ID: 1023136318

View in Genome Browser
Species Human (GRCh38)
Location 7:37056304-37056326
Sequence TGTGAAAAGCTGACCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023136318_1023136319 9 Left 1023136318 7:37056304-37056326 CCAGGCAGGGTCAGCTTTTCACA 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1023136319 7:37056336-37056358 ACAACGAGATAAATAATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023136318 Original CRISPR TGTGAAAAGCTGACCCTGCC TGG (reversed) Intronic
900437441 1:2638079-2638101 TGTGATAAGCTTACCTGGCCAGG + Intronic
900690581 1:3978110-3978132 TGACAAAAGCTGAGCCTTCCAGG + Intergenic
901237100 1:7672969-7672991 TGTGATAGGCAGACCCGGCCTGG - Intronic
901301430 1:8202380-8202402 TGTGCAAAGGTGACCTCGCCTGG - Intergenic
901846516 1:11986390-11986412 TGTGCACAGCTGACTGTGCCTGG - Intronic
904011730 1:27393754-27393776 TGTGAGAAGCTGACCAAGCTGGG - Intronic
904210183 1:28882172-28882194 AGTGCAAAGCTGAGCCTTCCAGG - Intergenic
905174597 1:36127592-36127614 TGTGGAAACCAGACCCTGCATGG + Intergenic
910274371 1:85432508-85432530 TGAAAAAAGCTGACCATTCCAGG - Intronic
1063622948 10:7666364-7666386 TGGGAAAAGCTGAGGCTCCCAGG + Intronic
1070960931 10:80499773-80499795 TGTGAATAGCTGCCCTTTCCTGG - Intronic
1074598005 10:114885097-114885119 TTTTAAAAGGTGACCCGGCCTGG + Intronic
1077037270 11:501466-501488 GCGGAAAAGCAGACCCTGCCTGG + Intronic
1077995591 11:7449655-7449677 TGTGGAAAGCACAGCCTGCCAGG + Intronic
1079644094 11:22842329-22842351 TGTAAAAAGCAGTCCCTCCCTGG + Intergenic
1079946943 11:26755499-26755521 TGTGAAAAGAACACACTGCCTGG + Intergenic
1081583319 11:44367070-44367092 TGGAAGAGGCTGACCCTGCCTGG + Intergenic
1081777784 11:45688008-45688030 AGAGAAAAGCAGCCCCTGCCAGG + Intergenic
1083374136 11:62205881-62205903 TGTACACAGCTGACCCTGGCTGG - Intergenic
1085306587 11:75489711-75489733 TGTGAAGAGGTCAGCCTGCCTGG + Intronic
1085985906 11:81788248-81788270 TGAGAAATACTGATCCTGCCTGG - Intergenic
1089495920 11:118908676-118908698 TGTGAAAAGTTAACCTTGCTAGG + Intronic
1093876054 12:24350637-24350659 GGTTAAAAGCTGACCAGGCCAGG - Intergenic
1097119343 12:56719559-56719581 TGGAAAGTGCTGACCCTGCCGGG - Exonic
1097155868 12:57011958-57011980 TTTGAAAGGCTCAGCCTGCCTGG + Intronic
1098374296 12:69797366-69797388 TATTAAGAGCTGACTCTGCCAGG - Intronic
1099130009 12:78816769-78816791 ATTGAAAAGCTTATCCTGCCTGG + Intergenic
1099164222 12:79282202-79282224 TGTGAATACCTTACCCTGCCTGG - Intronic
1101586980 12:106093722-106093744 TTTTAAAAACTGACCCTTCCTGG - Intronic
1101740698 12:107497696-107497718 ACTGAAAAGCTGTCCCTCCCAGG - Intronic
1102002128 12:109563842-109563864 TGGGAAGGGCTGACCCTGCGGGG + Intronic
1114339593 14:21729311-21729333 TGTGAGAATCTGTCTCTGCCTGG + Intergenic
1114526612 14:23370573-23370595 TGGGAAAAGCCAACCCTTCCTGG + Intergenic
1117715661 14:58577847-58577869 TTTAAAAAGTTGATCCTGCCAGG - Intergenic
1118031113 14:61818785-61818807 TTTGAAAAGCTGACTAAGCCTGG + Intergenic
1119104733 14:71913292-71913314 TGTGTAAGGCTGGCCCTGCAAGG + Intergenic
1119206892 14:72801114-72801136 TGTGAAAAGCTGGCCCTAAAAGG + Intronic
