ID: 1023137466

View in Genome Browser
Species Human (GRCh38)
Location 7:37066523-37066545
Sequence TTTGAGGCACAGAGGCCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023137466_1023137470 15 Left 1023137466 7:37066523-37066545 CCAGTAGGCCTCTGTGCCTCAAA 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1023137470 7:37066561-37066583 CTAGTGTTCTATACCACCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023137466 Original CRISPR TTTGAGGCACAGAGGCCTAC TGG (reversed) Intronic
900477249 1:2881780-2881802 TCTGGGGTACAGAGGCCTCCTGG - Intergenic
901008636 1:6184624-6184646 GTTGAGGCACAGGGGCTGACTGG - Intronic
903653294 1:24933806-24933828 TATGGGGAACAGAGGCCTCCTGG - Intronic
903741375 1:25560484-25560506 TTTGGAGCCCAGAGGCCTCCCGG - Intronic
910583004 1:88848781-88848803 CATGAGGCACAGAGGCCTCTTGG + Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
914915152 1:151815005-151815027 TTTGAGGAACACAGGCATCCTGG - Exonic
915009856 1:152675466-152675488 GTTGAGGCTCTGAGGCCTACCGG + Intronic
915011013 1:152686294-152686316 GTTGAGGCTGTGAGGCCTACCGG + Intronic
917399083 1:174626290-174626312 TAGGAGGCACTGAGGCCTATGGG - Intronic
918693506 1:187512266-187512288 TTTGGGGCACATAGGAATACAGG + Intergenic
919822908 1:201484163-201484185 TTGGAGGCAGAGAGGCATGCAGG - Exonic
920715768 1:208338591-208338613 ATTGTGGCACAGAGGCCATCTGG + Intergenic
924947255 1:248854983-248855005 TTTGAGGCACAGAAGGCAAGGGG - Intronic
1067290638 10:44937115-44937137 TCTGAGGCACATAGGCTTCCTGG + Intergenic
1067839448 10:49664450-49664472 TTTGAGGCACGGAGGCAATCAGG - Intronic
1068033459 10:51731659-51731681 TCTGATGCACATAGGCATACAGG - Intronic
1069686738 10:70323686-70323708 TTTGAGGCCCTGTTGCCTACCGG - Intronic
1070213293 10:74348513-74348535 TTGGAGGCAAAGAGGCATTCTGG - Intronic
1073031120 10:100526689-100526711 TCTGAGGCACACTGCCCTACAGG + Intronic
1075714124 10:124546100-124546122 TTTGAGGCAGAGTCGCCTGCAGG + Intronic
1076809115 10:132877660-132877682 ACTGAGGCACAGAGGCCAGCCGG + Intronic
1077098474 11:810116-810138 TTTTTGGGACGGAGGCCTACGGG + Intronic
1081490291 11:43562942-43562964 TTTGACTCACAGAAGCCTAGAGG + Intronic
1086889131 11:92236187-92236209 TCTGAGGCCCAGATGCCCACTGG + Intergenic
1092743783 12:11654407-11654429 TTTGGAGGACACAGGCCTACAGG + Intronic
1100726785 12:97417399-97417421 TTGGAGGTACAGAAGCCCACAGG - Intergenic
1107635963 13:42392856-42392878 TTGGAGGCACAGAGGCCTGATGG + Intergenic
1108936693 13:55890918-55890940 TTTGAGGCTCAGAGGCAGAAGGG - Intergenic
1108951722 13:56102595-56102617 TTTGTGGCACAAAAGCCAACTGG - Intergenic
1115112344 14:29839570-29839592 ATGGAGACACAGAGCCCTACTGG - Intronic
1117148980 14:52866182-52866204 GTGTAGGCTCAGAGGCCTACAGG + Intronic
1118720443 14:68590195-68590217 TTGGAAGCACAGAGGCAGACTGG - Intronic
1120444287 14:84574530-84574552 TGTGAGACACAGAGGTCTAAAGG + Intergenic
1121683687 14:95815831-95815853 TTTGAGGGACACAGGCCTAATGG - Intergenic
1122071799 14:99209746-99209768 TTAGAGGCAGAGAGGACAACTGG - Intronic
1122072044 14:99211223-99211245 TCTGAGGCAGAGAGTCCTACGGG - Intronic
