ID: 1023123632

View in Genome Browser
Species Human (GRCh38)
Location 7:36934066-36934088
Sequence CTCTGGGAATGAAGCCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1001
Summary {0: 1, 1: 0, 2: 5, 3: 70, 4: 925}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023123620_1023123632 16 Left 1023123620 7:36934027-36934049 CCCAGCAGCTTTGGGTGGCTTCT 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1023123632 7:36934066-36934088 CTCTGGGAATGAAGCCAAGAGGG 0: 1
1: 0
2: 5
3: 70
4: 925
1023123615_1023123632 27 Left 1023123615 7:36934016-36934038 CCCAGCAGGATCCCAGCAGCTTT 0: 1
1: 0
2: 0
3: 24
4: 298
Right 1023123632 7:36934066-36934088 CTCTGGGAATGAAGCCAAGAGGG 0: 1
1: 0
2: 5
3: 70
4: 925
1023123621_1023123632 15 Left 1023123621 7:36934028-36934050 CCAGCAGCTTTGGGTGGCTTCTG 0: 1
1: 0
2: 3
3: 27
4: 263
Right 1023123632 7:36934066-36934088 CTCTGGGAATGAAGCCAAGAGGG 0: 1
1: 0
2: 5
3: 70
4: 925
1023123616_1023123632 26 Left 1023123616 7:36934017-36934039 CCAGCAGGATCCCAGCAGCTTTG 0: 1
1: 0
2: 1
3: 22
4: 223
Right 1023123632 7:36934066-36934088 CTCTGGGAATGAAGCCAAGAGGG 0: 1
1: 0
2: 5
3: 70
4: 925

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023123632 Original CRISPR CTCTGGGAATGAAGCCAAGA GGG Intronic
900411419 1:2514412-2514434 CTCTGTGGATGCAGCCGAGAGGG - Exonic
900687113 1:3955630-3955652 CTGTGGGAAAGGAGCCAATAAGG - Intergenic
900878772 1:5365640-5365662 TTCTGGGAATGCAGCCTAGTAGG + Intergenic
901290838 1:8123084-8123106 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
901495830 1:9621208-9621230 ATCTGGGAATGCAGCCAAGTAGG + Intergenic
901744003 1:11360640-11360662 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
901822744 1:11840568-11840590 CTCTAGGAAAGTAGCAAAGATGG - Exonic
902739110 1:18422246-18422268 TTCTGGGAATGCAGCCCAGTAGG - Intergenic
903877306 1:26484062-26484084 ATCTGGGAATGAAGTCCAGCAGG + Intergenic
904488822 1:30845490-30845512 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
904874512 1:33643880-33643902 GTCTGGGAATGAAGGAAGGAAGG + Intronic
905428473 1:37903132-37903154 CTCTGGGAATGCAGCCCAGCAGG - Intronic
905428918 1:37907545-37907567 GTCTGGGAATGCAGCCCAGCAGG - Intronic
905730936 1:40299312-40299334 CTCTGGGAATGCTGCAGAGAGGG + Intergenic
906140914 1:43532839-43532861 GTGTGGAAATGAAGGCAAGAGGG - Intronic
906546408 1:46622359-46622381 TCCTGGACATGAAGCCAAGATGG - Intergenic
907445188 1:54503073-54503095 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
907518493 1:55008240-55008262 ATCTTGGAAGGAAGCCAAGGGGG - Exonic
908132427 1:61087397-61087419 CTATGGGAATGAAACAAAAAGGG - Intronic
909607314 1:77520237-77520259 TTCTGGGAATGCAGCCCAGTAGG + Intronic
909825969 1:80127439-80127461 GTCTGTGAAAGCAGCCAAGAGGG - Intergenic
910796197 1:91100000-91100022 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
911189227 1:94931475-94931497 GTCTGGGAATGCAGCCTAGCAGG - Intergenic
911951292 1:104176936-104176958 GTCTGGGAATGTAGCCCAGTAGG - Intergenic
912385095 1:109267525-109267547 CTGGGGGAAGGAAGCCAAAAGGG - Intronic
912388777 1:109287047-109287069 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
912728692 1:112082018-112082040 CTTTGGGAAGGAAGCCGAGGCGG - Intergenic
912896228 1:113593147-113593169 CTTAGGAAATGAAGCCAATAAGG - Intronic
915039711 1:152958520-152958542 GTCTGGGAATGTAGCCCAGTAGG - Intergenic
915099708 1:153490391-153490413 CCCTGGGAAGGAAGCCCAGATGG - Intergenic
915320447 1:155053187-155053209 CTCTGGGCAGGAAGCCGAGAAGG + Intronic
915447729 1:155983615-155983637 CTCTGGGCCTAAAGCCAATAAGG + Intronic
915885914 1:159720813-159720835 CTATGGGAATGAGGCCAAGAAGG + Intergenic
915963249 1:160284404-160284426 CTCTGGGCAGGAAGTCAACAGGG + Intronic
916259910 1:162831453-162831475 ATCTGGGAATGCAGCCCAGTAGG - Intronic
916351512 1:163854527-163854549 CTAGGGGGATGGAGCCAAGATGG - Intergenic
916572252 1:166038110-166038132 TCCTGGGAATGAGGCCATGATGG + Intergenic
916814063 1:168333668-168333690 ATCTGGGAATGCAGCCTAGTAGG + Intergenic
917215768 1:172676549-172676571 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
917447560 1:175119499-175119521 ATCTGGGAATGCAGCCCAGTAGG + Intronic
917777957 1:178358605-178358627 CTCATGGAATGAAGATAAGATGG - Intronic
917883665 1:179363522-179363544 ATCTGGGAACGCAGCCAAGTAGG + Intergenic
917944484 1:179954954-179954976 CGCTGGGAAGGAAGACAAGGCGG - Exonic
918024333 1:180728026-180728048 ATCTGGGAATGCAGCCCAGTAGG + Intronic
918347844 1:183621927-183621949 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
918735272 1:188054039-188054061 CTCTGGAAATGAGGCTCAGAAGG + Intergenic
918743677 1:188170457-188170479 CTCTGGGAAACAAGGAAAGATGG + Intergenic
918826572 1:189331410-189331432 CTCGGGGGGTGGAGCCAAGATGG - Intergenic
919256211 1:195128393-195128415 GTCTGTGAAAGAAGACAAGAGGG - Intergenic
919323969 1:196081993-196082015 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
919827484 1:201513693-201513715 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
919969099 1:202560696-202560718 GTCTGGGAATGCAGCCCAGTAGG + Intronic
920113011 1:203600368-203600390 ATCTGGGAATGTAGCCCAGTAGG + Intergenic
920137131 1:203779079-203779101 TTCTGGGAATGCAGCCCAGCAGG - Intergenic
920535803 1:206735891-206735913 CGTTGGGCATGAGGCCAAGAAGG - Intergenic
921084645 1:211777795-211777817 ATCTGGGAATGCAGCCGAGTAGG - Intronic
921962837 1:221054085-221054107 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
922154834 1:223032652-223032674 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
922190847 1:223317066-223317088 ATCTGGGAATGCAGCCCAGTAGG - Intronic
922237435 1:223732666-223732688 GTCTGGGAATGCAGCCCAGTAGG + Intronic
922436190 1:225609119-225609141 CTCCAGGAAGCAAGCCAAGAAGG + Intronic
922600773 1:226851000-226851022 ATCTGGGAATGCAGCCTAGTAGG - Intergenic
922846082 1:228685291-228685313 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
923019519 1:230152145-230152167 GTCTGGGAATGCAGCCCAGTAGG + Intronic
923351088 1:233107813-233107835 GTCTGGGAATGCAGCCCAGTAGG - Intronic
923702572 1:236314274-236314296 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
924048238 1:240054278-240054300 CTCTGGGAATGCAGCGCAGGAGG - Intronic
924174792 1:241379653-241379675 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
924449176 1:244162373-244162395 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
924558362 1:245136635-245136657 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
924683924 1:246268115-246268137 GTCTGGGAATGCAGCCCAGTAGG - Intronic
924808134 1:247377987-247378009 ATCTAGGAATGCAGCCAAGTAGG + Intergenic
1063028222 10:2204347-2204369 ATCTGGGAATGCAGCCCAGCAGG - Intergenic
1063560584 10:7122729-7122751 CTATGCAAAGGAAGCCAAGAAGG + Intergenic
1064075509 10:12265506-12265528 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1064098693 10:12444234-12444256 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1064160454 10:12941029-12941051 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1064210126 10:13354586-13354608 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1064232100 10:13538107-13538129 GTCTGGGAATGCAGCCCAGCAGG - Intergenic
1064334593 10:14427284-14427306 ATCTGGGAATGCAGCCCAGCAGG - Intronic
1064570320 10:16685755-16685777 ATCTGGGAATGCAGCCCAGCAGG + Intronic
1064699893 10:18007909-18007931 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1064952762 10:20872595-20872617 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1064994277 10:21282729-21282751 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1065014734 10:21451594-21451616 CTCTGGGAATGCAGCCCAGTGGG + Intergenic
1065057467 10:21861523-21861545 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1065290326 10:24223177-24223199 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1065384754 10:25123909-25123931 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1065997529 10:31072836-31072858 CTGTGGCAGTGAATCCAAGAGGG + Intergenic
1066108924 10:32179445-32179467 ATCTGGGAATGCAGCCTAGTGGG + Intergenic
1066128049 10:32361798-32361820 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1066977185 10:42379687-42379709 CCCTTGGAATGTAGCCCAGAAGG + Intergenic
1067012677 10:42729108-42729130 CTTTGGGAAAGGAGCTAAGATGG + Intergenic
1067310912 10:45112760-45112782 CTTTGGGAAAGGAGCTAAGATGG - Intergenic
1067328408 10:45291854-45291876 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1067420446 10:46140877-46140899 CTCTGGGAATGAGGCTTTGAAGG - Intergenic
1067425575 10:46208656-46208678 CTCTGGGAATGAGGCTTTGAAGG + Intergenic
1067505790 10:46847358-46847380 CTCTGGGAATGAGGCTTTGAAGG - Intergenic
1067772055 10:49133743-49133765 CCCTGGGAAGGAAGCCCTGATGG - Intronic
1067842952 10:49696566-49696588 CTCTGGTCATGAAGCCAAGGAGG - Intronic
1068048323 10:51916146-51916168 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1068256158 10:54514985-54515007 CTTGGGGGATGGAGCCAAGATGG + Intronic
1068467505 10:57413694-57413716 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1069074280 10:64021529-64021551 CGCTGGGGGTGTAGCCAAGATGG - Intergenic
1069505437 10:68993310-68993332 CTCTGGGAATGCAGCAGAAAGGG - Intronic
1069785474 10:70985155-70985177 CGCTGGGAATGAAGCCCAGCAGG - Intergenic
1070663925 10:78330132-78330154 CTTTGGGAAAAAAGCCAGGAGGG - Intergenic
1070694570 10:78552343-78552365 CTCTGGGAAGGAAGCCACCAGGG - Intergenic
1070914072 10:80141676-80141698 TCCTGGAAATGAAGCCAAGGGGG - Intronic
1071216729 10:83412606-83412628 CTCCTGAAATGAAGCCATGAAGG - Intergenic
1071392020 10:85184772-85184794 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1072109914 10:92308478-92308500 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1072434532 10:95403190-95403212 ATCTGGGAATGAAGCCTACATGG - Intronic