1121520894 14:94585585-94585607 TGTGACAGGCTGCCCCTGCCTGG + Intronic
1121956672 14:98219714-98219736 TGAGAAAACCAGACCCTCCCAGG + Intergenic
1122154494 14:99742135-99742157 TGTGAAGGGCTGGGCCTGCCTGG + Intronic
1125724143 15:41859681-41859703 TGGGGGAAGCTGAGCCTGCCAGG + Intronic
1128411372 15:67401724-67401746 TGTAAAAAGCTGGCCATGACAGG - Intronic
1129152788 15:73699582-73699604 GGTGGAAGGCTGCCCCTGCCTGG - Exonic
1129251138 15:74309554-74309576 TGTGAAAACCTCACAGTGCCTGG + Intronic
1130017646 15:80200149-80200171 TGAGAAAAGCTGAAGGTGCCAGG + Intergenic
1130969187 15:88718815-88718837 TGAGAAAAGGTGACCCAGCTGGG - Intergenic
1133261926 16:4556481-4556503 AGTGAGAAGCTCATCCTGCCAGG - Exonic
1134399687 16:13898419-13898441 GGTGAAAATCAGACTCTGCCAGG + Intergenic
1136281812 16:29217908-29217930 GGTGAAAAGGAGACCCTGCTGGG + Intergenic
1137613557 16:49834652-49834674 TCTGGACAGCTGCCCCTGCCCGG - Intronic
1138272382 16:55704610-55704632 TGTGAAAAGCTGAGTCTACTTGG + Intronic
1142086188 16:88183824-88183846 GGTGAAAAGGAGACCCTGCTGGG + Intergenic
1142229450 16:88892968-88892990 AGTGAAAACCTGAGCCAGCCTGG - Intronic
1142514269 17:416793-416815 TTTGTGAAGCTGACCCTTCCAGG - Intronic
1143466495 17:7140265-7140287 TGTGTAAATCAGACACTGCCTGG - Intergenic
1144068657 17:11646942-11646964 TCTCAGAAGCTGACCCAGCCTGG + Intronic
1144627489 17:16851795-16851817 CTGGACAAGCTGACCCTGCCTGG - Intergenic
1144650162 17:17002249-17002271 TGTGACAAGCGGCCGCTGCCAGG - Intergenic
1144878952 17:18420924-18420946 CTGGACAAGCTGACCCTGCCTGG + Intergenic
1145153284 17:20523470-20523492 CTGGACAAGCTGACCCTGCCTGG - Intergenic
1146306401 17:31732980-31733002 TTTGAAAATCTGAACCTTCCAGG + Intergenic
1149579502 17:57739350-57739372 TCTGAAAATCTAAGCCTGCCAGG + Intergenic
1152803444 17:82342915-82342937 TGCGAACAGCTGACCTTGACAGG + Intergenic
1154476596 18:14765788-14765810 TATGAAAATTTGACCCTTCCAGG + Intronic
1156251323 18:35355315-35355337 TGTGTGAAGCTGACCCTAACTGG - Intergenic
1156568338 18:38221971-38221993 TCTGAAAAGCTGTCATTGCCCGG + Intergenic
1156831260 18:41494227-41494249 TATGAAAATATGACTCTGCCTGG - Intergenic
1164698124 19:30262205-30262227 GGTGAGAGGCTGAGCCTGCCTGG + Intronic
1165110635 19:33500101-33500123 TGTCCAAAGCTGATGCTGCCAGG + Intronic
1165806387 19:38583620-38583642 TGGGAAGGGCTGGCCCTGCCTGG + Intronic
926419374 2:12681827-12681849 TGTGAAAAGATCACTCTGGCTGG + Intergenic
926574768 2:14567757-14567779 TCTGAAGGGCTGACCCTGGCAGG - Intergenic
927474182 2:23400038-23400060 TGTGGCAAGCTCACTCTGCCGGG - Intronic
927838742 2:26423130-26423152 TTTCACAAGCTGACCCTGCTGGG - Intronic
927883974 2:26707232-26707254 CGTGAGCAGCTGACCCTGTCCGG - Intronic
929532209 2:42760415-42760437 CTTGAAGAGCTGACTCTGCCTGG - Intergenic
932439239 2:71721315-71721337 TGTCAAAAGCTGAGCCTCACAGG + Intergenic
933132808 2:78693953-78693975 TGTGGAGAGCTTACACTGCCTGG + Intergenic
933687942 2:85158068-85158090 TCTGTAAAGCTGACCTTCCCAGG - Intronic
935107997 2:100063277-100063299 TTTGCAAAGCTGAAACTGCCTGG - Intronic
