ID: 1023121025

View in Genome Browser
Species Human (GRCh38)
Location 7:36908787-36908809
Sequence TGATACTGTACCTAATTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023121025_1023121029 19 Left 1023121025 7:36908787-36908809 CCACCTAATTAGGTACAGTATCA 0: 1
1: 0
2: 1
3: 5
4: 75
Right 1023121029 7:36908829-36908851 AAGCACCTCCTATCTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023121025 Original CRISPR TGATACTGTACCTAATTAGG TGG (reversed) Intronic
902841509 1:19077095-19077117 TGACACAGTGCCTAATAAGGAGG - Intronic
902884878 1:19397627-19397649 TGATGCTGTACCCTAGTAGGTGG - Intronic
903504924 1:23826687-23826709 TGATACTGTGACCAATTAGTGGG - Intronic
906754287 1:48294054-48294076 TGAAACTGTAGCTAGTTAGAAGG + Intergenic
913217166 1:116630245-116630267 TGATCTTGCCCCTAATTAGGAGG - Intronic
913714203 1:121517695-121517717 TGACACTCTACCTAATTATAGGG + Intergenic
917969628 1:180198460-180198482 TGATAATGAACCTCATTAAGGGG + Exonic
918334046 1:183489784-183489806 TGTTACTCTACCTATTTAGGTGG + Intronic
1065767902 10:29048790-29048812 TGATCTTGTACCTAATTAGGGGG + Intergenic
1066372137 10:34826210-34826232 TGCTACTGAACCTGAATAGGTGG - Intergenic
1073045773 10:100637477-100637499 AGACACTGTACCCTATTAGGTGG + Intergenic
1081465301 11:43311497-43311519 GGATACTGGACATAATCAGGTGG + Intergenic
1082015973 11:47487446-47487468 TTATAGTGTAACTAACTAGGAGG - Intronic
1087334468 11:96826038-96826060 TGACAATGTACCTCTTTAGGGGG - Intergenic
1091321243 11:134653696-134653718 TAATATTCTACCTAATTATGGGG - Intergenic
1093097135 12:14984422-14984444 TGATGCTGTAAGTAATCAGGAGG + Intergenic
1094344515 12:29452285-29452307 TAATACTGTACCTGAGGAGGAGG + Intronic
1095787389 12:46124478-46124500 CGATCCTGTGCCTAATTAGAAGG - Intergenic
1095937508 12:47701946-47701968 TCATACTGTACATAATATGGAGG - Intronic
1097434224 12:59540201-59540223 TGATACTGTTCCTAATTTCCAGG + Intergenic
1102694488 12:114787515-114787537 TGCTACTGTACATAGTGAGGAGG + Intergenic
1106986693 13:35360951-35360973 TGAAAATGTATCAAATTAGGTGG + Intronic
1111259800 13:85722369-85722391 TGATAAAGAAACTAATTAGGAGG - Intergenic
1114208378 14:20594670-20594692 TGCTACAGTACCTTATTAGGAGG - Intronic
1115014143 14:28589455-28589477 TTATACTGTACATCATTAAGGGG - Intergenic
1115458253 14:33630387-33630409 TGAAACTGTACTAAGTTAGGAGG - Intronic
1116574127 14:46551598-46551620 TTATGCTGCTCCTAATTAGGGGG - Intergenic
1129302017 15:74630893-74630915 TCTCACTGTACCTAATCAGGGGG + Exonic
1134115569 16:11545364-11545386 TGTTAAAGTACATAATTAGGTGG - Intergenic
1140934774 16:79660259-79660281 TTTTATTGTACCTAATTAGAAGG - Intergenic
1149216772 17:54365051-54365073 TGATTCTGAACCTAATTACAAGG - Intergenic
1156807240 18:41200062-41200084 TGAGACTGTTCCTAATTTTGAGG + Intergenic
1166237381 19:41466342-41466364 TGATACTGTTCCTAATAACCAGG - Intergenic
929080771 2:38119900-38119922 TGAAGCTGTTTCTAATTAGGAGG - Intergenic
931561616 2:63567585-63567607 TGTAACTGTAGCTAAGTAGGGGG - Intronic
935804933 2:106736044-106736066 TGAAACTGTACATAAGTACGGGG + Intergenic
941293365 2:163703864-163703886 TGATAATATATCTGATTAGGTGG - Intronic
1169102150 20:2959827-2959849 TGTAACTGTACCTACTCAGGAGG + Intronic