1072547999 10:96455430-96455452 TTCTGGGAATGCAGCCCAGTAGG - Intronic
1072579785 10:96730756-96730778 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1072855002 10:98937091-98937113 CTGTGACAATGGAGCCAAGATGG + Intronic
1073489716 10:103844931-103844953 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1073879496 10:107964221-107964243 ATCTGGGAATGATGAAAAGATGG - Intergenic
1073990497 10:109257221-109257243 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1074298741 10:112214175-112214197 CACTGGGAATTAAGACAACACGG + Intronic
1075104072 10:119525532-119525554 CACTGGGAATGAAGGCAAAGAGG + Intronic
1075466216 10:122652654-122652676 CTCTGGGACTGCAGTCAAGCTGG + Intergenic
1075784274 10:125038286-125038308 CTCTCGGAGGGAAGCGAAGATGG - Intronic
1075888920 10:125928515-125928537 CTCTGGGAATGCAGCCCAGTAGG + Intronic
1075977524 10:126708536-126708558 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1076001603 10:126917477-126917499 ATCTGGGAATGAGGCCAGGATGG - Intronic
1077874017 11:6288269-6288291 GTCTGGGAATGCAGCCTAGCAGG - Intergenic
1078476383 11:11633666-11633688 GAGTGGGAATGAACCCAAGATGG - Intergenic
1078561899 11:12379293-12379315 TTCTGGGAATGCAGCCCAGTAGG + Intronic
1078841498 11:15079782-15079804 CTATGGGAATAAAGAGAAGAAGG + Intronic
1079412254 11:20200564-20200586 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1079412896 11:20206780-20206802 ATCTGGGAATGCAGCCTAGTAGG - Intergenic
1079427698 11:20359315-20359337 CTCTGGGAATGAAGCCGGGTGGG - Intergenic
1079641058 11:22806096-22806118 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1079717510 11:23766772-23766794 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1080288092 11:30640020-30640042 CTCTGGGAATGCAGCCCAGTAGG - Intergenic
1080352774 11:31404241-31404263 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1081234961 11:40636175-40636197 TTGTGTGAATGAAGCCAAGGAGG + Intronic
1081351907 11:42064412-42064434 CTCTGGGAATGCAGCCCAGCAGG - Intergenic
1082273774 11:50199892-50199914 TTATGGGTATGGAGCCAAGATGG - Intergenic
1082867304 11:57911639-57911661 CTCTGGGAATGCAGCCCAGTAGG + Intergenic
1083283161 11:61639977-61639999 TCCTGGGAATGAAGCCCAGTGGG - Intergenic
1083910974 11:65709730-65709752 GTCTGGGAATGCAGCCTAGTAGG - Intergenic
1084193670 11:67510979-67511001 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1084201764 11:67563832-67563854 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1084353179 11:68618366-68618388 CTCTGGGAAATAAGGCACGACGG - Intergenic
1085182779 11:74550025-74550047 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1085238090 11:75030684-75030706 CCCTGGTAATGAAATCAAGAAGG - Intergenic
1085241434 11:75059642-75059664 ATCTGAGAATGAAACCAATATGG - Intergenic
1085974282 11:81634247-81634269 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1085974879 11:81640574-81640596 CTCTGGGAATGCAGCCCAGTAGG - Intergenic
1086453226 11:86937430-86937452 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1086572781 11:88304590-88304612 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1086906010 11:92418660-92418682 CTCTGGGGACCATGCCAAGAGGG + Intronic
1087082492 11:94185312-94185334 TTGTGGAAATGAAACCAAGATGG - Intergenic
1087304677 11:96474468-96474490 ATCTGGGAATGCAGCCCAGCAGG - Intronic
1087531398 11:99386662-99386684 ATCTGGGAATGCAGCCCAGTGGG + Intronic
1087991367 11:104747982-104748004 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1088486806 11:110348572-110348594 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1088767844 11:113001915-113001937 GCCTGGGAATGAAGCCAACGTGG - Intronic
1088851696 11:113708551-113708573 CTCTGGGAATGAGGCTTTGAAGG - Intergenic
1089312899 11:117571756-117571778 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1089385209 11:118062827-118062849 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1089883459 11:121796874-121796896 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1090694492 11:129224656-129224678 CTCTGGGAATGAGGCTTTGAAGG - Intronic
1090750173 11:129739716-129739738 CTCTGGGGAAGAAAACAAGAAGG - Intergenic
1091856368 12:3743759-3743781 CTCTGGGAATGAAGTCAGCTGGG - Intronic
1092354916 12:7786803-7786825 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1092367624 12:7890131-7890153 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1093735239 12:22613645-22613667 ATCTGGGAATGCAGCCTAGCAGG - Intergenic
1094146203 12:27230908-27230930 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1095217809 12:39569756-39569778 CTGGGGGAGTGGAGCCAAGAGGG - Intronic
1095602358 12:44028399-44028421 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1096337247 12:50765616-50765638 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1096642334 12:53004429-53004451 TTCTGGGAATGCAGCCCAGTAGG + Intergenic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1098228851 12:68352265-68352287 TCCTGGGAATGGAGCCAAGTCGG - Intergenic
1098316046 12:69194275-69194297 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1098535625 12:71591127-71591149 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1098842010 12:75488187-75488209 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1099172062 12:79376600-79376622 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1099189348 12:79546768-79546790 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1099371418 12:81835415-81835437 GCCTGGGAAAGCAGCCAAGAGGG + Intergenic
1100829943 12:98508609-98508631 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1101816998 12:108152853-108152875 CTTTGGGAGAGAAGCCAAGGTGG + Intronic
1101921209 12:108934564-108934586 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1102100107 12:110271777-110271799 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1102220085 12:111188436-111188458 CTCTGTGAAGGAAGCCACCAGGG + Intronic
1102498594 12:113336034-113336056 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1102536350 12:113584240-113584262 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1102599733 12:114020707-114020729 CTCTGGGAACAGAGACAAGAAGG + Intergenic
1102637168 12:114334485-114334507 CTCTGGGGAGGAACCCAAAAGGG + Intergenic
1102727992 12:115082380-115082402 CTCTTTGAAGGAAGCAAAGATGG - Intergenic
1102872999 12:116428421-116428443 GTCTGGGAATGTAGCCCAGTAGG - Intergenic
1103056092 12:117821898-117821920 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1103163326 12:118749330-118749352 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1103175116 12:118856347-118856369 CTATGGAAAAGAAGACAAGAAGG - Intergenic
1103245904 12:119456951-119456973 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1103456584 12:121071693-121071715 CTCTGGGAATGAGGCTTTGAGGG - Intergenic
1103962269 12:124616513-124616535 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1103964633 12:124630970-124630992 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1104127765 12:125863646-125863668 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1104361715 12:128139267-128139289 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1104371067 12:128224390-128224412 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1104572607 12:129938315-129938337 CCCTGGGAAGGAAGCAAAGAGGG - Intergenic
1104671482 12:130683534-130683556 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1104905132 12:132209133-132209155 ATCTGGGAATGCAGCCCAGTGGG - Intronic
1105778163 13:23681836-23681858 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1105778581 13:23686118-23686140 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1105886196 13:24644238-24644260 GTCTGGGAATCCAGCCAAGTAGG - Intergenic
1105937548 13:25116229-25116251 TTCTGGGAATGCAGCCCAGCAGG - Intergenic
1106331819 13:28746376-28746398 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1106386162 13:29288225-29288247 CTCTGGGAATGGAGGCAATGGGG + Intronic
1106397950 13:29399378-29399400 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1106559103 13:30833430-30833452 CTCTGGGAAGGAAGGAAAAAAGG - Intergenic
1106876268 13:34077226-34077248 CTCTGAGCATTAATCCAAGAAGG - Intergenic
1106927660 13:34630429-34630451 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1107020299 13:35744296-35744318 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1107104273 13:36626594-36626616 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1107127299 13:36859378-36859400 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1107465936 13:40650377-40650399 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1107693963 13:42982075-42982097 GTCTGGGAATGCAGCCCAGCAGG - Intronic
1108507724 13:51127876-51127898 CTCTGGGAATGCAGCCCATTAGG - Intergenic
1108528333 13:51304604-51304626 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1108737867 13:53304579-53304601 CCCTGGGAGGGAAGCAAAGATGG - Intergenic
1108844723 13:54663492-54663514 ATCTGGGAATGCAGCCTAGTAGG + Intergenic
1109121282 13:58461351-58461373 TCCTGGTAATGAAGCCAAGAAGG + Intergenic
1109162415 13:58992018-58992040 ATCTGGGAATGCAGCCCAGCAGG + Intergenic
1109704694 13:66074357-66074379 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1110211452 13:72978583-72978605 TTCTGGCAATGAAGACAAAAAGG - Intronic
1110684619 13:78357638-78357660 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1110949378 13:81465182-81465204 CTCTGGGCGAGGAGCCAAGATGG - Intergenic
1111233517 13:85376923-85376945 GTCTGGGAATGAAGTAAACAAGG - Intergenic
1111756200 13:92398835-92398857 TTCTGGGTATGTAGTCAAGAAGG - Intronic