935737954 2:106121111-106121133 TGTGAAATGCAGATCCTGGCTGG + Intronic
936263901 2:110985229-110985251 TGTGAGAATCAAACCCTGCCAGG - Intronic
937989932 2:127656708-127656730 TTTGAAAAGGTGACCTGGCCGGG - Intronic
941274491 2:163473655-163473677 TGTTATAAACTGACCCTTCCAGG + Intergenic
941653183 2:168115776-168115798 TGAGAAGAGCTGACACTTCCAGG + Intronic
947759817 2:232595861-232595883 TCTGAGAAGCTGTCCCAGCCAGG + Intergenic
1168861207 20:1047252-1047274 TGGGAAATGTTGACCCTGCCTGG - Intergenic
1169338181 20:4774617-4774639 TTAGAAAAACTGACCCTACCAGG + Intergenic
1169343454 20:4812973-4812995 TGGGAAAAGCAGACCCTGCAGGG + Intronic
1169521469 20:6378089-6378111 TTTGAAAAGTTAACCATGCCAGG - Intergenic
1170028498 20:11918127-11918149 AGTGAAAAGGTCACCTTGCCTGG + Exonic
1170111987 20:12815060-12815082 TGTGAGAAGCCAGCCCTGCCTGG + Intergenic
1171566342 20:26193864-26193886 TATGAAAATCTGACCCATCCAGG + Intergenic
1172842813 20:37912288-37912310 TGTGAGAATCTGACCAAGCCAGG - Intronic
1173491358 20:43485183-43485205 TCTGAAAAGATGACTCAGCCAGG + Intergenic
1173822071 20:46025958-46025980 TGTGAAAAGAGGACCCAGTCCGG + Intronic
1174152314 20:48494130-48494152 GGTGAAAACCTGACCCCACCTGG + Intergenic
1181821427 22:25478790-25478812 AGTGACCAGCTGAGCCTGCCAGG - Intergenic
1182764509 22:32748998-32749020 TGTTAATAGCTGACCCTGCTTGG + Intronic
1184279738 22:43430155-43430177 TGTTAGAAGCTGTCCCTGCCTGG + Intronic
1184668852 22:46002365-46002387 TCTTAAAAGGGGACCCTGCCTGG - Intergenic
951600428 3:24368308-24368330 TGTGACAAGATGACCATGGCAGG + Intronic
953883576 3:46703631-46703653 TGTCAATAGCTCACCCTGGCAGG + Intronic
957846890 3:85748612-85748634 TCTGAAAAACTTTCCCTGCCTGG + Intronic
959458073 3:106588918-106588940 TGTGAAAACCTGACCCAGGAAGG + Intergenic
960286481 3:115835747-115835769 GGAGAAAAGCTGACTCTGCAAGG - Intronic
961740496 3:129030580-129030602 TGTGGGAAGCTGACTCTGCCAGG + Intronic
963005166 3:140720352-140720374 CTTGAAATCCTGACCCTGCCTGG + Intergenic
964167495 3:153726112-153726134 TATGACAACCTGACCCAGCCAGG - Intergenic
964534211 3:157701730-157701752 GGTGAAAAGCAAAACCTGCCAGG - Intergenic
965107196 3:164371883-164371905 TGTGATAAGCACAGCCTGCCAGG - Intergenic
967119142 3:186367210-186367232 TGTGAAAAGCTTCCCCTCCAGGG - Intergenic
973858344 4:55035664-55035686 TGTGAAAAGCTTTCTCTGCCAGG - Intergenic
976149219 4:82076743-82076765 TATGGAAAGCAGACCCTGCCTGG - Intergenic
979136660 4:117118660-117118682 TGTAACATGCTGACCCTGACAGG - Intergenic
988799059 5:34679404-34679426 GGTGAAACCCTGACCCTGCTAGG + Intronic
990601944 5:57367722-57367744 GGTAAACATCTGACCCTGCCTGG + Intergenic
994584794 5:101693203-101693225 TGTGAGAAGCTGTCCCATCCAGG - Intergenic
997857267 5:137383518-137383540 TGTGAAAGGCTGACCTTGCAAGG + Intronic
999514529 5:152287694-152287716 TTGGAGAAGCTCACCCTGCCTGG - Intergenic
999719367 5:154387354-154387376 TGTTAGAAGCTGACTCTGACAGG - Intronic
1000004020 5:157166414-157166436 GGGGAGAGGCTGACCCTGCCTGG + Intronic
1000363326 5:160468046-160468068 GGAGAGAAGCTGACACTGCCAGG + Intergenic
1000738904 5:164939698-164939720 TATTAAAATCTTACCCTGCCAGG - Intergenic
