ID: 1023141757

View in Genome Browser
Species Human (GRCh38)
Location 7:37109176-37109198
Sequence CCACGTGGCCGCATTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023141757_1023141761 8 Left 1023141757 7:37109176-37109198 CCAGGGACAATGCGGCCACGTGG 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1023141761 7:37109207-37109229 ACTCAGAAGCAAATCTCCCTGGG 0: 1
1: 1
2: 1
3: 16
4: 306
1023141757_1023141764 29 Left 1023141757 7:37109176-37109198 CCAGGGACAATGCGGCCACGTGG 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1023141764 7:37109228-37109250 GGCCAAAGCCCACACTTCAAAGG 0: 2
1: 0
2: 3
3: 18
4: 127
1023141757_1023141760 7 Left 1023141757 7:37109176-37109198 CCAGGGACAATGCGGCCACGTGG 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1023141760 7:37109206-37109228 CACTCAGAAGCAAATCTCCCTGG 0: 1
1: 0
2: 4
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023141757 Original CRISPR CCACGTGGCCGCATTGTCCC TGG (reversed) Intronic