1171233434 20:23505915-23505937 TGTTAATGTACAGAATTAGGTGG - Intergenic
1178749996 21:35293456-35293478 TGATACTCTTCAAAATTAGGTGG - Intronic
1180818524 22:18808636-18808658 TGATTTTGCCCCTAATTAGGAGG - Intergenic
1181204747 22:21243091-21243113 TGATTTTGCCCCTAATTAGGAGG - Intergenic
1203222178 22_KI270731v1_random:52324-52346 TGATTTTGCCCCTAATTAGGAGG + Intergenic
1203268653 22_KI270734v1_random:34490-34512 TGATTTTGCCCCTAATTAGGAGG - Intergenic
958040976 3:88226081-88226103 TAATACTGTACATATTTATGGGG + Intergenic
959495416 3:107045097-107045119 TGATGAAATACCTAATTAGGAGG - Intergenic
960795608 3:121483802-121483824 TAATGCTCTACTTAATTAGGTGG + Intronic
966429871 3:179820239-179820261 TGAAACTGTACATAACTAGTGGG - Intronic
972041554 4:34607418-34607440 TGATTTTGTACCTCATTGGGAGG - Intergenic
974258467 4:59492923-59492945 AGTTACTCTAGCTAATTAGGAGG + Intergenic
974779401 4:66533074-66533096 TAATACTGTCTCTAACTAGGTGG - Intergenic
975451970 4:74538952-74538974 TGATGCTCTACCTAATCATGTGG - Intergenic
978213779 4:106172349-106172371 TGAGACTGTATCTCTTTAGGAGG + Intronic
979064200 4:116107217-116107239 TGATAATTTGCCTAATTGGGTGG + Intergenic
979711400 4:123784047-123784069 AGATCCTGTACTTTATTAGGTGG + Intergenic
983371720 4:166868336-166868358 TGCAACTGTAGCTAATCAGGAGG + Intronic
984399206 4:179240266-179240288 TGACAATGTACTTAATTAGGTGG - Intergenic
989963543 5:50442783-50442805 TGACACTCTACCTAATTATAGGG - Intronic
990876895 5:60496002-60496024 TGATACTGTGCCAAAGTTGGTGG - Intronic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
993272242 5:85811080-85811102 GGATACTGTATCTGACTAGGGGG - Intergenic
994393488 5:99210327-99210349 TGATACTGTTCCTAATTTCGAGG - Intergenic
994396071 5:99226683-99226705 TGATACTGTACCTAATATCCAGG - Intergenic
1000332226 5:160214901-160214923 AGATACTGTTCCTAGTGAGGTGG + Intronic
1009222433 6:60997154-60997176 TGATACTGTTCCTAATTTTCAGG + Intergenic
1009224811 6:61012033-61012055 TGATATTGTTCCTAATATGGGGG - Intergenic
1013988369 6:116224465-116224487 ATATACTGTACCTCATAAGGTGG - Intronic
1016287642 6:142491027-142491049 GGAGACTGTACCTAACTCGGTGG - Intergenic
1019619419 7:1982754-1982776 TGATACTGGACATCCTTAGGTGG + Intronic
1023121025 7:36908787-36908809 TGATACTGTACCTAATTAGGTGG - Intronic
1026392826 7:69919461-69919483 AGACACTGTAGCTAATTAGAAGG + Intronic
1028975920 7:96913913-96913935 GGATACTGTAACTAATTAGATGG - Intergenic
1029371823 7:100155251-100155273 TGGTTCTGTACCTCATGAGGTGG + Exonic
1033101489 7:138476616-138476638 TAATGCTGTACCTATTTTGGGGG - Intronic
1034825253 7:154256544-154256566 TGATTCTGTTCATAATTTGGAGG - Intronic
1044473417 8:92598881-92598903 TGATATTATACCTTAGTAGGAGG - Intergenic
1044780806 8:95741505-95741527 TGCTGCTCTACCTTATTAGGTGG + Intergenic
1055720678 9:79170312-79170334 TGCTAATGTTCATAATTAGGAGG - Intergenic
1057095367 9:92303001-92303023 GGAAAATGTACCTAATTAGCTGG + Intronic
1058421365 9:104836205-104836227 AGAGACTGTACCTACCTAGGGGG - Intronic
1193292693 X:79794548-79794570 TGATTCTGTAACTAAGAAGGAGG - Intergenic
1200312656 X:155094757-155094779 TGAACCTGAACCTAACTAGGTGG + Intronic