ID: 1023125628

View in Genome Browser
Species Human (GRCh38)
Location 7:36951513-36951535
Sequence GGCCACTGGAACCACCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023125617_1023125628 21 Left 1023125617 7:36951469-36951491 CCTTCCCATCACGTAGCCTTAAT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG No data
1023125615_1023125628 28 Left 1023125615 7:36951462-36951484 CCTACCTCCTTCCCATCACGTAG 0: 1
1: 0
2: 3
3: 13
4: 175
Right 1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG No data
1023125616_1023125628 24 Left 1023125616 7:36951466-36951488 CCTCCTTCCCATCACGTAGCCTT 0: 1
1: 0
2: 0
3: 18
4: 154
Right 1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG No data
1023125621_1023125628 5 Left 1023125621 7:36951485-36951507 CCTTAATCAGTGGTTCTCAATCT 0: 1
1: 0
2: 11
3: 110
4: 518
Right 1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG No data
1023125619_1023125628 16 Left 1023125619 7:36951474-36951496 CCATCACGTAGCCTTAATCAGTG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG No data
1023125618_1023125628 17 Left 1023125618 7:36951473-36951495 CCCATCACGTAGCCTTAATCAGT 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023125628 Original CRISPR GGCCACTGGAACCACCTGGA GGG Intronic
No off target data available for this crispr