1112434690 13:99383603-99383625 CCCTGGCTAGGAAGCCAAGAAGG - Intronic
1112585941 13:100718782-100718804 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1112938838 13:104835254-104835276 CTCTGGGGATCAAGACAGGATGG - Intergenic
1113480123 13:110614710-110614732 CCCTGGGAATGCAGCCCAGTAGG + Intergenic
1114583783 14:23790677-23790699 GTCTGGGAATGCAGCCCAGTTGG + Intergenic
1114773923 14:25459859-25459881 TTCTGGGAATGAAGCCCAGTAGG + Intergenic
1114946699 14:27690568-27690590 GTCTGGGAATGCAGCCCAGTGGG + Intergenic
1115239743 14:31242656-31242678 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1115556648 14:34549550-34549572 CTCTGGGAATTTAGCCTAGGTGG + Intergenic
1115917459 14:38331639-38331661 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1116120985 14:40722319-40722341 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1117956093 14:61124751-61124773 ATCTGGGAATGCAGCCCAGGAGG - Intergenic
1118266321 14:64297832-64297854 CTCTGAGCTTGAAGCCAAGTAGG + Intronic
1118304020 14:64639562-64639584 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1118304531 14:64644768-64644790 TTCTGGGAATGCAGCCTAGTAGG - Intergenic
1118406802 14:65432559-65432581 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1119000344 14:70876139-70876161 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1119034718 14:71219832-71219854 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1119102916 14:71896586-71896608 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1119109191 14:71955799-71955821 CTCTGGGAATGCAGCCCAGTAGG + Intronic
1119540785 14:75436885-75436907 CTCTGAGAATGAAGAGAACATGG + Intronic
1119578540 14:75752212-75752234 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1119720049 14:76884444-76884466 GTCTGGGAATGCAGCCTAGTAGG + Intergenic
1120044351 14:79789842-79789864 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1120884016 14:89437538-89437560 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1121194058 14:92054277-92054299 ATCTGGGAATGCAGCCCAGTAGG - Exonic
1121194387 14:92056846-92056868 ATCTGGGAATGCAGCCTAGTAGG - Exonic
1121705908 14:95993537-95993559 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1122174432 14:99906657-99906679 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1122689305 14:103524092-103524114 CTCTGTGAATAAAGCAAAGAAGG + Intergenic
1122949317 14:105032518-105032540 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1123112622 14:105880334-105880356 CTCTGGGGATGCAGCCACCATGG - Intergenic
1123119212 14:105909148-105909170 CTCTAGGAATGCAGCCACCACGG - Intergenic
1123865672 15:24517430-24517452 CTTTGAGATTAAAGCCAAGATGG + Intergenic
1123899297 15:24860037-24860059 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1123910746 15:24964539-24964561 CTTTGGGAAAGAAACCAAGGCGG - Intronic
1124387427 15:29222067-29222089 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1124613448 15:31224613-31224635 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1124718710 15:32093283-32093305 CTTGGGGAATGAAGCCTGGAAGG - Intronic
1124720788 15:32109442-32109464 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1125253055 15:37728520-37728542 CAGTGGGAATTAAGCCAAGTGGG - Intergenic
1125407866 15:39371639-39371661 TTCTGGGAATGAATTCAAGCTGG - Intergenic
1125754911 15:42057051-42057073 CTCTGGGAATGAAACCGGGAGGG - Intergenic
1126478679 15:49093927-49093949 GTCTGGGTATGATCCCAAGAAGG - Intergenic
1127162428 15:56203529-56203551 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1127344562 15:58081155-58081177 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1127506505 15:59603134-59603156 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1127888618 15:63227164-63227186 ATCTGGGAATGCAGCCCAGTGGG + Intronic
1127949802 15:63793860-63793882 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1128728497 15:70005169-70005191 CCCTGGGAATGGGGCTAAGAGGG + Intergenic
1128733127 15:70034266-70034288 CTCTGGGAATGGTGCAGAGAGGG + Intergenic
1130074225 15:80674865-80674887 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1130681943 15:86004749-86004771 CTCTGTAACTGAAGCTAAGATGG + Intergenic
1131359223 15:91774722-91774744 CTCTGGGTATGAAGTCCAGTGGG + Intergenic
1132140657 15:99390874-99390896 CTCTGGGAATGAGGCTTTGAAGG - Intergenic
1133493154 16:6291248-6291270 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1133493814 16:6297274-6297296 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1133498262 16:6340776-6340798 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1133570698 16:7037196-7037218 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1133625737 16:7568922-7568944 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1133652150 16:7822572-7822594 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1133825040 16:9270738-9270760 CTTTGCCAAAGAAGCCAAGAAGG - Intergenic
1133962312 16:10505258-10505280 GTCTGTGAATGCAGCCCAGAAGG - Intergenic
1134012667 16:10866813-10866835 CTCAGGGAGTGAACCCAAGCAGG - Intergenic
1134013401 16:10871698-10871720 CTCAGGAAAGGAAGCCCAGAAGG - Intergenic
1134328777 16:13231060-13231082 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1134691422 16:16193035-16193057 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1135169756 16:20173423-20173445 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1135308736 16:21389039-21389061 TCCTGGGAATGCAGCCAAGCAGG + Intergenic
1135779058 16:25283059-25283081 GTCTGGGAATGCAGCCCAGTTGG - Intergenic
1135820372 16:25679942-25679964 TCCTGGGAATGAAGCCCAGTAGG + Intergenic
1135903279 16:26486743-26486765 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1136148318 16:28329343-28329365 TCCTGGGAATGCAGCCAAGCAGG + Intergenic
1136305479 16:29368170-29368192 TCCTGGGAATGCAGCCAAGCAGG + Intergenic
1137074325 16:35943701-35943723 TTCTGGGGATAGAGCCAAGATGG + Intergenic
1137263522 16:46850268-46850290 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1137581842 16:49638371-49638393 GTCGGAGAAGGAAGCCAAGAAGG - Exonic
1137721755 16:50631638-50631660 GTGTGGGAAGGAAGCCAGGAGGG + Intronic
1137745300 16:50816114-50816136 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1137853309 16:51767918-51767940 AGCTGGGAATGAAGGCCAGAAGG - Intergenic
1138165187 16:54794709-54794731 ATCTGGGAATGTAGCCCAGTAGG + Intergenic
1138787332 16:59863238-59863260 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1138815936 16:60202764-60202786 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1138851622 16:60636284-60636306 ATCTGGGAATGCAGCCCAGCAGG - Intergenic
1138944185 16:61828000-61828022 GTCTGGGAATGCAGCTCAGAAGG - Intronic
1139759457 16:69172771-69172793 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1140016935 16:71196626-71196648 GGCTGGGAATGAAGCCTAGGAGG - Intronic
1140335150 16:74098032-74098054 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1140399265 16:74657149-74657171 CTCTGGGAATGAGGCTTTGAAGG + Intronic
1141268344 16:82516995-82517017 CTCTGTGGAATAAGCCAAGATGG - Intergenic
1141403161 16:83768932-83768954 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1141752875 16:85970851-85970873 GTCTGGGAATGTAGCCCAGCAGG - Intergenic
1141917614 16:87110594-87110616 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1141918038 16:87113700-87113722 ATCTGGGAATGAAGCCCAGCAGG + Intronic
1141950675 16:87337331-87337353 CTCTTGGAATGAGGCCAAGATGG - Intronic
1142320148 16:89376831-89376853 CACTGGGATAGAAGGCAAGAAGG + Intronic
1142514231 17:416490-416512 TTCTGGGAAAGTAGCTAAGATGG + Intronic
1142780499 17:2177758-2177780 ATCTGGAAATACAGCCAAGATGG + Intronic
1142995208 17:3755968-3755990 TTCTGGGAGTGAGGCCAAGCTGG - Intronic
1143764513 17:9128744-9128766 CCCTGAGAATGGAGCCAGGAGGG - Intronic
1144016197 17:11198815-11198837 CTCTGGGAATGCAGCCCAGTAGG - Intergenic
1144060009 17:11574878-11574900 TCCTGGGAATGCAGCCCAGAAGG - Intergenic
1144098462 17:11922994-11923016 CTTTGGGAATTAAGTGAAGAGGG + Intronic
1144473066 17:15561793-15561815 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1144637796 17:16921649-16921671 GTCTGGGAATGCAGCCTAGTAGG - Intergenic
1144846612 17:18223335-18223357 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1144875781 17:18396457-18396479 CTTTGGGAAGGAAGGAAAGAAGG - Intergenic
1144923416 17:18782927-18782949 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1145156447 17:20547964-20547986 CTTTGGGAAGGAAGGAAAGAAGG + Intergenic
1146694841 17:34900854-34900876 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1148385462 17:47231289-47231311 CTGTGAGAACAAAGCCAAGAAGG + Intergenic
1148652885 17:49262226-49262248 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1148814786 17:50319770-50319792 GTCTGGGAATGCAGCCCAGTGGG + Intergenic
1149207625 17:54266594-54266616 GTCTGGGAGTGAAGGGAAGAAGG + Intergenic
1149378580 17:56070150-56070172 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1149484102 17:57028519-57028541 TCCTGGGAATGCAGCCCAGAAGG + Intergenic
1150004920 17:61463545-61463567 CTGTGGAAATGAAGCCCAGCAGG + Intronic
1150132534 17:62677116-62677138 CTCTGGGGTTGGAGCCAGGAGGG - Intronic
1150169756 17:62980944-62980966 CTCAGGGAGAGAAGTCAAGAGGG - Intergenic
1150348729 17:64424921-64424943 CTCTGGGAGTGCAGCCCAGCAGG + Intergenic
1150844227 17:68638790-68638812 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1151572445 17:74933610-74933632 CTCTGGGAATGAATCCCAGCTGG + Exonic
1151997050 17:77616539-77616561 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1152296804 17:79472139-79472161 CTCTGGGATGGAGGCCAAGTGGG - Intronic
1152764621 17:82129296-82129318 CTGTGGAAAGGAAGCCAAAAGGG + Intronic