1122640343 14:103155876-103155898 TTTGGGGCAGAGAGGCCTGAAGG + Intergenic
1125589589 15:40845990-40846012 TTGTAGGCACAGAAGCCTAGAGG + Intronic
1127187242 15:56492573-56492595 TGGGAGGCACAGAGGAGTACTGG - Intergenic
1129670290 15:77604218-77604240 ATTGAGTCACAGAGGCTTCCTGG + Intergenic
1132364288 15:101245310-101245332 TTTGAGGCAGAGACAACTACAGG - Intronic
1133419051 16:5630102-5630124 TTTGAGGCTCAGAGGCACAGAGG + Intergenic
1137017671 16:35393448-35393470 TTAGGGGCACAGAGGCTTGCGGG - Intergenic
1137591347 16:49695962-49695984 ACTGAGGCACAGAGACCTTCAGG + Intronic
1138571792 16:57879008-57879030 TTTCAAGCACAGAGCCCTTCTGG + Intergenic
1142931116 17:3284730-3284752 TGTGGGTCACTGAGGCCTACAGG + Intergenic
1142944298 17:3411777-3411799 TGTGGGTCACTGAGGCCTACAGG - Intergenic
1144663458 17:17086564-17086586 TCTAAGGCAAAGTGGCCTACAGG - Intronic
1147318134 17:39630607-39630629 TTTGAGGCAAAGAGCCCCAAGGG - Intronic
1149999668 17:61425882-61425904 TCTGAGGCACAGAGGCTAAATGG - Intergenic
1151139811 17:71980421-71980443 TTTGAGACCCAGGAGCCTACAGG - Intergenic
1152379881 17:79936972-79936994 TCTGAGGCAAAGTGGCCTGCAGG + Exonic
1152990907 18:362727-362749 TTTGAAATTCAGAGGCCTACAGG + Intronic
1155346391 18:24861528-24861550 CTTTTGGCACAGAGGCCTAGAGG + Intergenic
1156490350 18:37492258-37492280 TTTGGGGCAGAGGGGCCTTCAGG - Intronic
1157519467 18:48335391-48335413 TCTGAGGCTCAGAGACCTTCAGG + Intronic
1158089167 18:53690605-53690627 ATTGAGGTCCAGAGGCCTACTGG - Intergenic
1159780303 18:72653206-72653228 TGTGAGTGTCAGAGGCCTACTGG + Intergenic
1163685096 19:18708150-18708172 TATGGGGCCCAGAGGCCTACAGG + Intronic
1164516285 19:28938943-28938965 TTGGAGGAGAAGAGGCCTACTGG + Intergenic
1166004476 19:39897569-39897591 TCTTGGGCACAGAGGCCTCCAGG - Intronic
1167708139 19:51093926-51093948 TGGCAGGCACAGAGGCCTGCAGG - Intergenic
1168240959 19:55088712-55088734 CTTGAGGCCCAGAGGCCCAGAGG - Intergenic
928048837 2:27968152-27968174 TTACAGGCCCAGAGGCCTAGGGG + Intronic
930190166 2:48450524-48450546 TATTAGGCACAGTGTCCTACTGG + Intronic
931217084 2:60256074-60256096 TTTTAGGCCAAGAGGCCTTCTGG + Intergenic
931247766 2:60505557-60505579 TTTGAGGGAGAGAGGCCCACTGG - Intronic
932752788 2:74382117-74382139 TTTAAGGCAGTGTGGCCTACAGG - Intronic
932777809 2:74539015-74539037 TTTCAGCCACAAAGGCCTCCTGG + Intronic
933001519 2:76930249-76930271 TTGGAGGCCCAGAGGCCAAAGGG - Intronic
935370122 2:102336705-102336727 ATCCAGGCAGAGAGGCCTACTGG + Intronic
935587235 2:104812434-104812456 TTTGAGGGAAAGGGGCCTTCAGG + Intergenic
936043815 2:109170955-109170977 GCTGAGGCACAGAGGCACACAGG + Intronic
936287237 2:111190296-111190318 TTTGAGGCAAAGATGCCTCTTGG + Intergenic
940534213 2:154917980-154918002 TGTGAGGAAGAGAGGCCTCCTGG - Intergenic
941215885 2:162708427-162708449 ATTGAGGGACACAGGCCTAGAGG + Intronic
943609516 2:190015495-190015517 TCACAGGCCCAGAGGCCTACAGG - Intronic
946118687 2:217489602-217489624 TCTGAGGCACAGAGACCCCCGGG - Intronic
947081516 2:226402377-226402399 ATTGAGGCACAGAGGGCTTTAGG - Intergenic
