 CCGTAAGATGGGCAGGGAGGAGG - Intronic
1006786564 6:36671739-36671761 CTCTGAGCTGGGCACTTAGAGGG - Intergenic
1006990543 6:38211497-38211519 CTGTGAGAGGCCTAGGTAGATGG + Intronic
1009706300 6:67256605-67256627 CTGTGAGAGGGGCAGTGGGAGGG - Intergenic
1010674347 6:78723639-78723661 CAGAGAGCTGGGCAGGTATAGGG + Intergenic
1013295052 6:108751547-108751569 GTGTGAGCTGGGCAGGTACCAGG + Intergenic
1014221938 6:118806601-118806623 GAGTGAGATGGGCTGATAGAAGG + Intergenic
1014545862 6:122734512-122734534 CAGAGAGATGGGCAGGAAAAGGG + Intergenic
1014735000 6:125083036-125083058 CTGGGAGATGAGATGGTAGAAGG - Exonic
1015557920 6:134482089-134482111 GTGAGAGAAGGGCAGGTAAAAGG + Intergenic
1015562341 6:134530116-134530138 CTGTGATGTGGGTAGGTTGATGG - Intergenic
1017137455 6:151160963-151160985 CTGAGAGATGCCCAGGTAGGAGG + Intergenic
1017248086 6:152249388-152249410 CTGTGCTATGGGAAGGTAAAAGG + Intronic
1017548511 6:155478654-155478676 TTGGGAGCTGGGGAGGTAGAGGG + Intergenic
1017778757 6:157700039-157700061 CTGAGATAAGGGCAGGTGGATGG + Intergenic
1018349762 6:162943958-162943980 CTGTGGGCTGGGCAGGTGGGTGG - Intronic
1018671034 6:166177687-166177709 CAGTGAGGTGGGCAGGGAGAAGG + Intergenic
1019738621 7:2662238-2662260 CAGAGAGATGGGCACGTGGAGGG - Exonic
1022819858 7:33948868-33948890 CTGTGAGATAAGCAGGAAGGAGG + Intronic
1023045299 7:36205144-36205166 GTGTGAGATGGACAGGGAGGGGG + Intronic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1023472253 7:40536340-40536362 CTCTGAGACAGGCAGGGAGAAGG + Intronic
1023473056 7:40545837-40545859 CTGTGTGATGGGGATGAAGATGG + Intronic
1024119388 7:46221661-46221683 ATCTGGGAAGGGCAGGTAGATGG + Intergenic
1028445509 7:90917762-90917784 CTGTGAGAATGCCAGGCAGATGG + Intronic
1028625381 7:92871348-92871370 CTGTGAGATGTGCAAGTGGAAGG + Intergenic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029161363 7:98554709-98554731 GTGTGAGCAGAGCAGGTAGAGGG - Intergenic
1032081541 7:128860953-128860975 CTGTAAGATGAGCAGGCTGAAGG - Intergenic
1032197276 7:129796599-129796621 CTGGGAGAGGGGCAGGCAGCAGG + Intergenic
1032197409 7:129797412-129797434 CTCTGAGATTGGGAGGTAGAGGG - Intergenic
1032786784 7:135207431-135207453 CTGTGGGCTGGCCAGGCAGATGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1035158082 7:156930336-156930358 CTGGGAGAAGGGGAGGAAGACGG - Intergenic
1035308777 7:157952019-157952041 CTGTGAGCTTGGGAGGAAGATGG - Intronic
1035471914 7:159115812-159115834 AGGTGAGAAGGGCAGCTAGAGGG - Intronic
1035684828 8:1515862-1515884 CTGTGAGATGTGGAGGAAAAGGG - Intronic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1037482453 8:19316843-19316865 CTGTGAGATGGGCATAGTGATGG + Intronic
1039532474 8:38275889-38275911 CGGGGAGATGGGGAGGAAGAAGG + Intronic
1039635475 8:39159887-39159909 GTGTGAGATGGGATGGTAGGTGG + Intronic
1040436881 8:47399525-47399547 CTGTGACACGGGCATGTAGTGGG + Intronic
1041703222 8:60815445-60815467 CTGTTTGAGGGGCAGGGAGAGGG + Intronic