1152997166 18:418502-418524 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1153113234 18:1619671-1619693 CTCTGAGAATGCAGCCCAGTAGG + Intergenic
1153437421 18:5082612-5082634 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1153583250 18:6596663-6596685 CTCAGTGAATGAAACCAAGGAGG + Intergenic
1154185756 18:12181634-12181656 CTCTGGGGGAGAAGCCAAGATGG + Intergenic
1155098041 18:22579117-22579139 TTCTGTGAATGAAGTGAAGAGGG + Intergenic
1155157375 18:23168933-23168955 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1155286833 18:24297946-24297968 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1157127428 18:44970149-44970171 CTCAGGGACTCAAGCCAAAAAGG + Intronic
1157866337 18:51188622-51188644 TGCTGGGAATAAAGGCAAGAGGG + Intronic
1158722271 18:59935995-59936017 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1158733314 18:60050555-60050577 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1159336069 18:67068215-67068237 TTCTAGGAAAGATGCCAAGAAGG + Intergenic
1160102591 18:75936975-75936997 ATCTGGGAATGCAGCCCAGCAGG + Intergenic
1161640469 19:5419422-5419444 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1161814672 19:6492654-6492676 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1162141788 19:8589647-8589669 CTGGGGGAGTGAGGCCAAGAGGG + Intronic
1163357443 19:16823318-16823340 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1163434453 19:17286926-17286948 ATCTGGGAATGCAGCCCAGTAGG - Exonic
1163473592 19:17512092-17512114 CACTGGGTATCATGCCAAGAGGG + Intronic
1164469982 19:28522159-28522181 ATCTGGGAATGAAGCCCAGTAGG - Intergenic
1164470678 19:28528716-28528738 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1164687534 19:30177701-30177723 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1164843431 19:31411997-31412019 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1164915616 19:32050107-32050129 GTCTGGGAATGCAGCCCAGTGGG - Intergenic
1165122490 19:33569451-33569473 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1165131800 19:33637270-33637292 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1165146433 19:33734031-33734053 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1165447946 19:35866942-35866964 CAATGGAAATGCAGCCAAGATGG + Exonic
1165572440 19:36786627-36786649 CTTTGGTAATTAAGCCAAAAAGG + Intergenic
1165792095 19:38498894-38498916 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1166321250 19:42020523-42020545 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1166401878 19:42487624-42487646 ATCTGGGAATGCAGCCCAGCAGG + Intergenic
1166477040 19:43135639-43135661 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1166620543 19:44295875-44295897 CTCAGGTAATGAACTCAAGATGG - Intronic
1167730448 19:51250487-51250509 CTCTGGGAATGCAGCCCAGCAGG + Intronic
1167806145 19:51787184-51787206 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1168323787 19:55526448-55526470 CTCTGGGCCTGAGGCCAAGGAGG + Intergenic
1168382704 19:55937857-55937879 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1168549129 19:57278754-57278776 GTCTGGGAATGCAGCCTAGTAGG + Intergenic
924984130 2:253269-253291 TTCTGGGAATGCAGCCCAGTAGG - Intronic
925892612 2:8448049-8448071 TTCTGGGAATGCAGCCCAGCAGG - Intergenic
926340425 2:11900581-11900603 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
926959734 2:18343079-18343101 GCCTGGGAATGAAGCCCAGCAGG - Intronic
927686609 2:25175467-25175489 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
927970295 2:27301740-27301762 ATCTGGGAATGCAGCCCAGTAGG + Intronic
928237234 2:29554724-29554746 GTCTGGGAATGCAGCCCAGTAGG - Intronic
928439733 2:31282284-31282306 GTCTGGGAATGTAGCCCAGTAGG - Intergenic
928683966 2:33728768-33728790 CTCTTGGAATGCAGCCCAGTAGG - Intergenic
928700541 2:33894674-33894696 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
928724812 2:34160106-34160128 TTCTGGGAATGAGGCCAAATGGG + Intergenic
928837929 2:35569187-35569209 CTCGGGGGGTGGAGCCAAGATGG - Intergenic
929045494 2:37785045-37785067 CACTGGGACTGAACCTAAGAAGG + Intergenic
929221396 2:39468245-39468267 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
929551030 2:42892053-42892075 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
930150202 2:48051502-48051524 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
930157361 2:48119166-48119188 CTCTGGGAATGCAGCCCAGTAGG - Intergenic
930404866 2:50942255-50942277 CTGTGGGAATGGAGCCCACATGG + Intronic
930414826 2:51078144-51078166 ATCTGGCAATGCAGCCCAGAGGG - Intergenic
930434503 2:51323354-51323376 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
930576709 2:53159383-53159405 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
931249382 2:60516487-60516509 CACTGGGAGAGGAGCCAAGAGGG + Intronic
932005332 2:67921775-67921797 CTCTAGAACTAAAGCCAAGATGG + Intergenic
932249346 2:70228757-70228779 ATCTGGGTATGAAGCCCAAATGG + Intronic
932494756 2:72140795-72140817 TTCTGGGCCTGAAGCCAAGGTGG - Intronic
932860781 2:75289170-75289192 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
933473811 2:82763715-82763737 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
933614570 2:84470708-84470730 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
933721602 2:85400801-85400823 CTCTGGGGAGGCAGCCAAGATGG - Intronic
934888555 2:98046221-98046243 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
934889376 2:98053495-98053517 CTCTAGGAATGCAGCCCAGTAGG - Intergenic
935095463 2:99940367-99940389 ATCTGGGAATGCAGCCCAGTAGG - Intronic
935103838 2:100021100-100021122 GTCTGGGAATGTTCCCAAGAGGG - Intronic
935637004 2:105256754-105256776 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
935661134 2:105467891-105467913 TTCTGGGAATGCAGCCCAGTAGG - Intergenic
935743043 2:106167798-106167820 GTCTGGGAATGTAGCCCAGTAGG - Intronic
935783738 2:106530678-106530700 ATCTGGGAATGCAGCCTAGCAGG - Intergenic
936963110 2:118097813-118097835 CTCTTGGATGGAAGCCAAGAAGG - Intronic
937611804 2:123870737-123870759 CACTGGAAATGAAGCCACGTAGG - Intergenic
937996467 2:127698271-127698293 CACTGTGAATGGAGCCCAGAAGG + Intergenic
938208254 2:129442069-129442091 CTCTGGAGATGATCCCAAGAGGG + Intergenic
938781832 2:134591510-134591532 ATCTGGGAATGCAGCCCAGTAGG + Intronic
938958842 2:136322865-136322887 CTCTGGGAATAAAGTCAAAGGGG - Intergenic
939843994 2:147221449-147221471 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
940209848 2:151245121-151245143 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
940313484 2:152303832-152303854 TCCTGGGAATGCAGCCAAGTAGG - Intergenic
941235922 2:162973807-162973829 CACTGGGAAGGAAGGAAAGAAGG + Intergenic
941395046 2:164963893-164963915 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
941868971 2:170363779-170363801 CTCTGGAAATAAGGCCATGATGG - Intronic
942062116 2:172236928-172236950 ATCTGGGAATGCAGCCCAGCAGG + Intergenic
942194302 2:173502481-173502503 GTCTGGGAATGCAGCCCAGCAGG - Intergenic
942194619 2:173505195-173505217 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
942588996 2:177520210-177520232 CTCTGGGAATGCAGCCCAGTAGG + Intronic
942615263 2:177785392-177785414 TTCTGGGAGGGCAGCCAAGATGG + Intronic
942870242 2:180725925-180725947 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
943077054 2:183208501-183208523 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
943466975 2:188240133-188240155 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
943760190 2:191599706-191599728 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
943836496 2:192520818-192520840 TTCTAGGAATCAAGGCAAGAAGG - Intergenic
943895139 2:193347857-193347879 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
943895780 2:193357827-193357849 CTATGGGAATGAACCCAAGGAGG - Intergenic
943960501 2:194256620-194256642 CTCTGGGCATAAAGACATGAAGG + Intergenic
943991899 2:194706414-194706436 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
944198982 2:197085420-197085442 ATCTGGGAATGCAGCCCAGTAGG - Intronic
944476072 2:200107983-200108005 TTCTGGGAATGAAGCTCAGCAGG + Intergenic
944714175 2:202362337-202362359 GTCTGGGAATGCAGCCCAGCAGG + Intergenic
945168700 2:206973390-206973412 TTCTGGGAATGCAGCCCAGTAGG + Intergenic
945559554 2:211321923-211321945 CTCTGCAAATGAAGGCAACAGGG - Intergenic
945937350 2:215916408-215916430 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
945986990 2:216362937-216362959 TGCTGGGAAGGAAGCCAAGTTGG - Intronic
946114463 2:217449194-217449216 CTCTGGCAATGCAGCCCAGTGGG + Intronic
946461885 2:219876169-219876191 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
946730546 2:222705331-222705353 ATCTGGGAATGCAGCCCAGTAGG + Intronic
946845403 2:223854437-223854459 TTCTGGGAATGCAGCCCAGGAGG - Intergenic
947088640 2:226484825-226484847 ATCTGGGAATGAAGCCCAATAGG - Intergenic
947184850 2:227445718-227445740 CTCTGGGAATGCAGCCCAGCAGG + Intergenic
947343423 2:229164669-229164691 CCCTGGGTATGAAGCAATGAAGG + Intronic
947498324 2:230654927-230654949 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
948019982 2:234724145-234724167 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
948094351 2:235321618-235321640 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
948109555 2:235443777-235443799 CTCTGGGAATGCAGCCCAGTAGG - Intergenic
948308408 2:236967412-236967434 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1168880469 20:1202245-1202267 ATCTGGGAATGCAGCCCAGTGGG - Intergenic
1169441177 20:5635147-5635169 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1170063708 20:12287773-12287795 TTCTGGGAATGCAGCCCAGCAGG - Intergenic
1170273642 20:14556984-14557006 CTATGGTAATGAAGACAACATGG + Intronic