947588277 2:231370345-231370367 TTTGAGTCACTGAGGCCAAAGGG - Intronic
948263733 2:236622752-236622774 TTTGGGGCCCAGAAGCCTCCTGG + Intergenic
948368108 2:237471795-237471817 CTGGAGCCACAGAGGCCTGCAGG + Intergenic
948837316 2:240632004-240632026 TTTTAGGCACAGAGCCCTTATGG - Intergenic
948928333 2:241114677-241114699 TGTGCGGCACAGCGGCCTGCAGG - Intronic
1171065221 20:22008607-22008629 TATGAGGCACAAAGGTCTCCTGG + Intergenic
1171231303 20:23488718-23488740 TTTCAGGGACATAGGTCTACAGG + Intergenic
1173897061 20:46559173-46559195 TTGCAGCCACAGAGGCCTATGGG + Exonic
1178214678 21:30580887-30580909 TTTGAGGCCCAGATGCCTGGAGG + Intergenic
1180876187 22:19176323-19176345 TGAGAGGCACAGAGGCCTGAAGG + Intronic
1182803310 22:33049874-33049896 TCTGAGACACAGAGGGCAACAGG - Intronic
1182822674 22:33232120-33232142 TTTTAGGCAGAGAGGCAGACTGG - Intronic
950411836 3:12843521-12843543 TTGGTTTCACAGAGGCCTACTGG + Intronic
951047922 3:18062282-18062304 TTAGAGGCACAGAGCCTTAAAGG - Intronic
952959085 3:38578617-38578639 TTTGGAGCACAAGGGCCTACTGG - Intronic
953482592 3:43264420-43264442 TCTGAGCCACAGCTGCCTACTGG + Intergenic
953854770 3:46492851-46492873 TTTGAGACACAGAGACCTAGGGG - Intergenic
956396513 3:68832243-68832265 TTGGAGGAAAAGAGGCCTTCTGG + Intronic
959593572 3:108104767-108104789 TTTGAGGCACTGAGGACTTAAGG - Intergenic
959943103 3:112100117-112100139 GATGAGGCAGAGAGGCCAACAGG - Intronic
961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG + Intronic
965285269 3:166811375-166811397 TTTGAGTCACAGAGGATTATTGG + Intergenic
966918398 3:184597280-184597302 CTTGAGGCCCAGAGGCCCAAAGG - Intronic
967535423 3:190596569-190596591 TTGGTGGCACAGAGGACTAATGG - Intronic
970107023 4:12596140-12596162 TTTGAGGAAAAGAGGCATTCTGG - Intergenic
970520643 4:16880480-16880502 TTTCAGGCACAGAAGGCTATGGG - Intronic
971087534 4:23296349-23296371 TTTGAAGCACATAGACCTGCTGG + Intergenic
972639802 4:40915123-40915145 TTAAAGGCACAGTGGCCTCCAGG + Intronic
978248901 4:106606957-106606979 TTTGAGACACAGAGTCATATGGG - Intergenic
983751607 4:171279893-171279915 TTCAAGGTACAGAGTCCTACTGG - Intergenic
986385422 5:7228485-7228507 TTAGGGCCACAGAGGTCTACTGG + Intergenic
988172997 5:27683137-27683159 TCATAGGCCCAGAGGCCTACTGG - Intergenic
988360144 5:30226821-30226843 TTTAAGGCACAGAGGCTCAGTGG - Intergenic
995291716 5:110463932-110463954 TAGGAGGCACAAAGGCCTCCAGG - Intronic
996598019 5:125227281-125227303 TTTGGGGCACAGAGGGATAATGG + Intergenic
999351370 5:150874719-150874741 CTTGAGGCACAGTGGCAGACAGG + Intronic
999533767 5:152493560-152493582 TTTAAGGCAAAGAGTACTACAGG - Intergenic
1005374403 6:25167363-25167385 TTTGAGGCACAGAATTCTCCAGG - Intergenic
1006436247 6:34027499-34027521 GGTGAGGCAGAGGGGCCTACAGG - Intronic
1008107786 6:47459053-47459075 TTTAAGGCAAAGACACCTACAGG + Intergenic
1008542861 6:52560682-52560704 TCTGAGTCACAGAGGATTACTGG + Intronic
1012273042 6:97238466-97238488 TTTGTGGAAAAGAGGCCCACAGG - Intronic
1016118345 6:140316308-140316330 TTTGTGGCCCTGAGGCCTTCAGG + Intergenic
1019009552 6:168832424-168832446 TCTGAGGCACAGATGGCTTCAGG - Intergenic