1001034342 5:168286785-168286807 TGTGAGAGGCTGAGGCTGCCAGG - Intergenic
1001334918 5:170789172-170789194 AGTGACAAGCTTTCCCTGCCTGG + Exonic
1001787590 5:174426982-174427004 TGTGAACAGCTGGCTGTGCCAGG - Intergenic
1004045102 6:12015750-12015772 TGTTAGATGTTGACCCTGCCTGG + Intronic
1008156710 6:48024423-48024445 TTTGAAAGGCAGACTCTGCCTGG + Intronic
1009949314 6:70377547-70377569 TCTGAAAAGCTGTCCCTGTCAGG + Intergenic
1010565795 6:77411838-77411860 TATGAAATGCTAACCCTACCTGG + Intergenic
1010935894 6:81861094-81861116 TATGAAAAGCAGACATTGCCTGG + Intergenic
1018080261 6:160253458-160253480 TATGGAAAGCTGCTCCTGCCTGG + Intronic
1019106111 6:169668310-169668332 TGTTAAAAGCCGACACTGACTGG + Intronic
1022730629 7:33020369-33020391 TGTTAGAAGCTGACCCAGGCAGG - Intronic
1023136318 7:37056304-37056326 TGTGAAAAGCTGACCCTGCCTGG - Intronic
1026728974 7:72894801-72894823 TGCGCACAGCTGACCATGCCTGG + Intronic
1033412044 7:141127013-141127035 TGTGTATAGCTGACCTTCCCAGG + Intronic
1035053976 7:156021603-156021625 TGGGAGAAGCTGAGCCCGCCTGG - Intergenic
1035580563 8:737345-737367 CCAGAAAGGCTGACCCTGCCCGG + Intronic
1036287851 8:7460305-7460327 TCTGAAGAGCTGCCCCTTCCTGG - Intronic
1036333625 8:7851223-7851245 TCTGAAGAGCTGCCCCTTCCTGG + Intronic
1036417319 8:8562935-8562957 TGTAAAAATGGGACCCTGCCAGG + Intergenic
1037479246 8:19289008-19289030 TGTGAACAGCTGACCCACCCTGG + Intergenic
1037898083 8:22671541-22671563 TGTGAAAAACTCAGCCTGCAGGG + Intergenic
1039846505 8:41329569-41329591 AGTGAGAGGCTGGCCCTGCCTGG + Intergenic
1039879100 8:41612552-41612574 TGTGTAAAACTGCCCCTCCCTGG - Intronic
1047959781 8:130002800-130002822 TGTAAAAAGCTGAGCTAGCCAGG + Intronic
1049579919 8:143406580-143406602 TGGGAATAGCTGAGGCTGCCTGG - Intergenic
1051707498 9:19895893-19895915 TGTTAGAATTTGACCCTGCCCGG - Intergenic
1056112308 9:83408062-83408084 TGTGAAAAGCAACCTCTGCCTGG - Intronic
1057011417 9:91605738-91605760 AGTCAAAAGTTGACCTTGCCCGG + Intronic
1057035841 9:91811239-91811261 TGGGAAAAGCTGTCCCTCCAGGG + Intronic
1057267883 9:93630900-93630922 TGTGATCAGCTGACCCAGCCAGG - Intronic
1057562603 9:96140108-96140130 TGGGAAACGCTGACCTTGCCAGG - Intergenic
1058885360 9:109318913-109318935 TGGGAAAATCAGAGCCTGCCTGG - Intronic
1059446069 9:114338781-114338803 GGTAAAAAGCTGGCACTGCCTGG + Intronic
1059734873 9:117091000-117091022 GGTGAAAAGCACACTCTGCCTGG - Intronic
1059737015 9:117110986-117111008 TGTGAAAGGCAGGCCCTGACAGG + Intronic
1061041959 9:128145534-128145556 TGTGAGGAGCTTGCCCTGCCAGG - Intergenic
1062197288 9:135281396-135281418 TCTGCAAAGCTGACCCCGTCTGG - Intergenic
1062350284 9:136135370-136135392 TGTGAACCCCTGCCCCTGCCTGG - Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1192196925 X:69034695-69034717 TGGGAGAAGCTGCCCCCGCCAGG - Intergenic
1197153711 X:123247613-123247635 GGTGAAATGCTGTCCCTACCTGG - Intronic
1199734056 X:150667667-150667689 TTTGAAAAGCTTCCACTGCCAGG + Intronic
1200268942 X:154662970-154662992 AGTGATAATCTGACCATGCCAGG + Intergenic
1202109430 Y:21405532-21405554 TGTGTACAGCTAACCCTGCTGGG + Intergenic