1170635016 20:18096669-18096691 GTCTGGGAATGCAGCCCAGGAGG - Intergenic
1172362235 20:34321269-34321291 ATCTGGGAATGCAGCCCAGCAGG - Intergenic
1173661314 20:44735919-44735941 ATCTGAGAATGAAGCCCAGCAGG + Intergenic
1173752690 20:45489373-45489395 CTCTGGGAATGTAGCCAAGCAGG + Intergenic
1174122598 20:48277428-48277450 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1174292860 20:49521340-49521362 TTTTGGGAGTGGAGCCAAGAGGG - Intronic
1174899139 20:54480214-54480236 GTCTGGGAATGTAGCCCAGTAGG - Intronic
1174916733 20:54661357-54661379 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1175027577 20:55918866-55918888 CTCTGGCAATGCAGCCCAGTAGG - Intergenic
1175059431 20:56228337-56228359 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1175097348 20:56552089-56552111 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1175136952 20:56831350-56831372 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1175137162 20:56832873-56832895 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1175144380 20:56884747-56884769 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1175181500 20:57151322-57151344 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1175918951 20:62441079-62441101 CTCTGGGAGGGAAGCCATGGAGG + Intergenic
1177291487 21:19119261-19119283 TTCTGGGAATGCAGCCAAGTGGG - Intergenic
1177684180 21:24416167-24416189 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1177806306 21:25878421-25878443 CTCTGGGAATGCAGCCCAGTAGG - Intergenic
1178043996 21:28673973-28673995 CTCAGGGAATGCAGCCCAGTAGG - Intergenic
1178112995 21:29387737-29387759 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1178155026 21:29842869-29842891 CTCTGGAAAGGAAGCCTATAGGG - Intronic
1178179498 21:30143842-30143864 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1178469831 21:32882650-32882672 TCCTGGGAATGCAGCCCAGAAGG + Intergenic
1178479156 21:32964105-32964127 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1178514485 21:33235263-33235285 CCCTGGGAATGCAGCCCAGCAGG + Intronic
1178516686 21:33253956-33253978 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1178597302 21:33966458-33966480 CTCTGGGCATCAAGCCAGGGAGG - Intergenic
1179089864 21:38255229-38255251 CTCAGTGAATGAAGGCCAGAGGG + Intronic
1179098326 21:38335231-38335253 CACTTGGAATGGAGCCATGAGGG + Intergenic
1179444549 21:41422071-41422093 GTCTGGGAATGCAGCCCAGTAGG - Exonic
1179579571 21:42332613-42332635 CTCTGGGCATGAAACCTCGAGGG - Intergenic
1179673856 21:42968515-42968537 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1179796056 21:43784376-43784398 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1179902632 21:44401939-44401961 CTATGAGAATGCAGCCAAGTGGG - Intronic
1182521492 22:30887285-30887307 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1182558954 22:31143915-31143937 ATCTGGGGAGGAAGCCCAGAAGG + Intergenic
1182943935 22:34304810-34304832 GTCTGGGAATGTAGCCCAGTAGG - Intergenic
1183207122 22:36427024-36427046 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1184161273 22:42698722-42698744 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1184338316 22:43869141-43869163 CCCTGGGAATGCAGCCCAGTAGG - Intergenic
1184345912 22:43912634-43912656 ATCTGGGAATGCAGCCCAGGAGG - Intergenic
1185406303 22:50653703-50653725 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
949113155 3:287064-287086 TTCTGGGAATGCAGCCCAGTAGG + Intronic
949247172 3:1938908-1938930 GACTGGGAGAGAAGCCAAGAGGG + Intergenic
949275143 3:2270547-2270569 CTCTGAGAATGAAGGAAAGTAGG - Intronic
949405166 3:3706352-3706374 ATCTGGGAATGCAGCCCAGTAGG + Intronic
949676464 3:6459945-6459967 CACTGGGAATAGGGCCAAGAGGG + Intergenic
950117367 3:10460109-10460131 CTCTGGGAATGAAGTGCTGATGG + Intronic
950314796 3:11991803-11991825 CTCTGGGAATGCAGAGAAGGGGG + Intergenic
950511863 3:13434146-13434168 ATCTGGGAATGCAGCCTAGTGGG + Intergenic
950837701 3:15936351-15936373 ATCTGGGGATGAAGCCAAGGAGG - Intergenic
950965500 3:17143111-17143133 CTGTGGGAGAGAATCCAAGAAGG + Intergenic
951143906 3:19202759-19202781 CTCTGTTATTGAAGCCAAAAGGG - Intronic
951350347 3:21599879-21599901 ATCTGGGAATGCAGCCCAGTAGG - Intronic
952123441 3:30271957-30271979 AACTGGGATTCAAGCCAAGATGG + Intergenic
952123623 3:30274675-30274697 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
952124217 3:30280603-30280625 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
952295292 3:32056804-32056826 TTCTGGGAATGCAGCCCAGTAGG - Intronic
952363848 3:32657594-32657616 GCCTGAGAATGAAGCCAACAGGG + Intergenic
952546257 3:34422684-34422706 CACTGGGAATGAAGCCGAAGTGG + Intergenic
952548768 3:34451106-34451128 GTCTGGGGAGGGAGCCAAGATGG - Intergenic
952666185 3:35907029-35907051 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
953247534 3:41208654-41208676 CACTGGGCATGAAGCCAGGGAGG - Intronic
953320387 3:41966170-41966192 ACCTGGGAATGCAGCCCAGAAGG - Intergenic
953416442 3:42722416-42722438 ATCTGGGAATGCAGCCCAGTAGG - Intronic
953427610 3:42808093-42808115 GTCTGGGAATGTAGCCCAGTAGG + Intronic
953609689 3:44437361-44437383 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
954333024 3:49900919-49900941 CTCTGGGCATGCAGCCACTAGGG - Intronic
954370201 3:50166149-50166171 GTCCGGGTAGGAAGCCAAGAGGG - Intronic
954715017 3:52522648-52522670 CTGAGGGAATGAAGCAAGGACGG - Exonic
954748727 3:52802020-52802042 CTGTTGGAATGAAAGCAAGAAGG - Intronic
955209131 3:56924839-56924861 GTCTGGGAATGCAGCCCAGTAGG + Intronic
955454576 3:59105684-59105706 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
955515897 3:59726098-59726120 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
955694032 3:61617639-61617661 CTCTGGCAAGGAAGGCAAGAGGG - Intronic
955889144 3:63632028-63632050 CTCTGGTAATGAAGATAGGAAGG + Intergenic
956546627 3:70410186-70410208 GTCTGGGAAGGAAGGCAACATGG - Intergenic
956584452 3:70849603-70849625 CTCTAGGAAGCAAGCAAAGAAGG - Intergenic
956634587 3:71351151-71351173 CTCCGTGAATGAATCCAACAGGG + Intronic
956686778 3:71836586-71836608 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
956890948 3:73613618-73613640 CTCTGTGAAAGCTGCCAAGAAGG - Intronic
957416267 3:79909501-79909523 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
957539149 3:81546445-81546467 ATCTGGGAATGCAGCCCAGTAGG - Intronic
957539567 3:81550541-81550563 ATCTGGGAATGCAGCCCAGTAGG - Intronic
958156508 3:89762067-89762089 GTCTGGGGGTGAAGCCGAGAGGG + Intergenic
958790919 3:98650119-98650141 CTAAGGGAAAGAAGCCAAGATGG - Intergenic
959811908 3:110629456-110629478 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
959872669 3:111346380-111346402 TTCTGGGAATGCAGCCCAGTCGG + Intronic
960040968 3:113149525-113149547 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
960183627 3:114612115-114612137 CTTTTGGAAAGAAGCAAAGATGG - Intronic
961045959 3:123708176-123708198 CTCTGAGAATGTATCCGAGATGG - Intronic
961332884 3:126153443-126153465 CTTTGGGAATGATGACAAAATGG - Exonic
961414517 3:126747752-126747774 CTCTGGAAATGAAGGGAAGGAGG - Intronic
961511001 3:127403524-127403546 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
962735652 3:138323075-138323097 GCCTGGGACTGAGGCCAAGAGGG - Intronic
962749825 3:138425666-138425688 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
962795592 3:138847051-138847073 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
963267686 3:143255223-143255245 TTTTGAGAATGAAGCCAAAATGG + Intergenic
963294736 3:143533327-143533349 ATCTGGGAATTAAGGCAAGTAGG - Intronic
963547016 3:146672176-146672198 GTCTGGGAGTGAAGCAAAGAGGG + Intergenic
963672534 3:148270029-148270051 TGCTGGGAATGGATCCAAGATGG + Intergenic
963972900 3:151448990-151449012 GTCTGGAAATGAAGCTAACATGG - Exonic
964950749 3:162289662-162289684 CTCTGGGAATGTAAACAAGGAGG - Intergenic
965586265 3:170320738-170320760 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
965588950 3:170344106-170344128 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
966034911 3:175399764-175399786 GTCTGGGAATGCAGCCCAGAAGG + Intronic
966489334 3:180509770-180509792 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
966878516 3:184336802-184336824 CTGTGGGAAGGAAGCCCTGATGG - Intronic
968081406 3:195849116-195849138 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
968295897 3:197576388-197576410 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
969303510 4:6311309-6311331 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
969420491 4:7091574-7091596 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
969504383 4:7575098-7575120 TTATGGCAATGAAGCCCAGAGGG - Intronic
969634991 4:8363645-8363667 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
970054046 4:11950980-11951002 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
970083266 4:12315150-12315172 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
970225273 4:13850932-13850954 CTTTTGTAATGAAGTCAAGAGGG - Intergenic
970667788 4:18358007-18358029 CTCTGGGATTGTAGTCAAGTGGG + Intergenic
970695676 4:18674099-18674121 TTCTGGGAATTAAGGCAAGATGG + Intergenic
970712267 4:18877046-18877068 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
970880607 4:20925283-20925305 ATCTGGGAATGAAGCCCAGTAGG - Intronic
971005816 4:22373604-22373626 ATCTGGGAATGCAGCCCAGTAGG - Intronic
971006679 4:22382252-22382274 GTCTGGGAATGCAGCCCAGTAGG - Intronic
971215780 4:24661190-24661212 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
971452361 4:26811973-26811995 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
971477651 4:27087485-27087507 GTCTGGGAATGCAGCCCAGCAGG + Intergenic
971998415 4:33996487-33996509 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