1019142916 6:169959605-169959627 TTTGAGACACAGAGGCGGCCCGG - Intergenic
1019747147 7:2707368-2707390 GTTGCGGCACAGAGGCACACCGG - Intronic
1022232952 7:28431749-28431771 TTTTAGGTACAGAGGCGTTCTGG + Intronic
1022945421 7:35279273-35279295 TTTGAGGGAAAGAGTCCTAGGGG + Intergenic
1023137466 7:37066523-37066545 TTTGAGGCACAGAGGCCTACTGG - Intronic
1024631001 7:51247025-51247047 TGTGAGGCACTGAGTCCTGCAGG - Intronic
1025029633 7:55546768-55546790 TTTGAAGCACAGAGCCCAAAGGG + Intronic
1025535271 7:61939880-61939902 TTGGAGTCATTGAGGCCTACTGG + Intergenic
1025968391 7:66297469-66297491 TTTGAGGAACAGAGTCCTCAGGG + Intronic
1032536932 7:132672190-132672212 TTTGAAGAGCAGAGGCCCACAGG - Intronic
1036816136 8:11904219-11904241 TCTGAGTCACAGAGACCTCCAGG - Intergenic
1036983871 8:13503934-13503956 TTTGAGGTACAGTTTCCTACTGG + Intronic
1037735917 8:21566054-21566076 TGTGAAGAAGAGAGGCCTACAGG - Intergenic
1037935556 8:22912981-22913003 TTTGAGGCCCAGAGGCAGAGGGG - Intronic
1038667545 8:29552890-29552912 TTTGAGGCAGAGAGGTCCAGTGG + Intergenic
1039133968 8:34298649-34298671 TTGGAGGAAAAGAGGCATACTGG - Intergenic
1045388566 8:101693127-101693149 TTGGAGACACAGGGGTCTACTGG - Intronic
1045662031 8:104448082-104448104 TTGGAAGCTCAGAGGCCTTCAGG + Intronic
1045886764 8:107107875-107107897 TTTGAGGAACAAAGGGCTTCAGG + Intergenic
1047122034 8:121915447-121915469 TTTCAAGCACAGAAGCCTTCTGG - Intergenic
1047775242 8:128065037-128065059 TCAGAGAAACAGAGGCCTACAGG + Intergenic
1048738630 8:137530209-137530231 TTTTAGGGAGAGAGGTCTACAGG + Intergenic
1048795884 8:138149482-138149504 TTTCAGGCACACAGGCCCTCAGG - Intronic
1051998158 9:23244709-23244731 TCTCAGTCACAGAGGGCTACAGG + Intergenic
1053409779 9:37908355-37908377 TTTGAAACACAGGGTCCTACAGG + Intronic
1055225535 9:73990175-73990197 TTATAGGCCCAGAGGCCTAGGGG - Intergenic
1056105432 9:83342245-83342267 TTTGAGGGAAGGAGGCCTCCAGG - Intronic
1056732896 9:89181152-89181174 TTTGATGCTGAGAGGCCTTCGGG - Intergenic
1057906815 9:98989770-98989792 TGTGAGTCACAGAGTCCTCCAGG + Intronic
1061709292 9:132476678-132476700 TTTGAGGCACAGAGACACACAGG + Intronic
1062248085 9:135580046-135580068 TTCGGGGCACAGTGACCTACAGG - Intergenic
1185639372 X:1578331-1578353 TTTGAGATACAGAGTCCTAGGGG - Intergenic
1186427682 X:9476615-9476637 TTTGAGGCACAGAGGTATGTAGG + Intronic
1187364637 X:18656444-18656466 TTCGAAGCTCAGAGGCCAACTGG + Intronic
1187565072 X:20441467-20441489 TTTGAGCCACAGGGGCATCCAGG - Intergenic
1187720935 X:22150187-22150209 TTTGAGAAGCAGAGCCCTACTGG + Intronic
1190760011 X:53431279-53431301 TATTAGGCACAGAGGGCGACTGG + Exonic
1192078244 X:68022132-68022154 TGTCAGGGACAGAGGCCTAAGGG + Intergenic
1192947620 X:75983156-75983178 GTTGAAACACAGAGGCCTATGGG + Intergenic
1193041170 X:77005348-77005370 TTTGAGGTACTTAGGCCTAGTGG - Intergenic
1196706635 X:118722842-118722864 TTGGAGGCCCACAGGTCTACGGG + Intergenic
1199951084 X:152706664-152706686 TCTGAGACACAGTGGCCAACTGG - Intergenic
1199958600 X:152761797-152761819 TCTGAGACACAGTGGCCAACTGG + Intergenic