1043572552 8:81621343-81621365 CAGTGAGATGGTCATGGAGAGGG - Intergenic
1044186620 8:89260843-89260865 CTTTGAGATGGGCAGTTTTAGGG + Intergenic
1044724763 8:95184418-95184440 CGGGGAGATGGGCAGGAAGGGGG + Intergenic
1045094347 8:98782246-98782268 CTGCCAGAAGGGCAGGTACATGG + Intronic
1045954174 8:107887714-107887736 GTGTGACATGAGCTGGTAGATGG - Intergenic
1046102291 8:109629045-109629067 CTCTGAGATAGGCAGGAATATGG + Intronic
1046503708 8:115111271-115111293 CTGAGAGATGGGCAGATAATGGG - Intergenic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1047676843 8:127211931-127211953 ATGTGAGGTGGACAGGAAGAGGG - Intergenic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1048317009 8:133369992-133370014 CAGTGTGAGGGGCAGGCAGAGGG - Intergenic
1048900152 8:139029378-139029400 ATGTGATACGTGCAGGTAGAAGG - Intergenic
1048952741 8:139509674-139509696 CTGTGAGATGGGCTTGGACATGG + Intergenic
1048986628 8:139738342-139738364 CTGGGACATGGGCAAGTGGAGGG - Intronic
1049270559 8:141693439-141693461 CTGAGGGATGGGCAGGAAGGAGG + Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049849451 8:144823012-144823034 CGGTGACATGGGCTGGGAGAGGG - Intergenic
1050027799 9:1353923-1353945 GTTTGAGAGGGGCAGGTAGAGGG + Intergenic
1052289362 9:26824277-26824299 CTGTGATATGGACAGGAAGCAGG - Intergenic
1052749222 9:32472032-32472054 CTGTGAGGTGGTCAGGATGAGGG + Intronic
1053443822 9:38136400-38136422 CTGTTAGATGGGAAGGGAAAGGG - Intergenic
1054838601 9:69708804-69708826 CTGTGAGAGGCCCAGGCAGACGG - Intergenic
1056526429 9:87447018-87447040 CTGTCCAATGGGCAGGTAGGAGG - Intergenic
1057205068 9:93166926-93166948 CTGTGGGATGGGAAGGTACAGGG - Intergenic
1057575538 9:96239250-96239272 TAGTGAGAGGGGCAGGAAGAAGG + Intronic
1057652628 9:96931802-96931824 CTGTGTGTTGGGCCGGGAGAGGG - Exonic
1058723645 9:107781957-107781979 CTATAAGATGGGCAGGGAGGTGG - Intergenic
1059736264 9:117102943-117102965 CTGTGAGAGAGACAGGGAGAGGG + Intronic
1060462304 9:123868541-123868563 CTCTGAGATTGGCATGTGGAGGG + Intronic
1060791701 9:126489692-126489714 CTGGAAGATGGCCAGGCAGAAGG - Intronic
1061604471 9:131698579-131698601 CTGTTAGAAGGGCGGGTAGAAGG + Intronic
1186816209 X:13240470-13240492 CTGGGAACTGGGCAGGTAGGAGG - Intergenic
1187379487 X:18787355-18787377 TTGTAAGGTGGGCAGGTTGAGGG + Intronic
1189252335 X:39611038-39611060 GTGTGGGACGGGCAGGTGGAAGG + Intergenic
1191032019 X:55984274-55984296 CTGTTAGGTGAGCGGGTAGAGGG - Intergenic
1195099346 X:101539387-101539409 GGGTGAGGTGGGCAGGTAGGTGG - Intergenic
1195380958 X:104270410-104270432 CTGTGAGATAGAAAGGCAGATGG - Intergenic
1196002028 X:110796163-110796185 CTGTGTGATGGGAAAGTAGCCGG - Intergenic
1197278785 X:124510570-124510592 CTCTGATATGGGTTGGTAGAGGG + Intronic
1197746423 X:129934470-129934492 GTGTGAGGTGGGCAGGGAGCTGG - Intergenic
1200149394 X:153943865-153943887 CTGGGAGATGGGCAGGAAGGGGG + Intronic
1201413999 Y:13729636-13729658 CTGGGGGATGGGCAGGGGGAAGG - Intergenic
1201747067 Y:17388375-17388397 AAGAGAGATGGGCAGGTAGATGG + Intergenic