972353530 4:38259725-38259747 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
972565724 4:40267389-40267411 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
972822270 4:42715273-42715295 CTCTAGGAATGTAACCCAGAAGG - Intergenic
973010393 4:45065667-45065689 CACTGGGAATGCTGCCAAGAGGG + Intergenic
973795255 4:54418573-54418595 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
973808293 4:54546374-54546396 CTCAGGGAATGAAGTCATTAGGG - Intergenic
973883438 4:55296814-55296836 TTCTGGGAATGCAGCCCAGTAGG - Intergenic
973942805 4:55927355-55927377 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
973986838 4:56362747-56362769 CCCTGGGGGTGGAGCCAAGATGG + Intronic
974029015 4:56759205-56759227 TTCTGGGAATGCAGCCCAGTAGG - Intergenic
974175092 4:58311305-58311327 CTCTGAGGATGAATCAAAGATGG - Intergenic
974412191 4:61556034-61556056 ATCTGGGAATGCAGCCCAGTGGG + Intronic
975494736 4:75025171-75025193 CTCTGTGAATGAAGCTTAGAGGG - Intronic
975528327 4:75375283-75375305 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
976857819 4:89626110-89626132 TTCTGGGAATGCAGCCCAGCAGG - Intergenic
977205828 4:94164141-94164163 ATCTGGGAATGCAGCCCAGGAGG - Intergenic
977590249 4:98818277-98818299 ATCTGGGAATGCAGCCCAGCAGG - Intergenic
977673878 4:99726592-99726614 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
977674783 4:99734838-99734860 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
977874083 4:102129015-102129037 TTCTGGGGAAGAATCCAAGAGGG + Intergenic
978415683 4:108473603-108473625 CTCTGGGTAGGAAGGCAAGGGGG + Intergenic
978800769 4:112753511-112753533 TTCTGGGAATGCAGCCCAGCAGG - Intergenic
978970019 4:114792304-114792326 TTCTGGGAATGCAGCCCAGTAGG + Intergenic
979084020 4:116382887-116382909 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
979505021 4:121485645-121485667 GTCTGGGCATGAAGCAGAGAGGG + Intergenic
979773409 4:124558247-124558269 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
979962418 4:127036691-127036713 GTCTGGGAGTGGAGCAAAGAGGG - Intergenic
980514820 4:133841763-133841785 CTCTCAGAGTGCAGCCAAGAGGG + Intergenic
980625400 4:135369027-135369049 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
980720925 4:136694403-136694425 TACTGGGAATGAAGCCCAGCAGG + Intergenic
980846539 4:138331801-138331823 ATCTGGGAATGCAGCCGAGGGGG + Intergenic
980987711 4:139711719-139711741 GTCTGGGAATGTAGCCCAGTAGG + Intronic
980988194 4:139715893-139715915 GTCTGGGAATGCAGCCCAGTAGG + Intronic
981495743 4:145390494-145390516 CCCTGGGAAGGAAGGAAAGAAGG + Intergenic
982220202 4:153118089-153118111 CTCTGGGAATGCAGCCCAGTAGG - Intergenic
982236240 4:153253579-153253601 ATCTGGGAATGCAGCCCAGTAGG - Intronic
982265846 4:153537751-153537773 GTCTGGGAATGCAGCCCAGTAGG + Intronic
982651648 4:158094837-158094859 CCCTGGGAATGCAGCCCAGCAGG - Intergenic
982689259 4:158529598-158529620 ATCTGGGAAAGAAGCAAAGGAGG - Intronic
983474345 4:168196029-168196051 GCCTGGGCATGAAGCAAAGAGGG - Intergenic
983771498 4:171555348-171555370 TCCTGGGAATGAAGCCCAGTAGG + Intergenic
984441208 4:179773452-179773474 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
984650772 4:182268536-182268558 ATCTGGGAATGCAGCCCAGTAGG - Intronic
984872553 4:184339854-184339876 TCCTGGGAATGCAGCCCAGAAGG + Intergenic
984874733 4:184357020-184357042 CTGTGGGGATGCAGCAAAGATGG + Intergenic
985758494 5:1733122-1733144 CTCTGGGAATGAAGGCTGGGAGG - Intergenic
986143495 5:5053783-5053805 CACTGAGAAAGACGCCAAGAAGG + Intergenic
986288828 5:6381367-6381389 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
986460149 5:7961691-7961713 GTCTGGGAATGTAGCCCAGTAGG + Intergenic
987195369 5:15520278-15520300 ATCTGGGAATGCAGCCCAGTAGG + Intronic
988453029 5:31362268-31362290 TCCTGGGAATGCAGCCCAGAAGG + Intergenic
988622404 5:32836365-32836387 GCCTGGGAATGAAGCCAACATGG + Intergenic
988831304 5:34989959-34989981 TTCTGGGAATGCAGCCCAGGAGG - Intergenic
988989449 5:36655232-36655254 CTCCGGCAAAGAAGCCAAAAGGG - Intronic
989317426 5:40098710-40098732 TTCTGGGAATGCAGCCAAGTAGG - Intergenic
989445850 5:41527411-41527433 TCCTGGGAATGCAGCCAAGCAGG - Intergenic
990076866 5:51856623-51856645 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
990300333 5:54443480-54443502 GTCTGAAAGTGAAGCCAAGAGGG - Intergenic
990384750 5:55249520-55249542 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
992223104 5:74591886-74591908 ATCTGGGAATGCAGCCCAGGAGG + Intergenic
992371293 5:76146652-76146674 TTCTGGGAATGCAGCCCAGTAGG + Intronic
992865840 5:80956453-80956475 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
993108686 5:83629250-83629272 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
993136198 5:83967465-83967487 CTCTAAGAATGAAAACAAGAGGG + Intronic
993718453 5:91298179-91298201 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
993771946 5:91939355-91939377 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
993829895 5:92742108-92742130 GTCTGGGAATGCAGCCCAGCAGG + Intergenic
993980511 5:94538984-94539006 ATCTGGGAATGAAGTCCAGTAGG - Intronic
994088990 5:95791918-95791940 GTCTGGGAATGCAGCCCAGTAGG + Intronic
994356312 5:98797609-98797631 TTCTGGGAATGAAGACAGAATGG - Intronic
994584657 5:101691123-101691145 CACTGAGAATGAAGCCAACATGG + Intergenic
995523542 5:113032684-113032706 ATCTGGGAATGCAGCCCAGTAGG - Intronic
995794900 5:115930759-115930781 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
996140829 5:119906606-119906628 TTCTGGGGATGGAGCCAAGATGG - Intergenic
996143899 5:119949643-119949665 TTCTGGGAATGCAGCCCAGTAGG - Intergenic
996351097 5:122542717-122542739 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
996855472 5:128001138-128001160 TTCTGGGAATAGAGCCAAAATGG + Intergenic
997172787 5:131740734-131740756 ATCTGGGAATGCAGCCCAGTCGG - Intronic
997267824 5:132506659-132506681 CTCTTGGAATGAATGGAAGATGG + Intergenic
997341286 5:133147018-133147040 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
997795964 5:136811288-136811310 CTCTGGGAAAACAGCCAACAAGG - Intergenic
998272689 5:140721086-140721108 CTCTAGAAGAGAAGCCAAGATGG - Intergenic
998273437 5:140728161-140728183 CTCTAGAAGAGAAGCCAAGATGG - Intergenic
998507442 5:142683344-142683366 TTCTGGGAATGCAGCCCAGCAGG - Intronic
998958169 5:147458143-147458165 ATCTGGGAATGCAGCCCAGTAGG - Intronic
999064835 5:148674326-148674348 GTCTGGGGGTGGAGCCAAGATGG - Intronic
999422432 5:151456665-151456687 CTCTGGCAATGAAGCTAGGCAGG + Intronic
999965444 5:156804587-156804609 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1000061316 5:157658817-157658839 GTCTGGGAATGCAGCCTAGTAGG - Intronic
1000415501 5:160980018-160980040 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1000564842 5:162834672-162834694 CCCTGTGAAAGCAGCCAAGACGG - Intergenic
1001131899 5:169071229-169071251 TTCAGGGACTGAAGCCAACATGG - Intronic
1001339471 5:170830114-170830136 TCCTGGGAATGAAGCCCAGTAGG - Intergenic
1001510217 5:172315434-172315456 GTCTGGGAATGAAGCCCAGCAGG - Intergenic
1001717549 5:173828961-173828983 CTCAGACAATGAAACCAAGATGG - Intergenic
1001972665 5:175968831-175968853 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1002029659 5:176418458-176418480 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1002244773 5:177874951-177874973 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1002342143 5:178524237-178524259 CCCTGGGAATGAAGCCAACATGG - Intronic
1002359881 5:178662078-178662100 GTCTGGGAATGCAGCCCAGGAGG + Intergenic
1003123828 6:3339491-3339513 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1003442612 6:6158049-6158071 CTCTGTGAAAGTAGCCACGAGGG + Intronic
1003644689 6:7904999-7905021 CTCTGGGATAGAAGTCAAGCGGG - Intronic
1004389463 6:15197942-15197964 TTCTGGGAATGCAGCCCAGTAGG + Intergenic
1004394990 6:15239800-15239822 CTCTGGTAAAGCAGCCAAGACGG - Intergenic
1004922221 6:20386341-20386363 GCCTGAGAATGAAGCCAACAGGG - Intergenic
1005570063 6:27136349-27136371 CTCTGGGAATGCAGCCCAGTAGG + Intergenic
1005776941 6:29144063-29144085 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1006767022 6:36515373-36515395 CTCTGTGGATGAATCCAAGTTGG + Exonic
1007467929 6:42068045-42068067 CTCTGGAAGTGAAGCTTAGAGGG + Intronic
1007944596 6:45814316-45814338 CTCTGGAAGTAGAGCCAAGAAGG + Intergenic
1008291163 6:49717527-49717549 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1008291610 6:49722507-49722529 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1008559480 6:52709810-52709832 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1008911575 6:56739560-56739582 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1008928087 6:56908640-56908662 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1010234586 6:73564723-73564745 GTCTGGGAATGCCGCCCAGATGG - Intergenic
1010353450 6:74903758-74903780 ATCTGGGGGTGGAGCCAAGATGG + Intergenic
1010445991 6:75949197-75949219 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1010974681 6:82298373-82298395 CTCTGGGCATAAAGACATGAAGG + Intergenic
1011929380 6:92691247-92691269 CTCTGGGAATGCAGCCCAGTGGG - Intergenic
1013179056 6:107702847-107702869 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1014200308 6:118601959-118601981 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1014215454 6:118748683-118748705 CTATGCCAATGCAGCCAAGATGG - Intergenic
1014235845 6:118953628-118953650 CTCTGGAAATACAGCAAAGAGGG + Intergenic
1014565739 6:122945532-122945554 TTCTGAGAGTGGAGCCAAGATGG - Intergenic
1014944566 6:127481797-127481819 ATCTGGGAATGCAGCCCAGTGGG - Intronic
1015105232 6:129528667-129528689 CAATGGGAAGGAAGCAAAGATGG - Intergenic
1015223467 6:130830618-130830640 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1015288288 6:131509336-131509358 CTCTGGGAATGCAGCCCAGTAGG - Intergenic
1015350280 6:132210138-132210160 CTCTGGTCATGAAGCAGAGAGGG + Intergenic
1015632661 6:135247014-135247036 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1016012900 6:139157350-139157372 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1016297115 6:142585340-142585362 TTCTGGGAATGCAGCCTAGTAGG - Intergenic
1016411122 6:143785429-143785451 GTCTGTGAAAGCAGCCAAGAGGG - Intronic
1016521076 6:144947553-144947575 CTCTGAGAATAAAGCAGAGAAGG - Intergenic
1016694513 6:146976943-146976965 CTCTTGGAATGAGGCCATGGCGG - Intergenic
1016832210 6:148445257-148445279 TTCTGGGAATGCAGCCCAGCAGG + Intronic
1017256038 6:152334807-152334829 TTCTGGGAATGCAGCCCAGCAGG + Intronic
1017348846 6:153415901-153415923 TTCTGGGAATGCAGCCCAGTAGG + Intergenic
1017392875 6:153959992-153960014 TCCTGGGAATGAAGCCCAGTAGG - Intergenic
1017464201 6:154679369-154679391 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1017780187 6:157709795-157709817 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1017785674 6:157755222-157755244 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1017900052 6:158711991-158712013 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1018137874 6:160795891-160795913 TTCTGGGAATGCAGCCCAGTAGG - Intergenic
1018138275 6:160800048-160800070 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1018195837 6:161355752-161355774 TTCTGGGATTGGAGCCTAGACGG + Intronic
1018435825 6:163758117-163758139 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1018960422 6:168443449-168443471 CTTGGGGAATGCAGCCAACAGGG - Intronic
1019007297 6:168809699-168809721 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1019038852 6:169086223-169086245 GTCTGGGAATGCAGCCCAGCAGG - Intergenic
1019394238 7:808429-808451 CTCTGGGAGGGGAGCCCAGAAGG - Intergenic
1019750416 7:2725646-2725668 CTCTGGGAGTGGAGCCCACAGGG - Intronic
1019823342 7:3262741-3262763 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1020201062 7:6080487-6080509 CTTTGGGAGTGAGGCCAAGGTGG + Intergenic
1021386727 7:20039786-20039808 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1021583274 7:22179561-22179583 TTCTGGGAATGCAGCCCAGTAGG - Intronic
1022272719 7:28826026-28826048 TTCTGGGAATGCAGCCCAGTAGG - Intergenic
1022373876 7:29795108-29795130 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1022478609 7:30728203-30728225 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1022521228 7:31008209-31008231 CTCTGGGAATGGGATCAAGATGG + Intergenic
1022747294 7:33185262-33185284 TTCTGGGAATGCAGCCCAGTAGG + Intronic
1022925158 7:35049499-35049521 CCCAGGGAATGAAGACATGATGG + Intergenic
1023123632 7:36934066-36934088 CTCTGGGAATGAAGCCAAGAGGG + Intronic
1023366438 7:39468911-39468933 ATCTGAGAAGGAAGCCAAGCAGG - Intronic
1023932906 7:44717357-44717379 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1023933691 7:44723911-44723933 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1024321837 7:48078629-48078651 CTCTGGGCATTTATCCAAGAGGG + Intergenic
1024462957 7:49678987-49679009 CTCTGAGAATGGTGTCAAGATGG + Intergenic
1024484766 7:49905708-49905730 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1024932543 7:54679014-54679036 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1025111192 7:56217726-56217748 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1025241665 7:57281792-57281814 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1026084892 7:67254891-67254913 GTCTGGGAATGCAGCCCAGCAGG + Intergenic
1026118546 7:67516876-67516898 ATCTGGGAATGCAGCCAAGTAGG - Intergenic
1026123808 7:67561830-67561852 TTCTGGGAATGGAGCCCAGCAGG - Intergenic
1026124677 7:67569132-67569154 GTCTGGGAATGCAGCCGAGTAGG + Intergenic
1026126158 7:67581622-67581644 TTCTGGGAATGCAGCCCAGCAGG + Intergenic
1026126544 7:67584570-67584592 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1026227594 7:68456320-68456342 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1026273002 7:68852745-68852767 AGCAGGGAATGCAGCCAAGAAGG + Intergenic
1026306710 7:69148744-69148766 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1026611005 7:71859847-71859869 TCCTGGGAATGCAGCCAAGTGGG - Intronic
1026692282 7:72560029-72560051 GTCTGGGAATGCAGCCCAGCAGG - Intronic
1027616435 7:80430296-80430318 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1027620642 7:80480894-80480916 GTCTGGGAATGAAGCCTAGTGGG + Intronic
1027856116 7:83513921-83513943 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1027958437 7:84913128-84913150 GTCTGGGAATGCAGCCCAGCAGG - Intergenic
1027999731 7:85478661-85478683 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1028029595 7:85893605-85893627 CTCTGGGAATCAAGATAACAAGG - Intergenic
1028458329 7:91062530-91062552 CTGGGGGAGTGGAGCCAAGATGG - Intronic
1028486565 7:91365132-91365154 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1029313089 7:99686016-99686038 CTCGGGGGGTGGAGCCAAGATGG + Intronic
1029493498 7:100884817-100884839 CTCCGAGAAGGAAGCCAAAAAGG + Exonic
1029823178 7:103164203-103164225 CCCAGGGAATGAAGACATGATGG + Intergenic
1030100062 7:105937886-105937908 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1030123126 7:106130087-106130109 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1030224138 7:107130013-107130035 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1030316319 7:108118020-108118042 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1030541443 7:110835428-110835450 CTCTTGGAAAGCTGCCAAGAAGG + Intronic
1031746490 7:125505518-125505540 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1031916318 7:127566120-127566142 CTCTGAGGATGGAGCCAACATGG - Intergenic
1032068404 7:128789905-128789927 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1032088911 7:128900950-128900972 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1032338653 7:131050071-131050093 CTTTGGGAATGCAGCCTAGTAGG + Intergenic
1032349003 7:131142799-131142821 CTCTGGAAAAGAAGCCCACAAGG - Intronic
1032502013 7:132406793-132406815 CTCTGTGAATGAAGGTAAGAAGG + Intronic
1032521460 7:132548731-132548753 TTCTGGGAATGTAGCCCAGTAGG - Intronic
1032671065 7:134082828-134082850 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1032671909 7:134091547-134091569 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1032986801 7:137346191-137346213 TCCTGGGAATGAAGCCCAGTAGG + Intergenic
1033162096 7:139006726-139006748 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1033351470 7:140565728-140565750 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1033433691 7:141313000-141313022 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1033577899 7:142703862-142703884 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1034116261 7:148586436-148586458 GTCTGGGAATGCAGCCCAGTGGG - Intergenic
1034914004 7:155021949-155021971 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1035127693 7:156620326-156620348 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1035307056 7:157940144-157940166 CTCTGAGGATGATGCCCAGAAGG - Intronic
1035326189 7:158067737-158067759 CTCTGGGAAGGAAGCCTGGTGGG - Intronic
1036101540 8:5792428-5792450 GTCTGGGAATGCAGCCTAGTAGG - Intergenic
1036576208 8:10029791-10029813 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1036579513 8:10061027-10061049 CTCTGGGCAGGATGCAAAGAGGG - Intronic
1037492629 8:19410578-19410600 CCTTGGGAAGGAAGACAAGAGGG + Intronic
1037595738 8:20352755-20352777 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1037740937 8:21608804-21608826 CACTGGGAATGGTGCTAAGAAGG - Intergenic
1038125803 8:24671509-24671531 GTCTGGGAATGTAGCCCAGTAGG - Intergenic
1038264791 8:26030143-26030165 TTCTGAAAATGAAGGCAAGAAGG + Intronic
1038455492 8:27669804-27669826 CTCTGGGAAGAAAACAAAGAGGG + Intronic
1038548369 8:28443655-28443677 GTCTGGGAGTGAAGCCCAGTAGG - Intronic
1038655547 8:29447876-29447898 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039533310 8:38284340-38284362 ATGTGGCAATGCAGCCAAGATGG - Intronic
1039621891 8:39005001-39005023 TTCTGGGAATGCAGCCCAGTAGG + Intronic
1039741666 8:40388566-40388588 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1039816383 8:41098276-41098298 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1039963357 8:42266606-42266628 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1040568904 8:48591194-48591216 CTCTGTGAATGTAGGCAGGAAGG + Intergenic
1040854633 8:51936212-51936234 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1041029017 8:53717271-53717293 CACTGGGAATGAGGACAAGAAGG + Intronic
1041035667 8:53786654-53786676 TTCAGGGAGTGGAGCCAAGATGG - Intronic
1041516135 8:58700699-58700721 CCCTGGGAAGGAAGGAAAGAAGG + Intergenic
1041634151 8:60123716-60123738 CTCTTTGTATGAAGCCATGACGG + Intergenic
1041741478 8:61162077-61162099 CTCTGGGAAAGACGGCAAGAAGG - Intronic
1041774527 8:61509621-61509643 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1042125758 8:65535788-65535810 CTCTGGGAATGTAGCCCAGTAGG - Intergenic
1042159076 8:65873892-65873914 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1042873183 8:73416512-73416534 CAATGGGAATGAAATCAAGAGGG + Intergenic
1042970499 8:74402688-74402710 CTTTGGGGAAGGAGCCAAGATGG - Intronic
1043004898 8:74807419-74807441 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1043069312 8:75619149-75619171 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1043070657 8:75631680-75631702 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1043535219 8:81196005-81196027 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1043777820 8:84292489-84292511 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1043839784 8:85089227-85089249 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1044537974 8:93379388-93379410 CTCTGGGAATGCAGGCGAAAGGG - Intergenic
1044657354 8:94562319-94562341 GTCTGGGAATGCAGCCCAGTGGG + Intergenic
1044773215 8:95659526-95659548 ATCTGGGAACGGAGGCAAGAAGG + Intergenic
1044984807 8:97748069-97748091 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1045048476 8:98301582-98301604 ATCTGAGGATGAAGCCCAGATGG - Intergenic
1045428046 8:102086745-102086767 GTCTGGGAATGCAGCCTAGTAGG - Intronic
1045688505 8:104736473-104736495 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1045691426 8:104763697-104763719 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1045862825 8:106832042-106832064 GTTTGGGAATCAATCCAAGAAGG - Intergenic
1045878668 8:107012806-107012828 CTCAGGGAATTAAGCTCAGAGGG + Intergenic
1046007771 8:108506427-108506449 CTCAGGGGGTGGAGCCAAGATGG - Intergenic
1046314252 8:112479067-112479089 CTCTTGTACTGAACCCAAGAAGG - Intronic
1046375555 8:113375612-113375634 CCTTAGGAATGAAGCTAAGAGGG + Intronic
1046494385 8:114994957-114994979 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1046511532 8:115210548-115210570 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1046670124 8:117047732-117047754 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1046884885 8:119355255-119355277 CTCAGAGAATGATGCCAAGCAGG - Intergenic
1046920064 8:119718562-119718584 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1047003380 8:120595208-120595230 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1047526678 8:125640003-125640025 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1049113212 8:140662738-140662760 CTCTGGGTATGATGCTGAGAAGG + Intronic
1049500974 8:142965699-142965721 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1050034923 9:1424851-1424873 ATCTGGGTGTGGAGCCAAGATGG - Intergenic
1050141928 9:2525044-2525066 TCCTGGGAATGAAGCCCAGCAGG - Intergenic
1050741373 9:8824194-8824216 GTCTGGGAATGCAGCCCAGTGGG + Intronic
1051298961 9:15628034-15628056 CACTGGGGAGGGAGCCAAGATGG + Intronic
1051710102 9:19922741-19922763 CTCTAGGAATGAATCCCAGAAGG - Intergenic
1051816413 9:21111929-21111951 CTTTAGGAATGAAGCTATGAAGG - Intergenic
1052520845 9:29547159-29547181 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1052521533 9:29554112-29554134 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1052759837 9:32578934-32578956 ATCTGGGAATGCAGCCCAGTGGG - Intergenic
1052815706 9:33101275-33101297 TTCTGGGAATGCAGCCCAGTAGG + Intergenic
1052891384 9:33703682-33703704 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1053060392 9:35026270-35026292 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1053249096 9:36559646-36559668 TTCTGGGAATGCAGCCTAGTAGG + Intergenic
1054772103 9:69092607-69092629 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1054993386 9:71356099-71356121 CTCTTGAAATCAAGCCAAGCAGG + Intronic
1055048433 9:71954800-71954822 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1055569136 9:77598748-77598770 TTCTGGGAAAAGAGCCAAGAGGG + Intronic
1056391407 9:86144804-86144826 GTCTGGGAATGCAGCCTAGTAGG - Intergenic
1056469852 9:86894763-86894785 ATCTGGGAATGCAGCCCAGCAGG - Intergenic
1056656502 9:88514004-88514026 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1056677821 9:88691207-88691229 ATCTGGGAATGTAGCCCAGTAGG - Intergenic
1056746593 9:89309326-89309348 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1057193480 9:93100249-93100271 CTCAAGGAGTGAACCCAAGAGGG + Intronic
1057314104 9:93958130-93958152 CTTTGGGAATGAGGCCCTGAGGG + Intergenic
1057580179 9:96280685-96280707 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1057596732 9:96420914-96420936 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1058048673 9:100384501-100384523 GTCTGGGAATGGAGCCCAGTAGG - Intergenic
1058291364 9:103244410-103244432 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1058602233 9:106682709-106682731 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1058795846 9:108497776-108497798 CTTTTGGGATGGAGCCAAGATGG + Intergenic
1059022864 9:110595872-110595894 TCCTGGGGATGAAGCCAAGTTGG + Intergenic
1059037812 9:110777167-110777189 CTCTGGGAAAGAATTCAAGAAGG + Intronic
1059586018 9:115607102-115607124 TCTTGGGAATGAAGCCAACATGG + Intergenic
1059838385 9:118183682-118183704 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1060172736 9:121475048-121475070 ATCTGGGAATGCAGCCCAGTGGG - Intergenic
1060681258 9:125567257-125567279 ATCTGGGAATGCAGCCCAGTAGG - Intronic
1060978443 9:127778927-127778949 CTCTGGGAACGGAGCCCAGTGGG + Intergenic
1061069036 9:128297284-128297306 CACTGGGAAGGAAGCCGAGCAGG - Intergenic
1061264971 9:129499583-129499605 CCCTGGGATGGAAGCAAAGAGGG + Intergenic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061362222 9:130150974-130150996 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1061636035 9:131908918-131908940 TCCTGGGAATGCAGCCCAGAAGG + Intronic
1062217153 9:135395396-135395418 GTCTGGGCCTGGAGCCAAGACGG + Intergenic
1185485635 X:479536-479558 TTCTGAGAATGCAGCCCAGAAGG + Intergenic
1185750173 X:2604588-2604610 ATCTGGGAATTCAGCCAAGTAGG - Intergenic
1185769602 X:2755561-2755583 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1185841785 X:3398758-3398780 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1185884663 X:3771809-3771831 GTCTGGGAATGAAGCCCAGTAGG + Intergenic
1186187101 X:7031237-7031259 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1187306048 X:18096243-18096265 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1187872143 X:23773308-23773330 CTCTGAAAATGAAACCAAAATGG + Intergenic
1187963278 X:24586331-24586353 AGCTGGCAATGATGCCAAGAAGG + Intronic
1188289317 X:28368203-28368225 TTCTGGGGGTGGAGCCAAGATGG - Intergenic
1188433959 X:30139275-30139297 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1189086173 X:38026854-38026876 CTCTGGGAATGCAGCCCAGTAGG + Intronic
1189289875 X:39877520-39877542 CTTTGGGAAGGAGGCCAAGGTGG - Intergenic
1189351707 X:40280451-40280473 GTCTGGGAATGCAGCCTAGTAGG - Intergenic
1189390429 X:40571664-40571686 CTCTGGGAAGGCAGCCCAGTAGG + Intergenic
1189419474 X:40843874-40843896 CCCTGGGAATGTAGCCCAGCAGG - Intergenic
1189433747 X:40972759-40972781 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1189480682 X:41390153-41390175 TTCTGGGAATGCAGCCCAGTAGG - Intergenic
1189691070 X:43617330-43617352 ATCTGGGAATGCAGCCCAGCAGG + Intergenic
1189733395 X:44045349-44045371 GTCTGGGAATGCAGCCTAGTAGG - Intergenic
1189965541 X:46368744-46368766 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1189971012 X:46418391-46418413 TTCTGGAAGGGAAGCCAAGAGGG + Intergenic
1190807723 X:53854551-53854573 AACTGGGGGTGAAGCCAAGATGG - Intergenic
1191006029 X:55712323-55712345 GTCTGGGAATGCAGCCCAGCAGG + Intergenic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191174267 X:57482687-57482709 TTGAGGGAATGAAGCCAAGATGG - Intronic
1191636631 X:63384699-63384721 CCCTGGGAATGCAGCCCAGTAGG + Intergenic
1191734794 X:64377358-64377380 GTCTGTGAAAGCAGCCAAGAGGG + Intronic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1192617238 X:72639288-72639310 CTTTGGGAAGGAGGCCAAGGTGG + Intronic
1193551099 X:82893625-82893647 GTCTGGGCATGTAGCAAAGAGGG - Intergenic
1194138695 X:90180586-90180608 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1194296731 X:92134955-92134977 ATCTGGGAATGCAGCCCAGTAGG + Intronic
1194303482 X:92215058-92215080 CACTGGGGAAGCAGCCAAGATGG + Intronic
1194997855 X:100611277-100611299 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1195117085 X:101710278-101710300 TTCTGGGAATGCAGCCCAGTAGG - Intergenic
1195243864 X:102979096-102979118 CTGTGGGACTGAGGCCAAGGAGG + Intergenic
1195877312 X:109555494-109555516 TCCTGGGAATGCAGCCAAGAAGG - Intergenic
1196401776 X:115324281-115324303 ATCTGGGAATGCAGCCAGGTAGG + Intergenic
1196613694 X:117743226-117743248 TCCTGGGTATGAAGCGAAGAGGG - Intergenic
1196700019 X:118658186-118658208 CTTTGATAATGAAGCCAAGAGGG + Intronic
1196896706 X:120344232-120344254 TTCTGGGAGTGGAGCGAAGATGG + Intergenic
1198181576 X:134215056-134215078 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1198497953 X:137212834-137212856 ATCTGGGAATGCAGCCGAGTAGG - Intergenic
1198597299 X:138250364-138250386 CTCTTGGAAGGAAGCAAGGAAGG + Intergenic
1198761428 X:140036785-140036807 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1198774146 X:140161821-140161843 CTCTGGGGATGAGGCCCAGCAGG + Intergenic
1198844451 X:140895489-140895511 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1199064314 X:143396450-143396472 CTCTGGGAATGAATCCACCAAGG - Intergenic
1199404552 X:147441969-147441991 TCCTGGGAATGAAGCCCAGTAGG - Intergenic
1199994309 X:153010584-153010606 ATCTGGGAATGCAGCCCAGTAGG + Intergenic
1200148625 X:153940555-153940577 GTCTGGGAATGCAGCCCAGTAGG - Intronic
1200384761 X:155879585-155879607 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1200484495 Y:3750822-3750844 GTCTGGGAATGCAGCCCAGTAGG - Intergenic
1200614246 Y:5359533-5359555 GTCTGGGAATGCAGCCCAGTAGG + Intronic
1200732681 Y:6759072-6759094 TACTGGGAGAGAAGCCAAGATGG - Intergenic
1201263992 Y:12188196-12188218 TTCTGGGAATGCAGCCCAGTAGG - Intergenic
1201300910 Y:12504068-12504090 ATCTGGGAATGCAGCCCAGTAGG - Intergenic
1201464564 Y:14266291-14266313 CTCTGAGAATGAAGTCATGTAGG + Intergenic
1202304898 Y:23458698-23458720 GTCTGGGAATGCAGCCCAGTAGG + Intergenic
1202565912 Y:26211892-26211914 GTCTGGGAATGCAGCCCAGTAGG - Intergenic